A SNP molecular marker for detecting the wax content of apple leaves and its application

Abstract

The present invention belongs to the technical field of molecular biotechnology and molecular markers, and discloses a SNP molecular marker for detecting wax in apple leaves and its application. The SNP molecular marker for detecting wax in apple leaves includes: the SNP position base of the high wax content germplasm on the MdHDG5 promoter is A / A or A / G, and the SNP position base of the low wax content germplasm is G / G. The present invention verifies the significant SNP on the MdHDG5 promoter by Sanger sequencing and CAPS technology, the SNP position base of the high wax content germplasm is A / A or A / G, and the SNP position base of the low wax content germplasm is G / G, and this SNP site can be used to develop a molecular marker for detecting the high and low wax content of leaves; the method of designing specific primers for PCR amplification and sequencing or CAPS identification is efficient, fast, and highly accurate, which can greatly help shorten the apple breeding period and concentrate on excellent traits.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biotechnology and molecular markers, and in particular relates to a SNP molecular marker for detecting the wax content of apple leaves and an application thereof. Background Art

[0002] At present, apples are the most popular fruit in my country. The Loess Plateau is the largest and best apple producing area in my country, but the precipitation in this producing area is small and the annual precipitation is unevenly distributed with more than 65% of precipitation concentrated in autumn. Drought restricts the growth of new shoots, causes flowers and fruits to fall, reduces the fruit setting rate, and affects yield and quality. Drought and water shortage have become the main environmental factors restricting the sustainable development of the apple industry in the Loess Plateau producing areas. Therefore, cultivating new varieties of drought-resistant and high-quality apples has become a key issue that needs to be urgently addressed for the healthy development of the apple industry in arid areas.

[0003] In order to cope with drought, plants have evolved a series of adaptation mechanisms at the morphological, physiological and molecular levels. Studies have shown that leaf wax is an important barrier for plants to resist drought stress. It can reduce the transpiration of leaf cuticle and reduce non-stomatal water loss, thus playing a role in drought resistance and water conservation, without affecting the accumulation of photosynthetic products.

[0004] Molecular markers are a type of genetic marker that detects genetic diversity at the DNA level and can also reflect nucleotide sequence variation. By utilizing the characteristics of molecular markers being linked to target traits, the purpose of selecting target traits can be achieved by identifying molecular markers.

[0005] CAPS technology is a technology that uses PCR to amplify the target DNA, and then digests the amplified product with specific endonucleases to cut it into fragments of different sizes, which are then distinguished directly on gel electrophoresis. This technology greatly improves the content and relative specificity of the target DNA, and the method is simple and the typing time is short. The complex genetic background, long juvenile period, and self-incompatibility of apples have seriously restricted apple genetic breeding and the selection of new varieties. Therefore, by designing a pair of specific primers for PCR amplification and then using CAPS technology for enzyme cutting, it is possible to effectively identify germplasm resources with high wax content in apple leaves, which provides an important reference for the selection of some apple varieties with high wax content in leaves.

[0006] Through the above analysis, the problems and defects of the existing technology are as follows: apple genetic breeding and the selection of new varieties are seriously restricted due to its complex genetic background, long juvenile period, self-incompatibility and other characteristics. Summary of the invention

[0007] In view of the problems existing in the prior art, the present invention provides a SNP molecular marker for detecting wax in apple leaves and an application thereof, and in particular relates to a SNP molecular marker for identifying the wax content in apple leaves.

[0008] The present invention is achieved by providing a SNP molecular marker for detecting wax in apple leaves, wherein the SNP molecular marker for detecting wax in apple leaves comprises: the SNP position base of the high wax content germplasm on the MdHDG5 promoter is A / A or A / G, and the SNP position base of the low wax content germplasm is G / G.

[0009] Furthermore, the primers for detecting the SNP molecular marker of apple leaf wax include a forward primer F and a reverse primer R, the nucleotide sequence of the forward primer F is SEQ ID NO: 1, and the nucleotide sequence of the reverse primer R is SEQ ID NO: 2.

[0010] Another object of the present invention is to provide an application of the SNP molecular marker for detecting apple leaf wax in identifying germplasm resources with high or low wax content in apple leaves.

