Mna capping enzyme, its preparation and use
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- TSINGHUA UNIVERSITY
- Filing Date
- 2023-03-27
- Publication Date
- 2026-06-19
Smart Images

Figure BDA0004145966540000051 
Figure BDA0004145966540000061 
Figure BDA0004145966540000211
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to mRNA capping enzymes, their preparation methods, and applications. Background Technology
[0002] mRNA was first discovered by Sydney Brenner and Francis Crick in 1960. Unlike the double-stranded, double-helix structure of DNA, mRNA is typically a single-stranded linear polynucleotide chain, accounting for about 3% of total cellular RNA. Due to the AU / GC pairing phenomenon, most mRNAs possess complex secondary structures (hairpins, stem-loops, etc.). mRNA is usually transcribed from deoxyribonucleic acid (DNA) within biological cells. Post-transcriptional modifications of mRNA vary among different cell types, leading to structural differences in mRNA across these organisms. Generally, in non-eukaryotic cells, mRNA requires almost no post-transcriptional modifications. In eukaryotic cells, however, mRNA precursors typically undergo 5' capping, 3' tailing, and intron removal splicing to form mature mRNA. Therefore, for eukaryotic cells, the complete mRNA structure includes a 5' cap, a 5' untranslated region (UTR), a protein-coding sequence (CDS) or open reading frame (ORF), a 3' untranslated region, and a 3' polyadenine tail. According to the central dogma of molecular biology, genetic information is transmitted through transcription from DNA to RNA, and then translation from RNA to protein. Therefore, the primary function of mRNA is as an intermediate carrier of genetic information. This also makes mRNA one of the most unstable types of RNA in cells. Its easily degraded nature allows cells to effectively regulate intracellular mRNA levels, thereby regulating the levels of different proteins and maintaining cellular homeostasis. Currently, mRNA is considered to have enormous application potential in the medical field. It has already been applied in areas such as protein replacement, gene editing, and nucleic acid vaccines.
[0003] Currently, there are two methods for obtaining mRNA in vitro: chemical synthesis and in vitro transcription. Because chemical synthesis yields low output and can only produce mRNA with a length of 50-70 nucleotides, in vitro transcription is the primary method for mRNA synthesis. In vitro transcription generally requires only the following components: DNA template, reaction buffer, and phage RNA polymerase. The DNA template required for in vitro transcription is generally a linear DNA template. Linear DNA templates can be obtained by linearizing pDNA or by polymerase chain reaction (PCR). Linear DNA templates are easily digested with DNase I (Deoxyribonuclease I) after the in vitro transcription reaction, reducing the formation of post-transcribed mRNA dimers. The phage RNA polymerases currently used are typically derived from T7, SP6, or T3 phages. Among them, T7 RNA polymerase is the most common and widely used phage RNA polymerase. In vitro transcription can synthesize longer mRNAs at a lower cost.
[0004] Adding a cap structure to the 5' end of mRNA can spatially protect the mRNA from degradation by exonucleases and enhance the efficiency of the translation process. The 5' cap structure is also known as the 7-methylguanosine cap (m... 7GTP, commonly found in post-transcriptional modifications of mRNA in eukaryotic cells, can bind to the eukaryotic initiation factor 4F (eIF4F) complex, enriching ribosomes and promoting the initiation of translation. The capping reaction mechanism is as follows: Triphosphatase (TPase) catalyzes the removal of γ-phosphate from 5' triphosphate RNA, first generating a 5' diphosphate RNA and inorganic phosphate. Subsequently, guanylyl transferase (GTase) consumes a GTP molecule, forming a covalent intermediate. In the presence of 5' diphosphate RNA, GTase transfers GMP to the 5' diphosphate, thereby forming a triphosphate bond between the first base of the RNA and the cap base. In the presence of S-adenosylmethionine (SAM), guanine-N7-methyltransferase (N7MTase) adds a methyl group to the N7 amine of the guanine cap, forming the cap 0 structure. Finally, the 2'-O-methyltransferase adds a methyl group at the 2'-O position of the first nucleotide adjacent to the cap 0 structure, forming the cap 1 structure. mRNA transcribed in vitro by phage RNA polymerase does not possess a cap structure and requires additional modification. Currently, there are two common methods for in vitro capping: chemical synthesis of cap structure analogs and enzymatic 5' capping. Chemically synthesized cap structure analogs can be added to the 5' end of mRNA via co-transcription with phage RNA polymerase. This co-transcription method significantly reduces the complexity of mRNA production. However, these cap structure analogs are currently too expensive to generate practical commercial value. Furthermore, some cap structure analogs can be retrogradely localized to the 3' end of mRNA. Therefore, enzymatic catalysis is considered a more promising method for 5' capping modification of mRNA. Vaccinia virus capping enzyme (VCE) was the first capping enzyme to be purified and characterized, and it is currently the main commercially available capping enzyme. VCE possesses two subunits, D1 and D12. The D1 subunit is the primary functional subunit, measuring 844 amino acids, and contains the activities of three enzymes: TPase, GTase, and N7MTase, enabling the synthesis of the cap 0 structure in vitro. The D12 subunit is an auxiliary subunit, measuring 287 amino acids, and binds to the N7MTase domain of the D1 subunit. Because VCE can only synthesize the cap 0 structure, a 2'-O-methyltransferase is typically added during the in vitro capping reaction to ultimately form the cap 1 structure. This enzyme-catalyzed capping method is relatively low-cost.However, the activity of commercially available capping enzymes is currently limited, and higher capping efficiency needs to be achieved by increasing the amount of capping enzyme used or extending the reaction time. Summary of the Invention
[0005] The purpose of this invention is to provide mRNA capping enzymes, their preparation methods, and applications.
[0006] In a first aspect, the present invention claims a method for preparing a soluble mRNA capping enzyme.
[0007] The method for preparing soluble mRNA capping enzymes claimed in this invention may include the following steps:
[0008] (A1) The gene encoding the fusion protein was introduced into E. coli recipient cells to obtain recombinant E. coli; the fusion protein was formed by fusing the solubilization tag MBP and a viral capping enzyme via a linker peptide; the viral capping enzyme was selected from any of the following: a capping enzyme derived from Bluetongue virus, a capping enzyme derived from Faustovirus, a capping enzyme derived from African swine fever virus, or a capping enzyme derived from Chlorella virus;
[0009] (A2) The recombinant Escherichia coli was induced to express the protein, the bacterial cells were collected and lysed, and the fusion protein was obtained from the supernatant after centrifugation. This protein is a soluble mRNA capping enzyme.
[0010] Furthermore, the fusion protein is formed by sequentially linking the solubilizing tag MBP, the linker peptide, and the virus-derived capping enzyme from the N-terminus to the C-terminus.
[0011] Furthermore, the amino acid sequence of the capping enzyme derived from Bluetongue virus is shown in positions 1-644 of SEQ ID No. 1 or SEQ ID No. 1.
[0012] Furthermore, the amino acid sequence of the capping enzyme derived from Faustovirus is shown in positions 1-879 of SEQ ID No. 2 or SEQ ID No. 2.
[0013] Furthermore, the amino acid sequence of the capping enzyme derived from African swine fever virus is shown in positions 1-868 of SEQ ID No. 3 or SEQ ID No. 3.
[0014] Furthermore, the amino acid sequence of the capping enzyme derived from Chlorella virus is shown in positions 1-330 of SEQ ID No. 4 or SEQ ID No. 4.
[0015] Furthermore, the amino acid sequence of the solubilizing tag MBP is shown in SEQ ID No. 5.
[0016] Furthermore, the linker peptide is a flexible linker peptide; even further, the amino acid sequence of the linker peptide is shown in SEQ ID No. 6.
[0017] Furthermore, the gene encoding the fusion protein may be any of the following:
[0018] (B1) The nucleotide sequence is as shown in positions 1-3063 of SEQ ID No. 7 or SEQ ID No. 7;
[0019] (B2) The nucleotide sequence is as shown in positions 1-3768 of SEQ ID No. 8 or SEQ ID No. 8;
[0020] (B3) The nucleotide sequence is as shown in positions 1-3735 of SEQ ID No. 9 or SEQ ID No. 9;
[0021] (B4) The nucleotide sequence is as shown in positions 1-2121 of SEQ ID No. 10 or SEQ ID No. 10.
