A maize low temperature response transcription factor ZmKNOX13 gene and application thereof

By providing the maize low-temperature response transcription factor ZmKNOX13 gene, and through overexpression and gene editing technology, the tolerance of maize to low temperatures was improved, solving the problem of maize's sensitivity to low temperatures, revealing the molecular mechanism of low-temperature stress response, and providing a basis for breeding low-temperature tolerant maize.

CN116375836BActive Publication Date: 2026-07-07ANHUI AGRICULTURAL UNIVERSITY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ANHUI AGRICULTURAL UNIVERSITY
Filing Date
2023-04-10
Publication Date
2026-07-07

AI Technical Summary

Technical Problem

Corn is sensitive to low temperatures, which leads to slow germination, low emergence rate, and inhibited seedling growth, seriously affecting yield and quality. The role of ZmKNOX13 in low temperature stress has not been reported in the existing technology.

Method used

We provide the ZmKNOX13 gene, a transcription factor for low-temperature response in maize, and through overexpression and gene editing, we enhance maize's tolerance to low temperatures and participate in the regulation of low-temperature stress response.

Benefits of technology

Overexpression of the ZmKNOX13 gene in maize plants increased their tolerance to low temperatures and reduced their sensitivity to low temperatures, revealing the molecular mechanism of low-temperature stress response and providing gene resources for the creation of new low-temperature tolerant maize germplasm.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116375836B_ABST
    Figure CN116375836B_ABST
Patent Text Reader

Abstract

The application discloses a corn low-temperature response transcription factor ZmKNOX13 gene and application thereof, relates to the field of functional genes and plant gene breeding technology, and the nucleotide sequence of the transcription factor gene ZmKNOX13 is shown as SEQ ID NO.1, and subcellular localization research shows that the protein is mainly located in the nucleus; the protein ZmKNOX13 coded by the transcription factor ZmKNOX13 gene has an amino acid sequence shown as SEQ ID NO.2. It is found through research that the ZmKNOX13 overexpression transgenic corn plant improves the tolerance to low temperature, and the gene editing plant reduces the resistance to low temperature, indicating that the ZmKNOX13 gene participates in the response regulation of corn low-temperature stress.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of functional genes and plant gene breeding technology, specifically to a maize low-temperature response transcription factor ZmKNOX13 gene and its applications. Background Technology

[0002] Corn is a low-temperature sensitive crop. In corn-sown spring areas, the occurrence of late spring frosts leads to slow germination, low emergence rate, and inhibited seedling growth, which seriously affects the yield and quality of corn. In the northeastern region, cold damage occurs frequently, causing a significant decline in corn yield and quality.

[0003] The damage caused by cold stress to maize manifests externally primarily as chlorosis, wilting, leaf depression, and water-soaked spots. At the microscopic level, the damage from cold stress to plants is more complex. First, cold stress increases the likelihood of polar side chains of proteins being exposed to the aqueous medium, leading to weakened protein or protein complex stability and metabolic dysregulation. Simultaneously, low temperatures cause the cell membrane to change from a liquid to a gel state, reducing cell membrane fluidity. Furthermore, lipids on the cell membrane change from disordered to ordered states. These combined events disrupt membrane reactions, including altered cell membrane permeability, disruption of the water-ion balance within the plant, damage to RNA secondary structure stability, and impacts on a range of basic metabolic processes, such as decreased photosynthesis, reduced respiration, and decreased enzyme reaction rates. Additionally, low temperatures cause the accumulation of large amounts of reactive oxygen species (ROS) within the plant. Excessive ROS can be toxic to cells, causing damage to biomembranes and reduced enzyme reaction efficiency.

[0004] Plant response to low-temperature stress is a complex regulatory process involving multiple genes, with transcription factors playing a crucial role. As one of the more important transcription factor families in plants, the KNOX family has been found to participate in plant growth, development, and hormone regulation in other species; however, the role of ZmKNOX13 in the response to low-temperature stress has not been reported. Summary of the Invention

[0005] The purpose of this invention is to provide a maize low-temperature response transcription factor ZmKNOX13 gene, providing a basis for breeding maize varieties adapted to low temperatures.

[0006] The present invention achieves the above objectives through the following technical solutions:

[0007] This invention provides a maize low-temperature response transcription factor ZmKNOX13 gene, which has the nucleotide sequence shown in SEQ ID NO.1.

[0008] A further improvement is that the gene is located in the nucleus of maize cells.

[0009] A further improvement is that the protein ZmKNOX13 encoded by the transcription factor ZmKNOX13 gene has the amino acid sequence shown in SEQ ID NO.2.