[0011] Another object of the present invention is to provide a method for identifying the application of the SNP molecular marker for detecting apple leaf wax in identifying germplasm resources with high or low wax content in apple leaves.

[0012] Further, the method for identifying the SNP molecular marker for detecting apple leaf wax in identifying germplasm resources with high or low wax content in apple leaves comprises the following steps:

[0013] Step 1, extracting genomic DNA from different apple germplasms;

[0014] Step 2, using the extracted DNA as a template and primers for PCR amplification;

[0015] Step three: Use CAPS technology to digest the PCR product.

[0016] Furthermore, in the step three, if the SNP site in the amplified product is A / G or A / A, and the agarose gel result after enzyme cutting is three bands or one band, the apple plant to be tested belongs to a variety with high leaf wax content; if the SNP site in the amplified product is G / G, and the agarose gel result after enzyme cutting is two bands, the apple plant to be tested belongs to a variety with low leaf wax content; at the same time, the PCR products are sequenced using primers, and in varieties with relatively high leaf wax content, the sequencing peak graph in the SNP position is a single peak of A or a set of peaks of A; in varieties with relatively low leaf wax content, the sequencing peak graph in the SNP position is a single peak of G.

[0017] Another object of the present invention is to provide an application of the SNP molecular marker for detecting apple leaf wax in apple molecular marker-assisted breeding.

[0018] Another object of the present invention is to provide a gene MdHDG5 for regulating the wax content of apple leaves, which is used to implement the SNP molecular marker for detecting the wax in apple leaves.

[0019] Furthermore, the gene MdHDG5 used to regulate the wax content of apple leaves is LOC103420161.

[0020] Furthermore, genetic engineering was used to reduce the wax content in leaves by inhibiting the expression of the gene MdHDG5 in apple.

[0021] In combination with the above technical solutions and the technical problems solved, please analyze the advantages and positive effects of the technical solutions to be protected by the present invention from the following aspects:

[0022] First, in view of the technical problems existing in the above-mentioned prior art and the difficulty of solving the problems, the technical solutions to be protected by the present invention and the results and data during the research and development process are closely combined to analyze in detail and deeply how the technical solutions of the present invention solve the technical problems, and some creative technical effects brought about after solving the problems. The specific description is as follows:

[0023] The embodiment of the present invention uses the Illumina HiSeq4000 sequencing platform to sequence the genomes of 158 apple germplasms, and obtains a total of 5.94 million SNPs. Then, the present invention extracts wax from mature leaves of different apple germplasms, determines the leaf wax components and their contents of different apple germplasms by GC-MS, performs GWAS analysis on the obtained phenotypic data, and locates the significantly associated MdHDG5. The haplotype analysis provided by the present invention shows that there are SNP sites on its promoter that can distinguish the high and low wax content phenotypes of different germplasms, but there are no SNPs in the genome sequence of MdHDG5 that can distinguish the high and low wax content phenotypes. Therefore, the present invention develops molecular markers for breeding apple varieties with high leaf wax content through this SNP site. In addition, the present invention verifies the significant SNP on the MdHDG5 promoter by Sanger sequencing and CAPS technology. The verification results found that the SNP position bases of high wax content germplasm are A / A or A / G, and the SNP position bases of low wax content germplasm are G / G. This SNP site can be used to develop molecular markers to detect the high and low wax content of leaves.

[0024] Second, considering the technical solution as a whole or from the perspective of the product, the technical effects and advantages of the technical solution to be protected by the present invention are described in detail as follows:

[0025] The invention solves the problem of breeding varieties with high leaf wax content by designing specific primers for PCR amplification and sequencing or CAPS identification, and can screen apple germplasm resources with high leaf wax content; the invention is efficient, fast and highly accurate by designing specific primers for PCR amplification and sequencing or CAPS identification, and can greatly help shorten the apple breeding period and concentrate on excellent traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments of the present invention. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0027] Figure 1 Schematic diagram of the discovery of MdHDG5 and the determination of its SNP provided in Example 1 of the present invention; A is the use of the Illumina HiSeq 4000 sequencing platform to re-sequence the genomes of 158 apple germplasm resources and determine the leaf wax of these 158 apple germplasm resources; through the whole genome association analysis of apple leaf wax, a transcription factor MdHDG5 significantly associated with apple leaf wax was found; B is the haplotype analysis of MdHDG5 showing that there are SNP sites on its promoter that can distinguish high and low wax phenotypes of different germplasms, but there is no SNP in the genome sequence of MdHDG5 that can distinguish high and low wax phenotypes;