[0022] In SEQ ID No. 7, positions 1-1101 are nucleotide sequences encoding the solubilizing tag MBP, positions 1102-1131 are nucleotide sequences encoding the linker peptide, and positions 1132-3081 are nucleotide sequences encoding the capping enzyme (SEQ ID No. 1, containing the His tag) derived from Bluetongue virus.
[0023] The first 1-1101 positions of SEQ ID No. 8 are nucleotide sequences encoding the solubilizing tag MBP, the first 1102-1131 positions are nucleotide sequences encoding the linker peptide, and the first 1132-3786 positions are nucleotide sequences encoding the capping enzyme (SEQ ID No. 2, containing the His tag) derived from Faustovirus.
[0024] Positions 1-1101 of SEQ ID No. 9 are nucleotide sequences encoding the solubilizing tag MBP, positions 1102-1131 are nucleotide sequences encoding the linker peptide, and positions 1132-3753 are nucleotide sequences encoding the capping enzyme (SEQ ID No. 3, containing the His tag) derived from African swine fever virus.
[0025] The first 1-1101 positions of SEQ ID No. 10 are nucleotide sequences encoding the solubilizing tag MBP, the first 1102-1131 positions are nucleotide sequences encoding the linker peptide, and the first 1132-2139 positions are nucleotide sequences encoding the capping enzyme (SEQ ID No. 4, containing the His tag) derived from Chlorella virus.
[0026] Further, in step (A1), the gene encoding the fusion protein can be introduced into the E. coli recipient cells via a recombinant vector.
[0027] In a specific embodiment of the present invention, the recombinant vector is obtained by inserting the coding gene of the fusion protein into the multiple cloning site of pET-21a(+) (for fusion expression with a downstream His tag, the His tag being used for purification).
[0028] In a specific embodiment of the present invention, the Escherichia coli recipient cell is Escherichia coli BL21(DE3).
[0029] Further, in step (A2), the induced expression is non-low-temperature induced expression. The conditions for induced expression are: expression induced by 1 mM IPTG at 37°C for 2 hours.
[0030] Secondly, the present invention claims protection for soluble mRNA capping enzymes prepared using the method described in the first aspect above.
[0031] Thirdly, the present invention claims protection for a complete product for preparing the soluble mRNA capping enzyme described in the second aspect above.
[0032] The kit for preparing the soluble mRNA capping enzyme described in the second aspect above, as claimed in this invention, may include:
[0033] (C1) The recombinant vector described in the first aspect above;
[0034] (C2) The Escherichia coli receptor cells described in the first aspect above.
[0035] Depending on the requirements, the complete product may also include IPTG.
[0036] Fourthly, the present invention claims the use of the soluble mRNA capping enzyme described in the second aspect above in the 5' end capping modification of mRNA.
[0037] Furthermore, the mRNA with the 5' end capped is an mRNA obtained through in vitro transcription.
[0038] Fifthly, the present invention claims a method for in vitro transcription-capping of mRNA.
[0039] The in vitro transcription-capping method for mRNA claimed in this invention may include the following steps:
[0040] S1. Prepare T7 RNA polymerase according to the following steps:
[0041] (a1) The encoding gene of T7 RNA polymerase fused with a purification tag was introduced into Escherichia coli recipient cells to obtain recombinant Escherichia coli; wherein the T7 RNA polymerase fused with the purification tag is T7 RNA polymerase with a 6His tag or an 8His tag fused to the N-terminus.
[0042] (a2) The recombinant Escherichia coli was induced to express, the bacterial cells were collected and lysed, and the T7 RNA polymerase was obtained by centrifugation and purification from the supernatant.
[0043] The T7 RNA polymerase can be stored in TSB solution, but it cannot be stored in PBS solution. Storing it in PBS solution will inactivate it.
[0044] S2. Prepare mRNA capping enzyme according to the method described in the first aspect above;
[0045] S3. First, the T7 RNA polymerase prepared in S1 is used for in vitro transcription of mRNA. Then, the mRNA capping enzyme prepared in S2 is used to modify the 5' end of the in vitro transcribed mRNA by capping.
[0046] Further, in step (a1), the encoding gene of the T7 RNA polymerase fused with the purified tag is introduced into E. coli recipient cells via a recombinant vector.
[0047] In a specific embodiment of the present invention, the recombinant vector is obtained by inserting the coding sequence of a 6His tag or an 8His tag upstream of the T7 RNA polymerase coding gene in pAR1219 and then expressing it via fusion. The expressed 6His tag or 8His tag is fused to the N-terminus of the T7 RNA polymerase.
[0048] Sixthly, the present invention claims a kit for in vitro transcription-capping of mRNA.
[0049] The kit for in vitro transcription-capping of mRNA claimed in this invention may include:
[0050] (D1) The T7 RNA polymerase fused with the purified tag, as described in the first aspect above;
[0051] (D2) The soluble mRNA capping enzyme described in the first aspect above.
[0052] This invention utilizes different protein expression systems, such as Pichia pastoris and Escherichia coli, to heterologously express mRNA capping enzymes from various viral sources. Based on this, a solubilizing tag is introduced to improve the solubility of the heterologously expressed mRNA capping enzymes. Subsequently, mRNA was obtained using a self-constructed in vitro transcription system, and capping was performed using mRNA capping enzymes from different viral sources. The results showed that ASF, BLUE, CHL, and FAU, after fusing with the solubilizing tag MBP, successfully expressed a certain amount of soluble mRNA capping enzymes in E. coli. Furthermore, a T7 in vitro transcription system was constructed, and a mammalian cell expression system based on HEK293T was selected for mRNA translation expression. mRNA capping enzymes derived from Bluetongue virus and Faustovirus were shown to have higher capping activity than the vaccinia virus capping enzyme VCE. Specifically, the activity of the bluetongue virus mRNA capping enzyme was 38% higher than that of VCE. This invention is of great significance for enhancing the stability of linear mRNA and improving its translation efficiency in vivo. Attached Figure Description
[0053] Figure 1 The following figures show the expression of mRNA capping enzymes in Pichia pastoris. (a) SDS-PAGE results of mRNA capping enzymes from different sources secreted in P. pastoris X33. (b) Western blot results of mRNA capping enzymes from different sources secreted in P. pastoris X33. (c) SDS-PAGE results of intracellular expression of mRNA capping enzymes from different sources in P. pastoris X33. (d) The numbers and corresponding molecular weights of mRNA capping enzymes from different sources in figures (a)-(c).
[0054] Figure 2The expression of mRNA capping enzymes in *E. coli* is shown. (a) SDS-PAGE results of mRNA capping enzymes from different sources expressed in BL21(DE3). (b) Western blot results of mRNA capping enzymes from different sources expressed in BL21(DE3). (c) The numbers and corresponding molecular weights of mRNA capping enzymes from different sources in (a) and (b) are shown.
[0055] Figure 3 The results of the low-temperature induction experiment of mRNA capping enzymes are shown. (a) SDS-PAGE results of the low-temperature induction experiment of mRNA capping enzymes. "T" at the top of the image indicates the whole protein sample, and "S" indicates the supernatant sample. (b) The molecular weights of mRNA capping enzymes from different sources are shown.
[0056] Figure 4 The images show the results of intracellular expression experiments of *E. coli* after fusing mRNA capping enzymes with lysing tags. "T" at the top of the images indicates the whole protein sample, and "S" indicates the supernatant sample. (a) SDS-PAGE results of the mRNA capping enzyme ASF. (b) SDS-PAGE results of the mRNA capping enzyme BLUE. (c) SDS-PAGE results of the mRNA capping enzyme RICE. (d) SDS-PAGE results of the mRNA capping enzyme ROT. (e) SDS-PAGE results of the mRNA capping enzyme COW. (f) SDS-PAGE results of the mRNA capping enzyme CHL. (g) SDS-PAGE results of the mRNA capping enzyme FAU. (h) Molecular weights after fusing different mRNA capping enzymes with lysing tags.