[0010] This invention provides an application of the above-mentioned maize low-temperature response transcription factor ZmKNOX13 gene in response to maize low-temperature stress.

[0011] A further improvement is that overexpression of the transcription factor ZmKNOX13 gene enables maize to resist low temperature stress.

[0012] The present invention has the following beneficial effects:

[0013] This study found that transgenic maize plants overexpressing ZmKNOX13 exhibited increased tolerance to low temperatures, while gene-edited plants showed decreased resistance, indicating that the ZmKNOX13 gene is involved in the regulation of maize's response to low-temperature stress. This invention provides an in-depth understanding of the molecular mechanism by which ZmKNOX13 regulates maize's response to low-temperature stress. The findings will further innovate the theoretical research on the molecular regulatory mechanisms of plant low-temperature stress responses, and simultaneously provide excellent genetic resources and application basis for creating new low-temperature-tolerant maize germplasm through molecular breeding techniques. Attached Figure Description

[0014] Figure 1 Analysis of ZmKNOX13 tissue expression patterns (A: V3 stage leaf; B: V3 stage root; C: V8 stage leaf; D: V8 stage root; E: V8 stage stem; F: V11 stage leaf; G: V11 stage stem; H: R1 stage leaf; I: R1 stage root; J: filament; K: embryo 20 days after pollination; L: endosperm 30 days after pollination);

[0015] Figure 2 The expression patterns of ZmKNOX13 under low and high temperature stress conditions;

[0016] Figure 3 Subcellular localization of ZmKNOX13 in maize protoplasts;

[0017] Figure 4 Identification of maize ZmKNOX13 overexpression lines; (A. Schematic diagram of the overexpression vector; B. Detection images of positive test strips for different overexpression maize lines; C. Expression levels by quantitative real-time PCR; D. Electrophoresis images of proteins from overexpression lines;)

[0018] Figure 5Molecular validation of ZmKNOX13 gene-edited lines (A. Schematic diagram of gene-editing vector; B. PCR sequencing peak diagram of different edited lines; C. Alignment of target sequence in gene-edited line plants;)

[0019] Figure 6 Phenotype of ZmKNOX13 overexpression lines under low-temperature treatment (A. Phenotype of transgenic lines under low-temperature treatment; B. Relative water content of leaves; C. Relative electrolyte permeability of leaves; D. Proline content);

[0020] Figure 7 The effects of low temperature stress on the seedling stage of ZmKNOX13 gene-edited lines (A. low temperature treatment phenotype of gene-edited lines; B. relative water content; C. relative electrolyte permeability; D. proline content). Detailed Implementation

[0021] The present application will now be described in further detail with reference to the accompanying drawings. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0022] 1. Materials

[0023] Unless otherwise specified, all methods used in this invention are conventional methods known to those skilled in the art, and all reagents used are commercially available products unless otherwise specified.

[0024] 2. Method

[0025] 2.1 Analysis of ZmKNOX13 gene expression patterns in different tissues

[0026] The plant material used in this experiment was the maize B73 inbred line.

[0027] Tissue expression pattern: Leaves, roots, leaves, stems, and roots of maize at stage V3, V3, V8, V8, V8, V11, V11, and R1, as well as silks, embryos 20 days after pollination, and endosperm 30 days after pollination were collected. After collection, the tissues were stored at -80℃ for later use.

[0028] Induced expression mode: After culturing maize to the three-leaf-one-heart stage, it was treated with a high temperature of 42℃ and a cold treatment of 4℃. Maize leaves were collected at 0h, 3h, 6h, 12h and 24h. After the leaves were collected, they were quickly transferred to liquid nitrogen and then stored in a -80℃ refrigerator for later use.

[0029] After RNA extraction and reverse transcription, using cDNA as a template, a real-time PCR reaction was performed using Roche's SYBR dye and a Roche LightCyler 480 real-time PCR instrument.

[0030] The qRT-PCR reaction system is as follows:

[0031]

[0032] After spotting, centrifuge to thoroughly mix the liquid and prevent air bubbles from forming. Then, seal the PCR plate tightly with sealing film and place it in a Roche LightCyler 480 real-time PCR instrument for PCR reaction. The PCR reaction procedure is as follows:

[0033]

[0034] After the reaction is complete, use 2 –ΔΔCT The algorithm analyzes the results and calculates the relative expression level of the ZmKNOX13 gene.