[0028] Figure 2 1 is a schematic diagram of verifying the MdHDG5 promoter SNP provided in Example 1 of the present invention; A is cloning the promoters of germplasm resources with different leaf wax contents and performing Sanger sequencing; in varieties with relatively high leaf wax, the sequencing peak graph at the SNP position is a single peak A or a set of peaks A, and in varieties with relatively low leaf wax, the sequencing peak graph at the SNP position is a single peak G (Note: each peak graph is a mixed sample of PCR products of five samples); B is verifying the MdHDG5 promoter SNP by CAPS technology; the agarose gel result after enzyme digestion in high wax varieties is three or one band, and the agarose gel result after enzyme digestion in low wax varieties is two bands;

[0029] Figure 3 This is a schematic diagram of the expression level of MdHDG5 in different germplasms provided in Example 1 of the present invention;

[0030] Figure 4 This is a schematic diagram of gene expression detection of the MdHDG5 interference strain provided in Example 2 of the present invention;

[0031] Figure 5It is a schematic diagram of the detection of chlorophyll leaching rate of the MdHDG5 interference strain and GL-3 provided in Example 2 of the present invention;

[0032] Figure 6 It is a schematic diagram of detecting the leaf wax content of the MdHDG5 interference strain and GL-3 provided in Example 2 of the present invention;

[0033] Figure 7 It is a flow chart of a method for applying SNP molecular markers for identifying and detecting wax in apple leaves provided by an embodiment of the present invention in identifying germplasm resources with high or low wax content in apple leaves. DETAILED DESCRIPTION

[0034] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0035] In view of the problems existing in the prior art, the present invention provides a SNP molecular marker for detecting wax in apple leaves and its application. The present invention is described in detail below in conjunction with the accompanying drawings.

[0036] 1. Explanatory Examples In order to enable those skilled in the art to fully understand how to implement the present invention, this section provides an illustrative example that expands and describes the technical solution of the claims.

[0037] The embodiment of the present invention uses the Illumina HiSeq4000 sequencing platform to sequence the genomes of 158 apple germplasms, and a total of 5.94 million SNPs are obtained. Then wax is extracted from mature leaves of different apple germplasms, and the leaf wax components and their contents of different apple germplasms are determined by GC-MS. The obtained phenotypic data are subjected to GWAS analysis, and the significantly associated MdHDG5 is located. Haplotype analysis shows that there are SNP sites on its promoter that can distinguish high and low wax phenotypes of different germplasms, but there are no SNPs in the genome sequence of MdHDG5 that can distinguish high and low wax phenotypes. Therefore, the present invention develops molecular markers for breeding apple varieties with high leaf wax content through this SNP site.

[0038] The embodiment of the present invention verifies the significant SNP on the MdHDG5 promoter by Sanger sequencing and CAPS technology; the verification results show that the SNP position bases of high wax content germplasm are A / A or A / G, and the SNP position bases of low wax content germplasm are G / G.

[0039] The embodiment of the present invention also provides a primer for detecting a SNP molecular marker related to the wax content of apple leaves, comprising a forward primer F and a reverse primer R; wherein the nucleotide sequence of the forward primer F is SEQ ID NO: 1, which is 5'-GTAGGGAACCCATTATGCCTCAAG-3'; and the nucleotide sequence of the reverse primer R is SEQ ID NO: 2, which is 5'-GGTGGGGTCTATTAGTTCAAGACAG-3'.

[0040] The embodiment of the present invention also provides an application of a SNP molecular marker related to the wax content of apple leaves in identifying germplasm resources with high or low wax content of apple leaves.

[0041] like Figure 7 As shown, the method for applying the SNP molecular marker for identifying and detecting wax in apple leaves provided by the embodiment of the present invention in identifying germplasm resources with high or low wax content in apple leaves comprises the following steps:

[0042] S101, extraction of genomic DNA from different apple germplasms;

[0043] S102, using the extracted DNA as a template and primers for PCR amplification;

[0044] S103, using CAPS technology to digest the PCR product.