[0057] Figure 5 Construction and expression of VCE. (a) pRSFDuet-1 plasmid vector. (b) SDS-PAGE results of purified mRNA capped with the enzyme VCE.
[0058] Figure 6 The results are from in vitro transcription using T7 RNA polymerase. In the figure, N8 represents the purification tag N8xHis, N6 represents the purification tag N6xHis, NS represents the purification tag NStrepII, C8 represents the purification tag C8xHis, C6 represents the purification tag C6xHis, and CS represents the purification tag CStrepII.
[0059] Figure 7Transfection efficiencies of HEK293T and HEK293F cells using different transfection reagents. (a) Comparison of transfection efficiencies of HEK293T and HEK293F cells using different transfection reagents. The negative control is cells without transfection reagent. The Thermo transfection reagent used for HEK293T is Lipofectamine™ MessengerMAX™ Transfection Reagent. The Thermo transfection reagent used for HEK293F is ExpiFectamine™ 293 Transfection Kit. (b) Flow cytometry results of HEK293T cells transfected with different transfection reagents. (c) Flow cytometry results of HEK293F cells transfected with different transfection reagents.
[0060] Figure 8 The expression of mRNAs after capping with different mRNA capping enzymes in cells. (a) Comparison of relative fluorescence values of mRNAs expressed with different mRNA capping enzymes in HEK293T cells. The relative fluorescence value was selected as the baseline "1" for the experimental results of the vaccinia virus capping enzyme VCE. (b) Flow cytometry results of mRNA expression with different mRNA capping enzymes in HEK293T cells. Detailed Implementation
[0061] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0062] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0063] Example 1: Heterologous expression and screening of mRNA capping enzymes
[0064] I. Heterologous expression of mRNA capping enzymes
[0065] 1. Capping enzymes of mRNA from different sources
[0066] The mRNA capping reaction requires the capping enzyme to possess the activities of several enzymes, including TPase, GTase, and MTase. Compared to eukaryotic mRNA capping enzymes, viral-derived mRNA capping enzymes exhibit higher functional integration and are more conducive to exerting their activity in vitro. This invention searches for viral-derived mRNA capping enzymes with similar activities from various protein / enzyme databases. These databases include the BRENDA Enzyme Database (http: / / www.brenda-enzymes.org), the RCSB Protein Database (http: / / www.pdbus.org), and the National Center for Biotechnology Information (NCBI) (https: / / www.ncbi.nlm.nih.gov). The selected mRNA capping enzymes from different viral sources are shown in Table 1.
[0067] Table 1. Capping enzymes on mRNA from different viral sources
[0068]
[0069]
[0070] mRNA capping enzymes from different viral sources may have a sequence similarity of 99%, so only one of them was selected for subsequent screening and verification.
[0071] 2. Heterologous expression of mRNA-capped enzymes based on Pichia pastoris system
[0072] Yeast, as a single-celled eukaryotic organism, possesses a relatively complete gene expression regulation mechanism. Furthermore, yeast cells can perform subsequent processing and modification of translated proteins, such as glycosylation. Pichia pastoris, a type of yeast that can utilize methanol as its sole carbon and energy source, has been widely used industrially. Therefore, the laboratory-stored Pichia pastoris X33 strain was preferentially used as the host cell for heterologous expression of mRNA capping enzymes. P. pastoris X33 possesses the AOX1 promoter, which can tightly regulate the expression of the target protein. In addition, P. pastoris X33 allows for high-density yeast cell culture and efficient expression of exogenous proteins.
[0073] The constructed mRNA capping enzyme gene sequences from different sources underwent codon optimization based on the *P. pastoris* host. The specific sequences are as follows:
[0074] ASF:
[0075]
[0076] BLUE:
[0077]
[0078] RICE:
[0079]
[0080] ROT:
[0081]
[0082] COW:
[0083]
[0084] CHL:
[0085]
[0086] FAU:
[0087]
[0088] The vector used for construction was pPICZalpha A. The MCS region was replaced with the target mRNA capping enzyme gene sequence, but c-Myc was not retained. Since the His-tag (histidine tag) on the pPICZalpha A vector is only 6×His, the terminal His may be cleaved during subsequent protein expression and modification, preventing the remaining His-tag from binding to subsequent affinity groups. Therefore, the His-tag on the vector was not retained during construction; instead, a self-designed 8×His tag was introduced for subsequent validation. The alpha-factor is a secretion signal peptide used to secrete the target protein. Since there is no natural plasmid in *P. pastoris* X33, the constructed plasmid was linearized using the SacI restriction enzyme. The linearized exogenous gene expression framework was integrated into the *P. pastoris* X33 genome via electroporation to obtain *Pichia pastoris* cells containing the target protein gene sequence.
[0089] Pichia pastoris containing the target protein gene sequence was cultured for 72 h, and the supernatant was collected by centrifugation and concentrated to 1 mL using an ultrafiltration tube. The obtained sample was then validated by SDS-PAGE. Figure 1 (a) No obvious target protein band was found on the gel image. A possible reason for this result is that the heterologous mRNA capping enzyme is expressed at low levels in *P. pastoris* X33, and even after concentration via ultrafiltration, it cannot be detected by SDS-PAGE. Because a self-designed 8×His tag was introduced during plasmid construction, the sample can be further characterized by Western blot. Figure 1 (b)). The results still did not show the target protein band, only bands of some other proteins. This indicates that the heterologous mRNA capping enzyme did not achieve secretory expression in *P. pastoris* X33. The reason for the failure of the heterologous mRNA capping enzyme to achieve secretory expression may be that the mRNA capping enzyme is not suitable for secretory expression and cannot successfully cross the cell membrane to be secreted from the yeast cell to the extracellular space. Based on the above conjecture, the alpha-factor in the constructed plasmid was removed by PCR and Gibson assembly to obtain a target plasmid that does not contain the secretion signal peptide. The constructed plasmid was linearized again with SacI endonuclease and integrated into the *P. pastoris* X33 genome by electroporation to obtain *P. pastoris* cells containing the target protein gene sequence. After culturing for 72 h, the supernatant was collected by centrifugation and concentrated to 1 mL using an ultrafiltration tube. The obtained sample was verified by SDS-PAGE. Figure 1(c) Analysis of the protein bands in the figure revealed no band of the target mRNA-capping enzyme, only bands of miscellaneous proteins found in *P. pastoris* X33 cells. The results indicate that even after removing the secretory signal peptide, the heterologous mRNA-capping enzyme was not successfully expressed in *P. pastoris* X33 cells. Two possible reasons for this are: firstly, the heterologous mRNA-capping enzyme is not suitable for expression in *P. pastoris* X33 cells; and secondly, the pPICZalpha A vector itself is not suitable for the expression of heterologous mRNA-capping enzymes. Based on these experimental results and conclusions, a new expression host needs to be found for the heterologous expression of the heterologous mRNA-capping enzyme.
[0090] 3. Heterologous expression of mRNA capping enzymes based on E. coli system
[0091] Bacteria, as a class of prokaryotes, are characterized by simple structure, rapid reproduction, and diverse species, and are currently widely used in industrial production. Among them, *Escherichia coli* (E. coli) is one of the most widely used engineered bacteria, often used for the expression of heterologous proteins. *E. coli* has a clear genetic background, mild culture conditions, and can be easily amplified and expressed using exogenous plasmids. Therefore, the laboratory-stored BL21(DE3) strain was selected as the host cell for heterologous expression of mRNA capping enzymes. The BL21(DE3) strain is a derivative of the BL21 strain. BL21 is currently the most widely used host cell, lacking the lon and ompT proteases, which can increase the yield of recombinant proteins and is typically used for the expression of non-toxic proteins. The BL21(DE3) strain integrates the gene encoding T7 RNA polymerase into the BL21 strain, thus it can be used for expression in plasmid vectors containing the T7 promoter.
