A CRISPR / Cas12a-based lung cancer patient peripheral blood EGFR gene mutation detection system and method
By designing specific RPA primers and a CRISPR/Cas12a system for mismatched crRNA bases, the problem of PAM site identification in EGFR gene mutation detection was solved, enabling rapid and accurate detection of EGFR gene mutations, especially the identification of low-abundance mutation sites, which is applicable to peripheral blood samples from lung cancer patients.
Patent Information
- Application Number
- CN202211565839.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-07
- Publication Date
- 2026-07-21
- Estimated Expiration
- 2042-12-07
AI Technical Summary
The existing CRISPR/Cas12a system cannot identify the PAM site of some mutated genes, such as the T790M mutation sequence, when detecting EGFR gene mutations, and it cannot detect certain specific gene mutations, such as SNV, with high specificity, which limits its application in personalized treatment of lung cancer patients.
A recombinase polymerase amplification (RPA) primer targeting EGFR hotspot gene mutations was designed. By introducing PAM sites into the RPA primers through crRNA base mismatch and combining LbaCas12a and a single-stranded DNA fluorescent reporter group, rapid and accurate detection of EGFR gene mutations can be achieved.
It enables rapid and accurate detection of EGFR gene mutations, with high sensitivity and selectivity. It can identify low-abundance mutation sites, simplify the operation, reduce costs, and is suitable for peripheral blood sample testing in lung cancer patients.
Smart Images

Figure CN116377036B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of gene detection, and specifically relates to a CRISPR / Cas12a-based peripheral blood EGFR gene mutation detection system and method for lung cancer patients. Background Technology
[0002] Lung cancer is the leading cause of cancer-related death in my country, with 80% of cases being non-small cell lung cancer (NSCLC). Traditional treatments for lung cancer primarily involve radiotherapy and chemotherapy, but these methods have poor specificity and significant side effects. Drugs targeting key enzymes in signal transduction pathways related to tumor cell proliferation and differentiation have become an important direction in NSCLC treatment. Tyrosine kinase inhibitors (TKIs) designed to target mutations in the epidermal growth factor receptor (EGFR) gene are now widely used clinically, significantly improving patient survival, prolonging life, and enhancing quality of life.
[0003] EGFR is a membrane surface receptor with tyrosine kinase activity, widely present in human epidermal cells. It is highly expressed in various epithelial tumors and is associated with tumor proliferation, angiogenesis, invasion, and metastasis. The dysregulation of signal transduction caused by EGFR mutations or abnormal expression is closely related to tumor occurrence and development. Currently, approximately 10%–40% of NSCLC patients have EGFR gene mutations. EGFR mutations mainly occur in the first four exons of the intracellular TK region (exons 18, 19, 20, and 21), with more than 30 mutation types and sites, including ligand-independent EGFR-TK activating mutations and drug resistance mutations. EGFR activating mutations mainly fall into three categories: deletion, substitution, and duplication or insertion. 90% of these mutations are the deletion mutation del E746-A750 in exon 19 and the substitution mutation L858R in exon 21. These two hotspot mutations can significantly increase the sensitivity of patients to tyrosine kinases and are effective predictive indicators for evaluating the efficacy of TKIs. In recent years, numerous clinical trials have confirmed the significant efficacy of targeted therapy against EGFR-mutated genes in lung cancer treatment, effectively prolonging progression-free survival and improving patients' quality of life. However, the emergence of some drug resistance genes during treatment can have a significant impact on treatment outcomes, with approximately 50% of acquired resistance caused by the T790M mutation in exon 20. Therefore, accurately understanding the EGFR gene mutation status before treatment and continuously monitoring drug resistance gene mutations during treatment are of great importance for personalized precision treatment of NSCLC.
[0004] Tissue biopsy is currently the gold standard for cancer genotyping, but it has limitations due to tumor heterogeneity and disease progression. Liquid biopsy based on circulating tumor DNA (ctDNA) in peripheral blood can be used for early tumor diagnosis, prognostic monitoring, and drug efficacy monitoring. Currently, the main clinical methods include amplified arrestor mutation system PCR, flow cytometry-based magnetic bead emulsion amplification, digital PCR, and high-throughput sequencing. However, these methods suffer from problems such as complex operation, expensive equipment, and the need for specialized personnel training.