[0035] Figure 1 The results showed that ZmKNOX13 was expressed in tissues at all stages of the disease, with the highest expression level in mature leaves, followed by leaves at stage V3, leaves at stage V8, leaves at stage V11, roots at stage V3, roots at stage V8, and endosperm 30 days after pollination. However, the expression level was lower in filaments, embryos 20 days after pollination, and stems.

[0036] Analysis of tissue expression patterns revealed that ZmKNOX13 was expressed at a relatively high level in leaves. To investigate whether ZmKNOX13 could be induced by temperature changes, high-temperature stress was simulated by treatment at 42℃ and low-temperature stress was simulated by treatment at 4℃ at the three-leaf stage of wild-type maize. Figure 2 The results of the expression data show that under low temperature stress, the expression level of ZmKNOX13 continuously increases with the occurrence of stress, reaching a significant level at 6 h and a highly significant level at 12 h, and the expression level remains at a highly significant level thereafter. Under high temperature stress, the expression level of ZmKNOX13 gradually increases with the increase of induction time, reaching a highly significant level at 6 h, and its expression level gradually increases with the occurrence of stress thereafter.

[0037] 2.2 Subcellular localization analysis of the ZmKNOX13 gene

[0038] To investigate the subcellular localization of ZmKNOX13 (nucleotide sequence shown in SEQ ID NO.1), a p1305-ZmKNOX13-GFP fusion vector was constructed using the pCAMBIA1305 vector. This vector uses a 35S promoter to regulate gene expression. After obtaining the ZmKNOX13 transcript, the stop codon was removed, and the following primers were designed to amplify ZmKNOX13:

[0039] ZmKNOX13-F: 5'GCTCTAGAATGGCGTTCAACTACCACGAC 3' introduces an Xba I restriction site; ZmKNOX13-R: 5'CGGGATCCCCAGGCTGGTTCTGCGTT 3' introduces a BamH I restriction site.

[0040] After primer design, cDNA derived from reverse transcription of RNA extracted from B73 was used as a template for PCR amplification with a high-fidelity enzyme. The PCR system and method were the same as in 2.1.

[0041] The constructed p1305-ZmKNOX13-GFP fusion vector and the nuclear localization vector m-Cheery were co-transformed into protoplasts. After culturing for 36 hours, the protein localization was observed using a laser confocal microscope. Simultaneously, co-transformed empty GFP vector served as a control. Figure 3 A). Observation of GFP fluorescence signals revealed that the empty GFP vector was expressed in all parts of the protoplast, while ZmKNOX13 and m-Cheery were expressed only in the protoplast nucleus. These results indicate that ZmKNOX13 (amino acid sequence shown in SEQ ID NO.2) is a nuclear-localized protein, consistent with the basic characteristics of a transcription factor. Figure 3 B).

[0042] 2.3 Identification of maize ZmKNOX13 overexpression lines and gene-edited lines

[0043] The maize variety used in this experiment was the maize inbred line KN5585.

[0044] 2.3.1 Overexpression lines

[0045] The overexpression vector was constructed using homologous recombination. Because the vector used had a MYC tag added, the terminator needed to be removed when designing the primers. The primers were designed as follows:

[0046] ZmKNOX13-OE-F:5' TAGAGAGCGGTACCCGGG ATGGCGTTCAACTACCACG A 3' underlined is the recombinant homologous arm; ZmKNOX13-OE-R: 5' CTTTGGGATCCCCGGGCCAG GCTGGTTCTGCGTT 3' underlined is the recombinant homologous arm; PCR amplification was performed, and the PCR product was obtained. The ZmKNOX13 gene was obtained by gel extraction; the ZmKNOX13 gene was transformed into the pZZ00026 plasmid to construct the pZZ00026-ZmKNOX13 overexpression vector. Figure 4 A).

[0047] After obtaining seeds of overexpressing maize lines using transgenic technology, the T0 generation seeds were tested. Since the constructed vector carried the Bar marker gene, the Bar marker was tested first. T0 generation maize plants from 20 different lines were randomly sampled, and 5 positive lines were identified and named OE1, OE5, OE8, OE14, and OE22. Figure 4 B). RNA was then extracted from each line and reverse transcribed. The expression level of ZmKNOX13 in the five lines was then detected by quantitative real-time PCR. The results showed that the expression level of ZmKNOX13 in all five transgenic lines was higher than that in the wild type, with OE8 and OE14 showing the highest expression levels among the five overexpression lines. Figure 4 C). Since the vector used to construct the overexpression lines carried the MYC protein tag, protein was subsequently extracted from the maize of the overexpression lines. The MYC-tagged proteins in the protein extract were then enriched using MYC magnetic beads and subjected to electrophoresis. The results showed that no band appeared in the channel of KN5585, while bands appeared in the other five lines. Figure 4 D).