[0092] The constructed mRNA capping enzyme genes from different sources underwent codon optimization based on the E. coli host. The specific sequences are as follows:
[0093] ASF: Positions 1132-3753 of SEQ ID No. 9.
[0094] BLUE: Positions 1132-3081 of SEQ ID No. 7.
[0095] RICE:
[0096]
[0097] ROT:
[0098]
[0099] COW:
[0100]
[0101] CHL: Positions 1132-2139 of SEQ ID No. 10.
[0102] FAU: Positions 1132-3786 of SEQ ID No. 8.
[0103] The vector used for construction was pET-21a(+). The MCS region was replaced with the target mRNA capping enzyme gene sequence, with Nde I retained at the 5' end and Xho I retained at the 3' end. The His-tag on the vector was retained for subsequent characterization and purification.
[0104] The correctly constructed target plasmid (i.e., the recombinant plasmid obtained by inserting the optimized mRNA capping enzyme gene into the Nde I and Xho I restriction sites of the pET-21a(+) vector), verified by sequencing, was chemically transformed into BL21(DE3) competent cells and induced for expression (at 37°C, 1 mM IPTG for 2 hours). Cells were lysed after induction, and the total protein sample containing the lysate and the supernatant after centrifugation were subjected to SDS-PAGE verification. Figure 2 (a)). The experimental results of the whole protein samples in the figure show that all heterologous mRNA capping enzymes were successfully expressed in BL21(DE3). The protein bands of ASF, BLUE, RICE, and CHL were darker, indicating high expression levels of these four mRNA capping enzymes in BL21(DE3) cells. Although the protein bands of ROT, COW, and FAU were lighter, they also showed some expression levels. However, the SDS-PAGE results of the supernatant samples showed that only the CHL protein band was darker, while the other six mRNA capping enzymes did not show obvious protein bands. The experimental results indicate that only CHL has good solubility, while the other heterologously expressed mRNA capping enzymes have poor solubility. This may be because the CHL protein has a smaller molecular weight and is more easily soluble in the supernatant. Further Western blot validation was performed on the supernatant samples of the six poorly soluble mRNA capping enzymes. Figure 2(b) The primary antibody was Anti-his Tag Monoclonal antibody, EarthOx, LLC, catalog number: E022020. The secondary antibody was HRP AffiniPure Goat Anti-Mouse IgG (H+L), EarthOx, LLC, catalog number: E030110. Western blot results showed that all six mRNA capping enzymes had corresponding protein bands, indicating that all six mRNA capping enzymes were present in the supernatant. The protein bands of ASF and FAU were darker, indicating that the solubility of these two mRNA capping enzymes was higher than that of BLUE, RICE, ROT, and COW. Based on the results of SDS-PAGE and Western blot experiments, the following two conclusions can be drawn: First, heterologous mRNA capping enzymes can be successfully expressed in BL21(DE3), and BL21(DE3) can serve as a heterologous expression host for mRNA capping enzymes; second, except for CHL, although heterologous mRNA capping enzymes are expressed, their solubility is poor. Based on the above experimental results, it is necessary to further improve the solubility of heterologous mRNA capping enzymes.
[0105] 4. Strategies to improve the solubility of mRNA-capped enzymes
[0106] Inducing protein expression at lower temperatures is a common method to improve the solubility of heterologously expressed proteins. Therefore, the first strategy used to improve the solubility of heterologously expressed mRNA-capped enzymes was low-temperature induction. Compared to the original induction conditions, low-temperature induction requires a lower temperature and a longer induction time. The original induction conditions were induction at 37°C for 2 hours. Here, the low-temperature induction conditions were induction at 20°C for 6 hours. Except for the induction temperature and time, all other operations were the same as in step 3. After lysing the collected cells, the whole protein samples and supernatant samples were subjected to SDS-PAGE verification. Figure 3The figure shows that the whole-protein samples of four mRNA capping enzymes (ASF, BLUE, COW, and CHL) exhibit distinct target protein bands, while RICE, ROT, and FAU do not show distinguishable target protein bands in the whole-protein samples. Furthermore, the supernatant samples of all seven mRNA capping enzymes did not show distinct target protein bands. These experimental results indicate that under low-temperature induction conditions, only four mRNA capping enzymes (ASF, BLUE, COW, and CHL) achieved heterologous expression in BL21(DE3). The low-temperature induction strategy did not improve the solubility of mRNA capping enzymes during heterologous expression. Moreover, the low-temperature induction strategy actually inhibited the expression of mRNA capping enzymes in BL21(DE3). A possible reason for this phenomenon is that at 20℃, the activity of some enzymes in BL21(DE3) is inhibited, and even extending the reaction time cannot achieve heterologous expression of mRNA capping enzymes. Based on these results, it is necessary to find new strategies to improve the solubility of mRNA heterologous expression.
[0107] Fusion of solubilizing tags to the ends of target proteins is also a common strategy to improve protein solubility. These solubilizing tags not only enhance the solubility of the target protein but can also be used as purification tags in subsequent protein purification processes. Solubilizing tags are typically added to the N-terminus of the target protein and linked to it via a linker. Currently, various solubilizing tags have been developed to improve protein solubility. However, the solubilizing effects of these tags vary for different proteins and may have some impact on the activity of the target protein. Therefore, four solubilizing tags were selected to investigate their solubilizing effects on heterologous expression of mRNA capping enzymes (Table 2).
[0108] Table 2. Solubility Labels
[0109] Solubility label abbreviation size source Small ubiquitin modified SUMO 10.6kDa Escherichia coli Maltose-binding protein MBP 40.3kDa Homo sapiens Thioredoxin A TrxA 11.8kDa Escherichia coli Glutathione-S-transferase GST 25.5kDa Schistosoma japonicum
[0110] The coding nucleic acid sequence of the lysis tag has been codon-optimized based on the E. coli host. The optimized sequence is as follows:
[0111] SUMO:
[0112] Atggccgacgaaaagcccaaggaaggagtcaagactgagaacaacgatcatattaatttgaaggtggcggggcaggatggttctgtggtgcagtttaagattaagaggcatacaccacttagtaaactaatgaaagcctattgtgaacgacagggattgtcaatgaggcagatcagattccgatttgacgggcaaccaatcaatgaaacagacacacctgcacagttggaaatggaggatgaagatacaattgatgtgttccaacagcagacgggaggt
[0113] MBP:
[0114]
[0115] TrxA:
[0116] Atgagcgataaaattattcacctgactgacgacagttttgacacggatgtactcaaagcggacggggcgatcctcgtcgatttctgggcagagtggtgcggtccgtgcaaaatgatcgccccgattctggatgaaatcgctgacgaatatcagggcaaactgaccgttgcaaaactgaacatcgatcaaaaccctggcactgcgccgaaatatggcatccgtggtatcccgactctgctgctgttcaaaaacggtgaagtggcggcaaccaaagtgggtgcactgtctaaaggtcagttgaaagagttcctcgacgctaacctggcc
[0117] GST:
[0118] atgtcccctatactaggttattggaaaattaagggccttgtgcaacccactcgacttcttttggaatatcttgaagaaaaatatgaagagcatttgtatgagcgcgatgaaggtgataaatggcgaaacaaaaagtttgaattgggtttggagtttcccaatc ttccttattatattgatggtgatgttaaattaacacagtctatggccatcatacgttatatagctgacaagcacaacatgttgggtggttgtccaaaagagcgtgcagagatttcaatgcttgaaggagcggttttggatattagatacggtgtttcgagaatt gcatatagtaaagactttgaaactctcaaagttgattttcttagcaagctacctgaaatgctgaaaatgttcgaagatcgtttatgtcataaaacatatttaaatggtgatcatgtaacccatcctgacttcatgttgtatgacgctcttgatgttgttttat acatggacccaatgtgcctggatgcgttcccaaaattagtttgttttaaaaaacgtattgaagctatcccacaaattgataagtacttgaaatccagcaagtatatagcatggcctttgcagggctggcaagccacgtttggtggtggtggcgaccatcctccaaaa
[0119] The lysin is attached to the N-terminus of the target protein via a flexible linker (amino acid sequence: GGGGSGGGGS, i.e., SEQ ID No. 6; corresponding nucleotide sequence: GGTGGAGGCGGTTCAGGCGGAGGTGGCTCT). The constructed C-terminal His-tag of the target protein is retained for subsequent characterization and purification.