[0005] CRISPR / Cas technology, as a "next-generation molecular diagnostic," boasts advantages such as speed, portability, low cost, high sensitivity, and strong specificity. It has been proven suitable for various applications including pathogen detection, drug resistance analysis, SNP typing, and tumor gene mutation detection. For example, taking type II Cas12a discovered by Zhang Feng's team, the Cas12a protein, guided by crRNA, can specifically recognize and cleave target genes, subsequently activating its trans-cleavage activity. Based on this principle, adding a fluorescent ssDNA fragment to the reaction system allows for the release of a fluorescent signal indicating the presence of the target gene, thus identifying whether the sample contains the target gene. However, the currently established CRISPR / Cas12a system still faces two problems: first, some mutated genes, such as the EGFR gene T790M mutation sequence, lack the PAM site required for Cas12a enzyme recognition, preventing the Cas12a protein from recognizing and cleaving the target nucleic acid; second, it cannot detect certain specific gene mutations with high specificity, such as single nucleotide variants (SNVs), which significantly limits its clinical application. Summary of the Invention
[0006] The technical problem to be solved by the present invention is to provide a CRISPR / Cas12a-based peripheral blood EGFR gene mutation detection system and method for lung cancer patients. This detection system can rapidly and accurately identify EGFR gene mutation sequences and their wild-type sequences in peripheral blood samples, and has the characteristics of universality, speed, high sensitivity and low cost.
[0007] This invention provides a peripheral blood EGFR gene mutation detection system for lung cancer patients. The detection system includes recombinase polymerase amplification (RPA) primers targeting EGFR mutant genes, crRNA, LbaCas12a, and a single-stranded DNA fluorescent reporter group. The crRNA includes a specific EGFR gene deletion mutation ΔE746-A750-crRNA or a point mutation T790M-crRNA, with sequences as shown in SEQ ID NO: 1 or 2. The RPA primers include forward / reverse primers ΔE746-A750-F / R or T790M-F / R.
[0008] The T790M-crRNA contains an additional mismatched base compared to the original crRNA. This mismatched base refers to a base at the mutation site that is not complementary to the target sequence. The crRNA can be prepared by constructing an in vitro transcription vector and performing in vitro transcription and purification, or it can be synthesized directly.
[0009] The sequence of ΔE746-A750-F / R is shown in SEQ ID NO:3-4; the sequence of T790M-F / R is shown in SEQ ID NO:5-6. The T790M-F primer introduces the PAM site of TTTN through base mutation. The RPA primers are highly efficient and specific sequences selected according to relevant primer design principles. This invention designs RPA primers for EGFR hotspot gene mutations (ΔE746-A750 and T790M). Considering that there is no PAM sequence near the T790M mutation site, the PAM site containing TTTN is introduced by base mutation when designing the RPA primers.
[0010] The sequence of the single-stranded DNA fluorescent reporter group is as follows: 5'-6-FAM-TTTTT-IABkFQ-3'.
[0011] The LbaCas12a can be obtained through recombinant expression and purification or by using commercial LbaCas12a products provided by companies such as NEB.
[0012] This invention provides a method for detecting EGFR gene mutations in peripheral blood of lung cancer patients, comprising:
[0013] The RPA primers were used to perform RPA amplification on the nucleic acid sample to be tested, and the RPA amplification product was obtained. The crRNA, RPA amplification product, LbaCas12a, and single-stranded DNA fluorescent reporter group were mixed in the reaction system and reacted. The reaction product was detected by fluorescence detection to obtain the detection result.
[0014] The reaction system consisted of 20 μL of 0.5 μL crRNA (10 μM), 1.0 μL LbaCas12a (10 μM), and 2 μL 10×NE Buffer. TM 2.1 2 μl single-stranded DNA fluorescent reporter group (10 μM), 5 μl RPA amplification product and 9.5 μl water.
[0015] The reaction conditions are 37°C for 10–60 minutes, preferably 10–30 minutes.