[0048] 2.3.2 Gene-edited lines

[0049] In addition to creating transgenic maize lines that expressed gene expression, gene-edited lines were also created. For non-coding proteins, the Huazhong Agricultural University CRISPR-P website (http: / / crispr.hzau.edu.cn / CRISPR2 / ) was used for design, selecting targets with high target scores, low off-target rates, and suitable locations. Finally, a single-gene dual-target vector was constructed. Figure 5A). After obtaining T0 generation gene-edited seeds, the seeds were planted in breeding pots, and the seedlings were tested when they reached the three-leaf-one-heart stage. After extracting the genome from the plant leaves, primers targeting two sites were designed to amplify the genomic fragment. This fragment was then sequenced, and the sequenced fragment was compared with the wild-type KN5585 using Sequencher software. The results showed that, compared with the wild type, the gene-edited plant had a base deletion in its editing site region. Further observation of the sequencing result peak diagram determined whether the gene-edited plant was a homozygous mutation (one peak indicates homozygosity, two peaks indicate heterozygosity). Finally, two gene-edited lines were selected, named KO#-6 and KO#-15. The T0 generation of these two lines was propagated to the T2 generation for subsequent experiments. Figure 5 BC).

[0050] 2.4 Functional Analysis of ZmKNOX13 in Cold Stress Response

[0051] 2.4.1 Low-temperature treatment tolerance analysis

[0052] 2.4.1.1 ZmKNOX13 overexpression transgenic plants

[0053] After obtaining seeds of the stable overexpression line T2, the overexpression seeds were planted in seedling trays. Once the seedlings reached the three-leaf-one-heart stage, they were transferred to a light-cured incubator for 4℃ low-temperature treatment. The phenotypes of wild-type and overexpression plants were observed after 3 days. The results showed that under normal conditions, both wild-type and overexpression lines grew well, with no significant difference between them. However, after 3 days of low-temperature stress treatment, compared to the overexpression transgenic plants, the wild-type KN5585 plants exhibited more curled leaf edges, more wilted leaves, and a darker leaf color. Figure 6 A). Further measurements were performed on the three lines under control and low-temperature treatment conditions, including relative leaf water content, relative electrolyte permeability, and proline content. The results showed that under normal conditions, there was no difference in relative leaf water content, relative leaf conductivity, and proline content between the wild-type and overexpression plants; however, after low-temperature treatment, compared with the wild-type, the overexpression plants had higher leaf water content and lower relative leaf conductivity. These two results indicate that, physiologically, the leaves of the overexpression plants suffered less damage than those of the wild-type. Figure 6 (BC). Since osmotic regulators play an important role in plant responses to cold stress, the proline content of the three lines was subsequently measured. The results showed that the proline content in the two overexpression lines was higher than that in the wild-type plants, indicating that the osmotic regulator proline in the two overexpression lines may participate in osmotic regulation within maize and play a positive role in the overexpression plants' response to low-temperature stress. Figure 6 D).

[0054] 2.4.1.2 ZmKNOX13 gene-edited plants

[0055] After obtaining T2 generation seeds of stable genetically modified gene-edited lines, both gene-edited and wild-type seeds were planted in seedling trays. Once the seedlings reached the three-leaf-one-heart stage, they were transferred to a light-cured incubator for 4℃ low-temperature treatment. The phenotypes of wild-type and gene-edited plants were observed after 2 days. The results showed that under normal conditions, both wild-type and gene-edited lines grew well, with no significant difference between them. However, under low-temperature stress treatment, the leaves of both gene-edited lines were more curled and wilted than those of the wild-type plants. Figure 7 A). Further measurements were performed on the three lines under control and treatment conditions, including relative leaf water content, relative electrolyte permeability, and proline content. Under normal conditions, there were no differences in relative leaf water content, relative electrolyte permeability, and proline content between wild-type and gene-edited lines. However, under low-temperature treatment, compared with the wild type, the gene-edited lines had lower leaf water content, higher relative electrolyte permeability, and lower proline content. These results indicate that the gene-edited lines are more sensitive to low-temperature stress than the wild type. Figure 7 BD).

[0056] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. Maize low-temperature response transcription factors ZmKNOX13 The application of genes in response to low temperature stress in maize is characterized by, The ZmKNOX13 The nucleotide sequence of the gene is shown in SEQ ID NO.1; the transcription factor ZmKNOX13 Gene overexpression enables maize to resist low temperature stress.