[0120] The correctly constructed plasmid (i.e., the recombinant plasmid obtained by inserting the "solubilizing tag-flexible linker-capping enzyme" nucleotide sequence with the stop codon removed between the Nde I and Xho I restriction sites of the pET-21a(+) vector) was chemically transformed into BL21(DE3) competent cells and induced for expression at 37°C with 1 mM IPTG for 2 h. Cells were lysed after induction, and the whole protein sample containing the lysate and the supernatant after centrifugation were subjected to SDS-PAGE verification. Figure 4 ).
[0121] Figure 4 The SDS-PAGE results in (a) showed that the mRNA capping enzyme ASF exhibited high expression levels in all protein samples after incorporating the solubilization tag. However, in the supernatant, only the ASF sample fused with the solubilization tag MBP showed a darker protein band, while the ASF sample fused with the solubilization tag SUMO showed a lighter protein band. The ASF samples fused with the solubilization tags TrxA and GST showed no obvious protein bands. These results indicate that the solubilization tag MBP has a good solubilization effect on ASF, the solubilization tag SUMO has a certain solubilization effect on ASF, while the solubilization tags TrxA and GST have no significant solubilization effect on ASF.
[0122] Figure 4 The SDS-PAGE results in (b) showed that the mRNA capping enzyme BLUE was highly expressed in all protein samples after the addition of the solubilization tags. In the supernatant, BLUE samples fused with the solubilization tags MBP and GST showed lighter protein bands, while BLUE samples fused with the solubilization tags SUMO and TrxA showed no obvious protein bands. The results indicate that the solubilization tags MBP and GST have a certain solubilization effect on BLUE, while the solubilization tags SUMO and TrxA have no significant solubilization effect on BLUE.
[0123] Figure 4 SDS-PAGE results in (c) showed that the mRNA-capped enzyme RICE exhibited high expression levels in all protein samples after incorporating the solubilization tags. However, no obvious target protein band was observed in any of the RICE samples in the supernatant. These results indicate that the four selected solubilization tags did not significantly improve the solubility of RICE and did not achieve a substantial increase in RICE solubility.
[0124] Figure 4The SDS-PAGE results in (d) showed that the whole-protein sample of the mRNA capping enzyme ROT, after fusing the solubilization tags MBP and GST, exhibited a lighter protein band, while the whole-protein sample of ROT fused with the solubilization tags SUMO and TrxA did not show a corresponding protein band. This result may be due to the introduction of the solubilization tags and linker causing premature termination of translation, preventing the acquisition of the full-length target protein. Alternatively, it may be that the linker breaks after translation, preventing the acquisition of the mRNA capping enzyme fused with the solubilization tags.
[0125] Figure 4 The SDS-PAGE results in (e) showed that the mRNA-capped enzyme COW exhibited high expression levels in all protein samples after incorporating the solubilization tags. However, no obvious target protein band was observed in any of the COW samples in the supernatant. These results indicate that the four selected solubilization tags did not significantly improve the solubility of COW and did not achieve a substantial increase in COW solubility.
[0126] Figure 4 SDS-PAGE results in (f) showed that the mRNA capping enzyme CHL exhibited high expression levels in all protein samples after incorporating the solubilization tag. Furthermore, in the supernatant, CHL samples incorporating the solubilization tags SUMO, MBP, and TrxA showed corresponding target protein bands, while only the CHL sample incorporating the solubilization tag GST showed no obvious protein band. Notably, the grayscale of the protein band in the supernatant of CHL incorporating the solubilization tag MBP was similar to that in the whole protein sample, indicating that CHL was nearly completely soluble in BL21(DE3) after incorporating the solubilization tag MBP. Since CHL already had high solubility without the solubilization tag, compared to previous experimental results, the solubility of CHL decreased after incorporating the solubilization tags SUMO, TrxA, and GST. These results suggest that for CHL with smaller molecular weights, the solubilization tag MBP has a better solubilization effect, while the solubilization tags SUMO, TrxA, and GST inhibit its dissolution.
[0127] Figure 4 SDS-PAGE results for the whole protein (g) showed that the mRNA capping enzyme FAU exhibited high expression levels in all samples after incorporating the solubilization tag. However, in the supernatant, only the FAU sample fused with the solubilization tag MBP showed a faint protein band; the other supernatant samples did not show corresponding protein bands. These results indicate that only the solubilization tag MBP has a certain solubilization effect on FAU, while the solubilization tags SUMO, TrxA, and GST have no significant solubilization effect on FAU.
[0128] Based on the experimental results of the seven mRNA capping enzymes, the following conclusions can be drawn: First, the solubilizing tags have significantly different solubilizing effects on different proteins, and in some cases may inhibit the dissolution of the target protein; second, among the four selected solubilizing tags, although MBP has the largest molecular weight, it has the best solubilizing effect on mRNA capping enzymes. Therefore, mRNA capping enzymes ASF, BLUE, CHL, and FAU, which are fused with the solubilizing tag MBP (amino acid sequence shown in SEQ ID No. 5) and have a certain degree of solubility, were selected for subsequent capping efficiency testing.
[0129] The structural information of the recombinant plasmids constructed earlier for expressing the corresponding soluble mRNA capping enzymes, ASF, BLUE, CHL, and FAU, is as follows:
[0130] The recombinant plasmid used to express MBP-BLUE is structurally described as follows: The recombinant plasmid obtained by inserting the DNA fragment shown in SEQ ID No. 7 between the Nde I and Xho I restriction sites of the pET-21a(+) vector. Positions 1-1101 of SEQ ID No. 7 are nucleotide sequences encoding the solubilizing tag MBP, positions 1102-1131 are nucleotide sequences encoding the linker peptide, and positions 1132-3081 are nucleotide sequences encoding the capping enzyme (SEQ ID No. 1) derived from Bluetongue virus.
[0131] The recombinant plasmid used to express MBP-FAU is structurally described as follows: The recombinant plasmid obtained by inserting the DNA fragment shown in SEQ ID No. 8 between the Nde I and Xho I restriction sites of the pET-21a(+) vector. Positions 1-1101 of SEQ ID No. 8 are the nucleotide sequences encoding the solubilizing tag MBP, positions 1102-1131 are the nucleotide sequences encoding the linker peptide, and positions 1132-3786 are the nucleotide sequences encoding the capping enzyme (SEQ ID No. 2) derived from Faustovirus.
[0132] The recombinant plasmid used to express MBP-ASF is structurally described as follows: The recombinant plasmid obtained by inserting the DNA fragment shown in SEQ ID No. 9 between the Nde I and Xho I restriction sites of the pET-21a(+) vector. Positions 1-1101 of SEQ ID No. 9 are the nucleotide sequences encoding the solubilizing tag MBP, positions 1102-1131 are the nucleotide sequences encoding the linker peptide, and positions 1132-3753 are the nucleotide sequences encoding the capping enzyme (SEQ ID No. 3) derived from African swine fever virus.
[0133] The recombinant plasmid for expressing MBP-CHL is structurally described as follows: The recombinant plasmid obtained by inserting the DNA fragment shown in SEQ ID No. 10 between the Nde I and Xho I restriction sites of the pET-21a(+) vector. Positions 1-1101 of SEQ ID No. 10 are the nucleotide sequences encoding the solubilizing tag MBP, positions 1102-1131 are the nucleotide sequences encoding the linker peptide, and positions 1132-2139 are the nucleotide sequences encoding the capping enzyme (SEQ ID No. 4) derived from Chlorella virus.