[0016] The nucleic acid sample to be tested can be nucleic acid extracted from clinical samples, or a sample processed by other nucleic acid detection methods.
[0017] The fluorescence detection device can be any fluorescence detection device capable of fluorescence excitation and detection on the FAM fluorescence channel, or can be visually observed with the naked eye by blue light irradiation.
[0018] Beneficial effects
[0019] (1) Compared with other existing detection technologies, the present invention only requires a constant temperature device and a simple fluorescence reading device or direct observation with the naked eye. It is simple to operate, fast to detect, and shows good performance in EGFR gene mutation detection. It can accurately detect low abundance EGFR gene mutation sites and has good application prospects.
[0020] (2) In this invention, a large number of amplification products are generated through the high efficiency of RPA. The amplification products can be specifically recognized by Cas12a. The recognition process requires corresponding PAM sites. The method of introducing PAM sites (TTTN) by base mutation in RPA primers can solve the problem of no PAM sites at some target mutation sequences, which greatly increases the versatility of the method of this invention. At the same time, the high specificity and self-amplification ability of CRISPR / Cas12a further improve the sensing performance. In particular, the purpose of efficiently distinguishing SNV sites can be achieved by using crRNA mismatch bases. Thus, the detection method of this invention has the advantages of good accuracy, high sensitivity, strong selectivity, strong anti-interference ability, and good repeatability. Attached Figure Description
[0021] Figure 1 The results show the fluorescence signal intensity and naked-eye observation of the EGFR gene deletion mutation ΔE746-A750 in Example 1. Figure 2 The graph shows the results of the sensitivity (A) and selectivity (B) analysis of the EGFR gene deletion mutation ΔE746-A750 in Example 1.
[0022] Figure 3The results of agarose gel electrophoresis (A) and endpoint fluorescence detection (B) in Example 2 are shown.
[0023] Figure 4 The fluorescence signal intensity and naked-eye observation results for detecting the EGFR gene point mutation T790M in Example 2 are shown.
[0024] Figure 5 The graph shows the results of the sensitivity (A) and selectivity (B) analysis of the EGFR gene point mutation T790M in Example 2. Detailed Implementation
[0025] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, it should be understood that after reading the teachings of this invention, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.
[0026] First, let me briefly explain the mechanism of this invention: This invention uses a type V CRISPR system, in which the effector proteins are mainly from the Cas12 family. These nucleases generally possess non-specific ssDNA cleavage activity. When the Cas12 effector protein targets the target DNA sequence under the guidance of characteristic crRNA, its cis and trans cleavage activities are activated. By adding an ssDNA fluorescent reporter probe, when the target DNA sequence is present in the sample, the Cas12 trans cleavage activity is activated, the probe is cleaved, and fluorescence is released, thereby achieving the detection of the target gene sequence.
[0027] Further experiments revealed that base mismatches between crRNA and the target sequence affect trans-cleavage activity; mismatches at specific positions can lead to a significant reduction or even loss of cleavage activity. Based on this, the detection of SNV sites can be achieved.
[0028] Unless otherwise specified, the experimental methods described in the following examples are generally performed under standard experimental conditions or as recommended by the manufacturer. Unless otherwise specified, all materials and reagents used are commercially available products.
[0029] Example 1
[0030] Detection of EGFR gene ΔE746-A750 deletion mutation
[0031] This embodiment uses the ΔE746-A750 deletion mutation, which is the most common in exon 19, as an example for experimental purposes.
[0032] There are two types of mutations in exon 19: the ΔE746-A750 deletion mutation and its corresponding wild type.
[0033] The reference sequence for the ΔE746-A750 deletion mutation in exon 19 is as follows (as shown in SEQ ID NO:7):
[0034] 5'-TTCGGCCACGGTGTATAAGGGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTC CCGTCGCTATCAAAACATCTCCGAAAGCCAACAAGGAAATCCTCGATGAAGCCTACGTG ATGGCCAGCGTGGACAACCCCCACGTGTGCCGCCTGCTGGGCATCTGCCTCACCTC-3'
[0035] The wild-type reference sequence corresponding to the ΔE746-A750 deletion mutation in exon 19 is as follows (as shown in SEQ ID NO:8):
[0036] 5'-TTCGGCCACGGTGTATAAGGGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATT CCCGTCGCTATCAA GGAATTAAGAGAAGC AACATCTCCGAAAGCCAACAAGGAAATCC-3'
[0037] The underlined bases represent the ΔE746-A750 deletion mutation sequence.