[0045] In step S103 provided in an embodiment of the present invention, if the SNP site in the amplified product is A / G or A / A, and the agarose gel result after enzyme cutting is three bands or one band, the apple plant to be tested belongs to a variety with high leaf wax content; if the SNP site in the amplified product is G / G, and the agarose gel result after enzyme cutting is two bands, the apple plant to be tested belongs to a variety with low leaf wax content; at the same time, the PCR product can also be sequenced using the above-mentioned primers; in varieties with relatively high leaf wax content, the sequencing peak graph at the SNP position is a single peak of A or a set of peaks of A, and in varieties with relatively low leaf wax content, the sequencing peak graph at the SNP position is a single peak of G.

[0046] The embodiment of the present invention also provides an application of a SNP molecular marker related to the wax content of apple leaves in apple molecular marker-assisted breeding.

[0047] The embodiment of the present invention also provides a gene MdHDG5 (LOC103420161) for regulating the wax content of apple leaves; by using genetic engineering means, the wax content of apple leaves can be reduced by inhibiting the expression of the gene.

[0048] 2. Evidence of the effects of the embodiments The embodiments of the present invention have achieved some positive effects during the development or use process, and indeed have great advantages over the prior art. The following content is described in conjunction with the data, charts, etc. of the test process.

[0049] Example 1: Discovery of MdHDG5 and verification of its promoter SNP

[0050] The embodiment of the present invention uses the Illumina HiSeq4000 sequencing platform to resequence the genomes of 158 apple germplasm resources, and obtains a total of 5.94 million SNPs. Then, wax is extracted from mature leaves of different apple germplasms, and the wax composition and content are determined by gas chromatography-mass spectrometry. Through the whole genome association analysis of apple leaf wax, a transcription factor MdHDG5 significantly associated with apple leaf wax is found. Haplotype analysis shows that there are SNP sites on its promoter that can distinguish high and low wax phenotypes of different germplasms, but there is no SNP in the genome sequence of MdHDG5 that can distinguish high and low wax phenotypes. The embodiment of the present invention selects some high-wax and low-wax germplasms to detect the expression level of MdHDG5 and finds that the expression level of MdHDG5 in high-wax germplasms is higher. On this basis, the embodiment of the present invention clones the promoters of germplasm resources with different leaf wax contents, performs Sanger sequencing, and verifies SNPs by CAPS technology. This SNP site can be used to develop molecular markers for detecting the high and low wax content of leaves.

[0051] The specific method is as follows:

[0052] 1. Total RNA extraction from apple leaves of different germplasms

[0053] (1) Grind the sample into powder in liquid nitrogen and place it into a 2.0 mL siliconized centrifuge tube.

[0054] (2) Preheat CTAB in a 65°C water bath. Add 700 μL CTAB and 40 μL β-mercaptoethanol to the sample. Vortex mix well and place in a water bath at 65°C for 10 min. Shake three times during the mixing.

[0055] (3) After the water bath, take out the sample and cool it to room temperature. Add 700 μL of chloroform:isoamyl alcohol (24:1) and mix well.

[0056] (4) Centrifuge the sample at 12000 rpm at 4°C for 10 min.

[0057] (5) Remove the sample, pipette 500 μL of supernatant into a new siliconized tube, add 500 μL of chloroform:isoamyl alcohol (24:1) to the sample, and mix by inversion.

[0058] (6) Centrifuge the sample at 12000 rpm for 10 min at 4°C, pipette 300 μL of the supernatant into a new siliconized tube, add 30 μL of 3 mol / L sodium acetate (pH = 5.2) and 600 μL of anhydrous ethanol to the sample, mix by inversion, and let stand at -20°C overnight.

[0059] (7) Take out the sample that has been left to stand overnight, centrifuge it at 12,000 rpm at 4°C for 20 min, discard the supernatant, and dry it in a fume hood.

[0060] (8) Add 500 μL of 75% ethanol to the sample, centrifuge at 12,000 rpm at 4°C for 30 s, and discard the supernatant.