[0134] 5. Heterologous expression of wild-type vaccinia virus capping enzyme
[0135] To compare the capping efficiency of mRNA capping enzymes from different viral sources, the commonly used vaccinia virus capping enzyme, VCE, was heterologously expressed. Based on previous experimental experience, *E. coli* BL21(DE3) was selected as the host cell for heterologous expression. Since VCE consists of two subunits, D1 (844 aa) and D12 (287 aa), pRSFDuet-1 was used as the vector for construction. Figure 5 (a)). The coding nucleotide sequence of VCE was codon-optimized based on the E. coli host, and the optimized sequence is as follows:
[0136] D1:
[0137]
[0138] D12:
[0139] ATGGATGAAATCGTCAAAAATATCCGCGAAGGCACGCACGTCCTGCTGCCGTTCTATGAAACCCTGCCGGAACTGAATCTGTCACTGGGCAAATCTCCGCTGCCGAGTCTGGAATATGGTGCAAACTACTTTCTGCAGATTTCTCGTGTGAACGATCTGAATCGCATGCCGACCGACATGCTGAAACTGTTCACGCATGATATCATGCTGCCGGAAAGCGATCTGGACAAAGTCTACGAAATCCTGAAAATCAACTCCGTTAAATACTACGGCCGTTCAACCAAAGCGGATGCCGTGGTTGCAGACCTGTCCGCTCGCAATAAACTGTTTAAACGTGAACGCGATGCTATTAAATCGAACAATCACCTGACCGAAAACAACCTGTACATCAGCGATTACAAAATGCTGACGTTTGACGTGTTCCGTCCGCTGTTCGATTTCGTTAACGAAAAATACTGCATCATCAAACTGCCGACCCTGTTTGGCCGTGGTGTGATTGATACGATGCGCATCTACTGCAGCCTGTTCAAAAATGTCCGCCTGCTGAAATGTGTGTCGGATAGCTGGCTGAAAGACTCTGCGATTATGGTGGCCAGTGACGTTTGTAAGAAAAACCTGGACCTGTTTATGTCCCATGTCAAATCAGTGACCAAAAGCTCTAGTTGGAAAGACGTTAATTCGGTCCAATTTAGCATTCTGAACAATCCGGTTGATACGGAATTCATCAACAAATTCCTGGAATTCTCTAACCGTGTTTACGAAGCACTGTATTACGTCCACAGTCTGCTGTACTCCTCAATGACCTCGGACTCCAAATCCATCGAAAATAAACATCAACGCCGCCTGGTGAAACTGCTGCTGTAA
[0140] The MCS1 region was replaced with the D1 subunit sequence, and the MCS2 region was replaced with the D12 subunit sequence. The His-tag on the vector was retained for subsequent characterization and purification. It is worth noting that, unlike the previously constructed mRNA capping enzyme, the His-tag here is located at the N-terminus of the D1 subunit. This is because the D1 subunit needs to bind to the D12 subunit to form a dimer. Adding the His-tag to the C-terminus of the D1 subunit would affect dimer formation and cause the His-tag to be located inside the dimer, affecting subsequent purification. The correctly constructed plasmid, verified by sequencing, was chemically transformed into BL21(DE3) competent cells and induced for expression at 37°C with 1 mM IPTG for 4 h. The induced cells were lysed and purified using a His-tag gravity column. The purified VCE sample was verified by SDS-PAGE. Figure 5 (b) The experimental results show that the mRNA capping enzyme VCE was successfully heterologously expressed in BL21(DE3) with good solubility. Furthermore, although a His-tag was not added to the D12 subunit during the design process, a protein band of the D12 subunit still appeared in the SDS-PAGE results. This indicates that the D1 and D12 subunits successfully formed a dimer, and the complete VCE could be purified by His-tag gravity column.
[0141] II. Construction of mRNA Capping Characterization System
[0142] 1. Construction of the T7 in vitro transcription system
[0143] Before comparing the capping efficiency of mRNA capping enzymes, it is necessary to construct a T7 in vitro transcription system to obtain uncapped mRNA in vitro. The T7 in vitro transcription system mainly consists of T7 RNA polymerase, buffer solution, and DNA template. T7 RNA polymerase is crucial for constructing the T7 in vitro transcription system. The existing laboratory preparation method involves lysing and dialyzing the *E. coli* BL21(DE3) expression plasmid pAR1219 to obtain a crude extract of T7 RNA polymerase, which is insufficient for the T7 in vitro transcription system. Therefore, a purification tag needs to be added to the existing plasmid to purify the T7 RNA polymerase. His-tag and Strep II are currently commonly used purification tags. The advantage of the His-tag is its good binding to the purification column, resulting in a large amount of target protein. However, the disadvantage of the His-tag is its poor specificity, resulting in some residual contaminants after purification. The advantage of the Strep II purification tag is its good specificity, yielding a high-purity target protein. However, the disadvantage of Strep II is the lower concentration of the target protein obtained. The six types of labels designed in the experiment are shown in Table 3.
[0144] Table 3. Purification Labels
[0145] Purification Tag Connecting sites protein sequence N8His N-end HHHHHHH N6xHis N-end HHHHHH NStrepII N-end WSHPQFEK C8xHis C-end HHHHHHH C6xHis C-end HHHHHH CStrepII C-end WSHPQFEK
[0146] Purification tags were designed at the N-terminus and C-terminus of T7 RNA polymerase to compare their effects on T7 RNA polymerase activity. The specific procedures are as follows:
[0147] Using plasmid pAR1219 as a template, it was linearized by PCR and a purification tag was introduced. Finally, it was re-ligated using a Gibson ligation reaction to obtain a plasmid containing the purification tag. The primers used are as follows (5'-3'):
[0148] N8xHis:
[0149] Forward primer: 5'-gcactaaATGCACCATcatcaccatcaccatcatAACACGATTAACATCGCTAAGAACGA CTTC-3';
[0150] Reverse primer: 5'-gatgATGGTGCATttagtgcctcttccagttagtaaatccggatca-3'.
[0151] N6xHis:
[0152] Forward primer: 5'-gcactaaATGcatcaccatcaccatcatAACACGATTAACATCGCTAAGAACGACTTC-3';
[0153] Reverse primer: 5'-gatggtgatgCATttagtgcctcttccagttagtaaatccggatca-3'.
[0154] NStrepII:
[0155] Forward primer: 5'-TGGTCACATCCGCAATTTGAAAAGAACACGATTAACATCGCTAAGAACGACTTC-3';
[0156] Reverse primer: 5'-CTTTTCAAATTGCGGATGTGACCACATttagtgcctcttccagttagtaaatccg-3'.
[0157] C8xHis:
[0158] Forward primer: 5'-CTTCGCGTTCGCGCACCATcatcaccatcaccatcatTAAcgccaaatcaatacgactccgg atcc-3';
[0159] Reverse primer: 5'-ATGATGGTGCGCGAACGCGAAGTCCGACTCTAAG-3'.
[0160] C6xHis:
[0161] Forward primer: 5'-CTTCGCGTTCGCGcatcaccatcaccatcatTAAcgccaaatcaatacgactccggatc c-3';
[0162] Reverse primer: 5'-atggtgatgCGCGAACGCGAAGTCCGACTCTAAG-3'.
[0163] CStrepII:
[0164] Forward primer: 5'-TGGTCACATCCGCAATTTGAAAAGTAAcgccaaatcaatacgactccgga tcca-3';
[0165] Reverse primer: 5'-CTTTTCAAATTGCGGATGTGACCACGCGAACGCGAAGTCCGACTCTAAG-3'.
[0166] The correctly constructed plasmid, verified by sequencing, was chemically transformed into BL21(DE3) competent cells for expression. The collected cells were lysed, and the supernatant was collected and purified. Two solutions were designed for dialysis and storage of T7 RNA polymerase (Table 4).
[0167] Table 4. Components of T7 RNA Polymerase Storage Solution
[0168]
[0169] The obtained T7 RNA polymerase was added to the T7 in vitro transcription system for in vitro transcription experiments. The components of the in vitro transcription system are shown in Table 5.
[0170] Table 5. Components of the in vitro transcription system
[0171]
[0172]
[0173] All components were stored at -20°C. The 5x Transcription Buffer contained the following components: 50mM NaCl, 40mM MgCl2, 10mM spermidine, 400mM Tris-HCl, pH 8.0.