[0038] The specific E746-A750-crRNA sequence designed for the ΔE746-A750 deletion mutation in exon 19 of the EGFR gene is as follows (as shown in SEQ ID NO:1):
[0039] 5'-UAAUUUCUACUAAGUGUAGAUGGAGAUGUUUUGAUAGCGAC-3'.
[0040] A transcription vector for E746-A750-crRNA was constructed and prepared using a T7 high-yield transcription kit (Thermo Fisher Scientific). The prepared crRNA was then processed using RNA Clean & Concentrator. TM -5 (Zymo Research) purification.
[0041] For the ΔE746-A750 deletion mutation in exon 19 of the EGFR gene and its corresponding wild-type sequence, the RPA forward primer sequence for amplifying the above target fragment was designed and synthesized (as shown in SEQ ID NO:3): GGACTCTGGATCCCAGAAGGTGAGAAAGTT; the reverse primer sequence was (as shown in SEQ ID NO:4): GTCCACGCTGGCCATCACGTAGGCTTCATC.
[0042] The method for processing the nucleic acid sample to be tested is to take 10 μL of sample solution for RPA amplification. The amplification product obtained is the processed nucleic acid sample. In this embodiment, the nucleic acid sample to be tested is artificially synthesized plasmid DNA containing the ΔE746-A750 deletion mutation in exon 19 of the EGFR gene and its corresponding wild-type sequence.
[0043] RPA reaction system: In a 50 μl system, add 29.5 μL rehydration buffer, 0.6 μL forward and reverse primers (10 μM), 10 μL nucleic acid sample template to be tested, and 6.8 μL water. After mixing the above system, add 2.5 μL magnesium acetate (280 mM) and react at 37 °C for 20 min.
[0044] Design and synthesis of single-stranded DNA fluorescent reporter group: a single-stranded double-quenched DNA fluorescent probe 5'-6-FAM-TTTTT-IABkFQ-3' composed of 5 T bases of FAM fluorescent group at the 5' end.
[0045] The above-mentioned ΔE746-A750-crRNA in vitro transcription product, the treated nucleic acid sample, LbaCas12a, and single-stranded DNA fluorescent reporter group were mixed in an appropriate ratio in a suitable system for reaction.
[0046] The reaction system consisted of: 0.5 μl crRNA (10 μM), 1.0 μl LbaCas12a (10 μM), and 2 μl 10×NE Buffer in a 20 μl system. TM 2.1. 2 μl of single-stranded DNA fluorescent reporter group (10 μM), 5 μl of treated nucleic acid sample, and 9.5 μl of water. The reaction system was incubated at 37 °C for 10–60 min.
[0047] The reaction products can be detected by a fluorescence detection device. Fluorescence is excited by excitation light with a wavelength of 485 nm, and the fluorescence intensity is detected at a wavelength of 535 nm to obtain the detection result; or the result can be determined by direct visual observation with the naked eye by irradiation with blue light.
[0048] The results showed that, at a reaction time of 60 min, the detection system described in this invention could effectively distinguish the ΔE746-A750 deletion mutation in exon 19 of the EGFR gene and its corresponding wild-type sequence, such as... Figure 1 As shown. Figure 1 The results showed that when using ΔE746-A750-specific crRNA to detect the ΔE746-A750 deletion mutation and its corresponding wild-type sample (WT), the ΔE746-A750 deletion mutation sample produced a significant fluorescence signal, while the wild-type sample (WT) corresponding to ΔE746-A750 did not produce a fluorescence signal. This indicates that the detection system described in this invention can effectively distinguish the EGFR gene deletion mutation ΔE746-A750 and its corresponding wild-type sample.
[0049] Sensitivity and selectivity analysis results showed that, with a reaction time of 30 min, the detection limit of the detection system described in this invention could be as low as 100 aM, and the detected mutation frequency was 0.02%. Figure 2 As shown. Using this invention to detect EGFR gene deletion mutation ΔE746-A750 nucleic acid samples (1 aM to 10,000 aM) at 10-fold serial dilutions, both fluorescence detection and naked-eye observation confirmed that the detection limit of this invention is as low as 100 aM, and it can highly selectively detect low-abundance mutant samples with a mutation frequency of 0.02% from wild-type samples.
[0050] Example 2
[0051] EGFR gene T790M point mutation detection
[0052] This embodiment uses the most common drug resistance mutation site T790M in exon 20 as an example for experiments.
[0053] There are two types of mutations in exon 20: the T790M mutation and its corresponding wild type.
[0054] The reference sequence for the T790M mutation in exon 20 is as follows (as shown in SEQ ID NO:9):
[0055] 5'-TACGTGATGGCCAGCGTGGACAACCCCCACGTGTGCCGCCTGCTGGGCATCTGCCTCACCTCCACCGTGCAGCTCATCATGCAGCTCATGCCCTTCGGCTGCCTCCTGGACTATGTCCGGGAACACAAAGACAATATTGGCTCCCAGTACCTGCTCAACTGGTGTGTGCA-3'.
[0056] The wild-type reference sequence corresponding to the T790M mutation in exon 20 is as follows (as shown in SEQ ID NO:10):
[0057] 5'-TACGGTGATGGCCAGCGTGGACAACCCCCACGTGTGCCGCCTGCTGGGCATCTGCC TCACCTCCACCGTGCAGCTCATCA C GCAGCTCATGCCCTTCGGCTGCCTCCTGGACTATG TCCGGGAACACAAAGACAATATTGGCTCCCAGTACCTGCTCAACTGGTGTGTGCA-3'.
[0058] The underlined bases represent the T790M mutation site in the EGFR gene.
[0059] A specific T790M-crRNA sequence was designed targeting the T790M mutation in exon 20 of the EGFR gene. Unlike the original crRNA, this sequence also carries an extra mismatched base to effectively achieve specific detection and differentiation of the SNV site. The reference sequence is as follows (as shown in SEQ ID NO:2):
[0060] 5'-UAAUUUCUACUAAGUGUAGA U UUGCAGCUCAUGCCCUUCGG-3'
[0061] The underlined base is an extra mismatched base introduced by T790M-crRNA.
[0062] Transcription vectors for T790M-crRNA were constructed and prepared using a T7 high-yield transcription kit (Thermo Fisher Scientific). The prepared crRNA was then processed using RNA Clean & Concentrator. TM -5 (Zymo Research) purification.
[0063] For the T790M mutation in exon 20 of the EGFR gene and its corresponding wild-type sequence, RPA forward and reverse primers for amplifying the above target fragment were designed and synthesized. Since there is no PAM sequence near the T790M mutation site, it cannot be recognized and cleaved by Cas enzyme. Therefore, when designing RPA primers, a PAM site with TTTN was artificially introduced by base mutation.
[0064] Specifically, the forward sequence of the RPA primers for the T790M mutation site is (as shown in SEQ ID NO:5): TCTGCCTCACCTCCACCGTGCAGCT TTTCA; the reverse primer sequence is (as shown in SEQ ID NO:6): GTTGAGCAGGTACTGGGAGCCAATATTGTC. The underlined parts represent the two mutant bases introduced in the design of the RPA forward primer.
[0065] The method for processing the nucleic acid sample to be tested is to take 10 μL of sample solution for RPA amplification, and the resulting amplification product is the processed nucleic acid sample. In this embodiment, the nucleic acid sample to be tested is artificially synthesized plasmid DNA containing the T790M mutation in exon 20 of the EGFR gene and its corresponding wild-type sequence.
[0066] RPA reaction system: In a 50 μl system, add 29.5 μL rehydration buffer, 0.6 μL forward and reverse primers (10 μM), 10 μL nucleic acid sample template to be tested, and 6.8 μL water. After mixing the above system, add 2.5 μL magnesium acetate (280 mM) and react at 37 °C for 20 min.