[0174] The template DNA needs to be linearized before the reaction. This invention utilizes PCR to obtain linearized template DNA. The template DNA must contain the T7 promoter sequence.
[0175] Template sfGFP plasmid sequence:
[0176]
[0177] Linearized DNA template sequence:
[0178]
[0179] The specific procedures for in vitro transcription are as follows.
[0180] 1) Thaw all components except T7 RNA polymerase on ice.
[0181] 2) In an RNase-free environment, mix all components according to Table 5. The scale of the reaction system can be appropriately increased according to experimental requirements.
[0182] 3) Incubate at 37°C for 2 hours. If the target mRNA is shorter than 300 nt, the reaction time can be extended to 4 hours or longer.
[0183] 16h.
[0184] 4) In an RNase-free environment, add 1 μL of DNase I (NEB, catalog number: ) to 25 μL of the reacted solution.
[0185] M0303) was used to degrade the template DNA. The reaction was allowed to proceed at 37°C for 10–15 min.
[0186] 5) Purify mRNA using a kit or lithium chloride precipitation method, and determine the recovered concentration using Nanodrop. Store at -80°C for later use.
[0187] The transcribed mRNA was subjected to agarose gel electrophoresis. Figure 6The agarose gel electrophoresis results show that all T7 RNA polymerases dissolved in PBS solution lost their activity and failed to transcribe the target mRNA. The remaining bands in the image should be DNA templates that were not completely degraded by DNase I. Among the several T7 RNA polymerases dissolved in TSB solution, only the T7 RNA polymerases fused with purification tags N8xHis and N6xHis showed transcriptional activity, and corresponding mRNA nucleic acid bands appeared in the agarose gel electrophoresis. The T7 RNA polymerase fused with the purification tag NStrepII may have been unable to transcribe the target mRNA even after concentration due to its low concentration. The purification tags fused to the C-terminus of the T7 RNA polymerase may have hindered the active site of the T7 RNA polymerase, leading to its loss of activity. Based on the above experimental results, the following conclusions can be drawn: First, PBS solution is not suitable for storing T7 RNA polymerase, as it leads to its loss of activity; second, the active site of T7 RNA polymerase is located at the C-terminus of the protein, and fusing purification tags at the C-terminus leads to its loss of activity. ImageJ was used to analyze the grayscale of the mRNA bands transcribed by the N8xHis and N6xHis T7 RNA polymerases, with the grayscale of the N8xHis group as the baseline (100%). The grayscale of the N6xHis group was found to be 108%. This indicates that the activity of the T7 RNA polymerase fused with the purified N6xHis tag is slightly higher than that of the T7 RNA polymerase fused with the purified N8xHis tag. Therefore, subsequent experiments will use the T7 RNA polymerase fused with the purified N6xHis tag in the T7 in vitro transcription system.
[0188] 2. Selection of mammalian cells and transfection reagents
[0189] Capped mRNAs can be transfected into mammalian cells for expression. The expression level of the target protein reflects the stability of the mRNA, thus indirectly characterizing the capping efficiency. Therefore, it is necessary to select an effective mammalian cell expression system. Human embryonic kidney cells 293 (HEK293) are currently a widely used mammalian cell line with advantages such as ease of culture and high transfection efficiency. In this experiment, HEK293T and HEK293F were selected to express in vitro transcribed mRNAs. Both HEK293T and HEK293F are derivatives of HEK293. HEK293T is a semi-adherent cell line used for static culture, while HEK293F is a suspension cell line used for suspension culture. Lipofectamine was used in the experiment. TM MessengerMAX TM Transfection Reagent (Thermo), ExpiFectamine TM 293 Transfection Kit (Thermo), Lipo293TM Beyotime and Sinofection Transfection Reagent (SinoBiological) were used as transfection reagents for mRNA entry into mammalian cells, and their transfection efficiencies were tested and compared. Figure 7 (a) In the experiment, pCMV-C-EGFP was selected as the plasmid for transfection. The transfection and expression of the plasmid can be easily observed by utilizing the fluorescence characteristics of EGFP.
[0190] Comparison of transfection results between HEK293T and HEK293F ( Figure 7 In (a), it was found that the transfection efficiency of pCMV-C-EGFP in HEK293T cells was much higher than that in HEK293F cells. This indicates that although suspension culture has higher mass transfer efficiency, it does not enhance nucleic acid transfection efficiency. This may be because the high-speed oscillation environment is not conducive to the fusion of transfection reagents with the cell membrane, and the transfection reagents encapsulating nucleic acid samples do not have enough reaction time to be delivered into the cells before separating from them. Therefore, adherent HEK293T cells are more suitable for nucleic acid transfection. Flow cytometry results after HEK293T transfection with different transfection reagents ( Figure 7 As can be seen from (b)), Thermo and SinoBiological's transfection reagents showed better results, while Beyotime's transfection reagent had the worst results but still achieved considerable transfection efficiency. The flow cytometry results after HEK293F transfection using the transfection reagents ( Figure 7 As shown in (c)), the three transfection reagents were all ineffective, and SinoBiological's cation exchange transfection reagent showed almost no transfection effect. This indicates that transfection reagents based on liposome delivery are more suitable for transfecting HEK293 series cells, and liposomes are currently the most commonly used delivery reagents on the market. Based on the above experimental results, HEK293T will be used as the cell expression system for capped mRNA in the future, and the capping efficiency of different mRNA capping enzymes will be compared.
[0191] III. Intracellular expression levels of mRNAs after capping with different mRNA-capping enzymes
[0192] The target protein for mRNA translation was chosen to be superfolded green fluorescent protein (sfGFP). The fluorescent properties of sfGFP make its expression relatively easy to observe after intracellular expression. mRNA was obtained through in vitro transcription using the T7 in vitro transcription system constructed previously. The purified mRNA was then capped using a capping enzyme. The template sfGFP plasmid sequence is described above.
[0193] For the specific method of in vitro transcription, please refer to step 2.1 above.
[0194] The components of the in vitro capping system are shown in Table 6.
[0195] Table 6. Components of the in vitro capping system
[0196]
[0197]
[0198] All components were stored at -20°C. The 10x Capping Buffer contained the following components: 5mM KCl, 1mM MgCl2, 1mM DTT, 40mM Tris-HCl, pH 8.0.
[0199] The in vitro capping system in the table above can form a cap 0 structure. If a cap 1 structure is required, simply add 1 μL of 2'-O-methyltransferase (NEB, catalog number: M0366) to the above reaction system.
[0200] The specific procedure for applying an external cap is as follows:
[0201] 1) Thaw all components except the capped enzyme on ice. Simultaneously heat the mRNA sample at 65°C for 5 minutes. After heating, place the mRNA sample on ice for 5 minutes.
[0202] 2) In an RNase-free environment, mix all components according to Table 2.11. The scale of the reaction system can be appropriately increased according to experimental requirements.
[0203] 3) Incubate at 37°C for 30 hours. If the target mRNA is shorter than 300 nt, the reaction time can be extended to 2 hours.
[0204] 4) Purify mRNA using a kit or lithium chloride precipitation method, and determine the recovered concentration using Nanodrop. Store at -80°C for later use.
[0205] Based on the HEK293T cell expression system obtained above, the capped mRNA was transfected into the cells for expression. Figure 8 (a) and (b)). The flow cytometers used in the flow cytometry assays include the BIO-RAD S3e™ CellSorter and the BD FACSCalibur. Since the operation of flow cytometers is similar, only the specific operation of the BD FACSCalibur will be described here:
[0206] 1) Turn on the power to the BD FACSCalibur until the "STNDBY" button lights up. Check if the sheath fluid tank contains enough sheath fluid. If not, add sheath fluid to at least 2 / 3 of the tank's capacity. Check if the waste liquid tank contains excessive waste liquid. If so, pour the waste liquid into the laboratory flow cytometry waste liquid recovery container.