[0067] Design and synthesis of single-stranded DNA fluorescent reporter group: a single-stranded double-quenched DNA fluorescent probe 5'-6-FAM-TTTTT-IABkFQ-3' composed of 5 T bases of FAM fluorescent group at the 5' end.
[0068] The above-mentioned T790M-crRNA in vitro transcription product, the treated nucleic acid sample, LbaCas12a, and single-stranded DNA fluorescent reporter group were mixed in an appropriate ratio in a suitable system for reaction.
[0069] The reaction system consisted of: 0.5 μl crRNA (10 μM), 1.0 μl LbaCas12a (10 μM), and 2 μl 10×NE Buffer in a 20 μl system. TM 2.1. 2 μl of single-stranded DNA fluorescent reporter group (10 μM), 5 μl of treated nucleic acid sample, and 9.5 μl of water. The reaction system was incubated at 37 °C for 10–60 min.
[0070] The reaction products can be detected by a fluorescence detection device. Fluorescence is excited by excitation light with a wavelength of 485 nm, and the fluorescence intensity is detected at a wavelength of 535 nm to obtain the detection result; or the result can be determined by direct visual observation with the naked eye by irradiation with blue light.
[0071] To verify the effectiveness of RPA primers in cleaving the target gene after introduction into the PAM site, RPA was reacted in a 50 μl system at 37°C for 20 min, followed by Cas12 protein cleavage in a 20 μl system at 37°C for 60 min. A suitable amount of the reaction mixture was then subjected to agarose gel electrophoresis, and the fluorescence signal was read using a microplate reader. Results are as follows: Figure 3As shown, the design of mismatched bases in RPA primers can successfully introduce PAM sites into the target region, enabling LbaCas12a to effectively recognize and cleave the target sequence.
[0072] The test results showed that, at a reaction time of 60 minutes, the detection system described in this invention could effectively distinguish the T790M mutation in EGFR exon 20 and its corresponding wild-type sequence. Figure 4 As shown. Figure 4 The results showed that when T790M point mutation and its corresponding wild-type sample (WT) were detected using T790M specific crRNA, T790M sample produced obvious fluorescence signal, while wild-type sample (WT) corresponding to T790M did not produce fluorescence signal. This indicates that the detection system described in this invention can effectively distinguish EGFR gene point mutation T790M and its corresponding wild-type sample.
[0073] Sensitivity and selectivity analysis results show that, with a reaction time of 30 min, the detection limit of the detection system described in this invention can be as low as 100 aM, and it can highly selectively detect low-abundance mutant samples with a mutation frequency of 0.02% from wild-type samples. Figure 5 As shown. Using this invention to detect EGFR gene point mutation T790M nucleic acid samples (1 aM to 10,000 aM) at 10-fold serial dilutions, both fluorescence detection and naked-eye observation confirmed that the detection limit of this invention is as low as 100 aM, and it can highly selectively detect low-abundance mutant samples with a mutation frequency of 0.02% from wild-type samples.
[0074] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. A CRISPR / Cas12a-based peripheral blood EGFR gene mutation detection system for lung cancer patients, characterized in that: The detection system includes recombinase polymerase amplification (RPA) primers for EGFR mutant genes, crRNA, LbaCas12a, and a single-stranded DNA probe; wherein, the crRNA includes a specific EGFR gene deletion mutation ΔE746-A750-crRNA or a point mutation T790M-crRNA, the sequence of which is shown in SEQ ID NO:1 or 2; the RPA primers include forward / reverse primers ΔE746-A750-F / R or T790M-F / R; the sequence of ΔE746-A750-F / R is shown in SEQ ID NO:3~4; the sequence of T790M-F / R is shown in SEQ ID NO:5~6, and the T790M-F primer introduces the PAM site of TTTN through base mutation; the sequence of the single-stranded DNA probe is as follows: 5'-6-FAM-TTTTT-IABkFQ-3'.
Citation Information
Patent Citations
Kit used for detecting T790M mutation of EGFR gene
CN105886648A
Specific primer and probe and kit for detecting peripheral blood EGFR gene T790M mutation
CN108531600A