[0207] 2) Adjust the pressure regulator to the pressurized position. Observe whether there are air bubbles in the pipeline. If there are no air bubbles, you can proceed to the next step of the experiment.
[0208] 3) Press the "PRIME" button to pre-run the flow cytometer; the "PRIME" button will light up. After completion, press "STNDBY".
[0209] The button will automatically light up, and the "PRIME" button will automatically turn off. Press the "PRIME" button again to pre-run the flow cytometer and repeat the above steps.
[0210] 4) Connect the computer power supply, start the computer, and open the CELLQuest software. Set the relevant parameters according to the experimental requirements. In the Acquire command bar, select Connect to Cytometer. Wait for the flow cytometer to stabilize for 3-5 minutes.
[0211] 5) Place the sample to be tested and press the "RUN" button to start the flow cytometer. Select Aquire in the software to collect data. After collection is complete, select Save in the software to save the data and press "STNDBY" on the flow cytometer.
[0212] Button.
[0213] 6) If there are other samples, repeat the previous step.
[0214] 7) After all samples have been analyzed, add 75% ethanol and press the "RUN" button to run the flow cytometer. After 10 minutes, press the "STNDBY" button. Add the flow cytometry wash buffer and press the "RUN" button to run the flow cytometer. After 10 minutes, press the "STNDBY" button. Adjust the pressure regulator to the depressurization position. Turn off the power to the BD FACSCalibur and the computer.
[0215] 8) The experimental data were then analyzed using FlowJo software.
[0216] Figure 8 (b) shows the streaming results; the data is then processed into a bar chart. Figure 8 (a) From Figure 8As shown in (a), the expression level of capped mRNA was significantly increased compared to uncapped mRNA. The expression level of mRNA capped using VCE was approximately three times that of uncapped mRNA. This indicates that the cap structure can significantly improve mRNA stability and translation efficiency, thereby increasing the protein expression level of mRNA in HEK293T. Furthermore, comparing the experimental results of commonly used VCE with other mRNA capping enzymes, it was found that the expression levels of BLUE and FAU in HEK293T were higher than those of VCE, approximately 1.3 times that of VCE; while the expression level of ASF in HEK293T was similar to that of VCE; and the expression level of CHL in HEK293T was slightly lower than that of VCE. The experimental results indicate that BLUE and FAU have a better capping effect than VCE in the in vitro environment, while the capping effect of ASF and CHL in the in vitro environment is similar to that of VCE.
[0217] Based on the results of the above embodiments, it is evident that this invention screened mRNA capping enzymes with in vivo capping activity from different viral sources for in vitro capping reactions. These screened capping enzymes were then heterologously expressed in *Pichia pastoris* X33 and *Escherichia coli* BL21(DE3), and successful expression was achieved in *E. coli* BL21(DE3). To address the poor solubility of heterologously expressed mRNA capping enzymes, two methods were tested: low-temperature induction expression and fusion with a solubilizing tag. MBP was proven to be a solubilizing tag with excellent solubilizing effect. The mRNA capping enzyme fused with the solubilizing tag MBP successfully improved solubility. Furthermore, this invention constructed a T7 in vitro transcription system and screened a mammalian cell expression system based on HEK293T for mRNA translation expression. Based on the above system, this invention demonstrated that the cap structure can significantly improve mRNA stability and translation efficiency. Simultaneously, mRNA capping enzymes derived from Bluetongue virus and Faustovirus were shown to possess higher capping activity than the vaccinia virus capping enzyme VCE. Among them, the activity of the capping enzyme derived from bluetongue virus mRNA is 38% higher than that of VCE.
[0218] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. A method for preparing a soluble mRNA capping enzyme, comprising the following steps: (A1) The gene encoding the fusion protein was introduced into Escherichia coli recipient cells to obtain recombinant Escherichia coli; the fusion protein was formed by fusing the solubilization tag MBP and a viral capping enzyme via a linker peptide; the viral capping enzyme was selected from any of the following: a capping enzyme derived from bluetongue virus, a capping enzyme derived from floating disease virus, a capping enzyme derived from African swine fever virus, or a capping enzyme derived from Chlorella virus; (A2) The recombinant Escherichia coli was induced to express the protein, the bacterial cells were collected and lysed, and the fusion protein was obtained from the supernatant after centrifugation. This protein is a soluble mRNA capping enzyme. The fusion protein is composed of the solubilizing tag MBP, the linker peptide, and the virus-derived capping enzyme sequentially linked from the N-terminus to the C-terminus. The amino acid sequence of the capping enzyme derived from bluetongue virus is shown in positions 1-644 of SEQ ID No. 1 or SEQ ID No. 1; The amino acid sequence of the capping enzyme derived from the floating disease virus is shown in positions 1-879 of SEQ ID No. 2 or SEQ ID No. 2; The amino acid sequence of the capping enzyme derived from African swine fever virus is shown in positions 1-868 of SEQ ID No. 3 or SEQ ID No. 3; The amino acid sequence of the capped enzyme derived from Chlorella virus is shown in positions 1-330 of SEQ ID No. 4 or SEQ ID No. 4; The linker peptide is a flexible linker peptide.
2. The method according to claim 1, characterized in that: The amino acid sequence of the solubilizing tag MBP is shown in SEQ ID No.
5.
3. The method according to claim 1, characterized in that: The amino acid sequence of the linker peptide is shown in SEQ ID No.
6.
4. The method according to claim 1, characterized in that: The gene encoding the fusion protein is any one of the following: (B1) The nucleotide sequence is as shown in positions 1-3063 of SEQ ID No. 7 or SEQ ID No. 7; (B2) The nucleotide sequence is as shown in positions 1-3768 of SEQ ID No. 8 or SEQ ID No. 8; (B3) The nucleotide sequence is as shown in positions 1-3735 of SEQ ID No. 9 or SEQ ID No. 9; (B4) The nucleotide sequence is as shown in positions 1-2121 of SEQ ID No. 10 or SEQ ID No.
10.
5. The method according to any one of claims 1-4, characterized in that: In step (A1), the gene encoding the fusion protein is introduced into the E. coli recipient cells via a recombinant vector.
6. The method according to claim 5, characterized in that: The recombinant vector was obtained by inserting the gene encoding the fusion protein into the multiple cloning site of pET-21a(+).
7. The method according to claim 1, characterized in that: The Escherichia coli recipient cells were Escherichia coli BL21(DE3).
8. The method according to any one of claims 1-4, characterized in that: In step (A2), the conditions for inducing expression are: expression induced by 1 mM IPTG at 37°C for 2 h.
9. A soluble mRNA capping enzyme prepared using the method described in any one of claims 1-8.
10. A complete product for preparing the soluble mRNA capping enzyme of claim 9, comprising: (C1) The recombinant vector as described in claim 5 or 6; (C2) The Escherichia coli recipient cell as described in any one of claims 1-7.
11. The application of the soluble mRNA capping enzyme of claim 9 in the 5' end capping modification of mRNA.
12. An in vitro transcription-capping method for mRNA, comprising the following steps: S1. Prepare T7 RNA polymerase according to the following steps: (a1) The encoding gene of T7 RNA polymerase fused with a purification tag was introduced into Escherichia coli recipient cells to obtain recombinant Escherichia coli; wherein the T7 RNA polymerase fused with the purification tag is T7 RNA polymerase with a 6His tag or an 8His tag fused to the N-terminus. (a2) The recombinant Escherichia coli was induced to express T7 RNA polymerase, the bacterial cells were collected and lysed, and the T7 RNA polymerase was obtained by centrifugation and purification from the supernatant. S2. Prepare mRNA capping enzyme according to any one of claims 1-8; S3. First, the T7 RNA polymerase prepared in S1 is used for in vitro transcription of mRNA. Then, the mRNA capping enzyme prepared in S2 is used to modify the 5' end of the in vitro transcribed mRNA by capping.
13. A complete product kit for in vitro transcription-capping of mRNA, comprising: (D1) The T7 RNA polymerase fused with the purified tag as described in claim 12; (D2) The soluble mRNA capping enzyme of claim 9.