[0061] (9) Add 500 μL of anhydrous ethanol to the sample, centrifuge at 12,000 rpm at 4°C for 1 min, discard the supernatant, and air dry in a fume hood.

[0062] (10) Add 303 μL DEPC water, 35 μL DNase I Buffer, and 12 μL DNase I to the sample and incubate in a 37°C water bath for 30 min. Remove the sample, add 150 μL DEPC water and 500 μL chloroform:isoamyl alcohol (24:1), mix well, and centrifuge at 12,000 rpm at 4°C for 10 min.

[0063] (11) Take 400 μL of the supernatant, add 40 μL of 3 mol / L sodium acetate (pH=5.2) and 800 μL of anhydrous ethanol, and settle at -20°C for 2 h. Centrifuge at 4°C, 12,000 rpm for 10 min, discard the supernatant, add 500 μL of 70% ethanol, centrifuge at 4°C, 12,000 rpm for 10 min, and discard the supernatant.

[0064] (12) Add 500 μL of anhydrous ethanol, centrifuge at 12,000 rpm at 4°C for 10 min, discard the supernatant, and dry in a fume hood.

[0065] (13) Add 30 μL of DEPC water to dissolve the RNA and measure the concentration using a UV spectrophotometer.

[0066] 2. Reverse transcription reaction system and steps (1) Removal of genomic DNA

[0067] Prepare the following mixture in an RNase-free centrifuge tube.

[0068] 4xgDNA wiper Mix (Vazyme, R223) 4μL

[0069] Template RNA 1 μg

[0070] RNase-free ddH2O (Vazyme, R223) added to 16 μL

[0071] Mix by gently pipetting. Incubate at 42°C for 2 min.

[0072] (2) Configure the reverse transcription reaction system

[0073] 5x HiScript II qRT SuperMix II (Vazyme, R223) 4μL

[0074] First step reaction solution 16μL

[0075] Mix by gently pipetting.

[0076] 50℃15min, 85℃5sec.

[0077] The product can be used immediately for qPCR reaction or stored at -20℃ and used within half a year.

[0078] 3. Fluorescence quantitative reaction system

[0079] Design MdHDG5-specific primers (F: GTCGTGGACGGCTATATCTGATT, R: TAAGGGAGCCAAGTGGTAGAAAC);

[0080] Fluorescence quantification was performed using SYBR Green fluorescent quantitative premix (Yugong Biolabs Co., Ltd., REF: EG20117M) in CFX96. The PCR reaction program was as follows: 95°C, 15 mins; 95°C 10 sec, 60°C 30 sec, for a total of 40 cycles. -ΔΔCt Perform statistical analysis.

[0081] 4. DNA extraction from apple germplasm resources

[0082] (1) Collect apple germplasm leaves from the field, wrap them in tin foil, mark them, and place them in liquid nitrogen.

[0083] (2) Grind the sample into powder in liquid nitrogen and place it into a siliconized tube.

[0084] (3) Preheat CTAB in a 65°C water bath, add 700 μL CTAB and 40 μL β-mercaptoethanol to the sample, vortex mix, and place in a water bath at 65°C for 10 min.

[0085] (4) After the water bath, take out the sample and cool it to room temperature. Add 700 μL of chloroform:isoamyl alcohol (24:1) and mix well.

[0086] (5) Centrifuge the sample at 12000 rpm at 4°C for 10 min.

[0087] (6) Remove the sample, pipette 500 μL of supernatant into a new siliconized tube, add 500 μL of chloroform:isoamyl alcohol (24:1) to the sample, and mix by inversion.

[0088] (7) Centrifuge the sample at 12000 rpm at 4°C for 10 min.

[0089] (8) Pipette 300 μL of the supernatant into a new siliconized tube, add 30 μL of 3 mol / L sodium acetate (pH = 5.2) and 600 μL of anhydrous ethanol to the sample, invert to mix, and let stand at -20°C overnight.

[0090] (9) Centrifuge at 12,000 rpm at 4°C for 10 min, discard the supernatant, add 500 μL 70% ethanol, centrifuge at 12,000 rpm at 4°C for 10 min, and discard the supernatant.

[0091] (10) Add 500 μL of anhydrous ethanol, centrifuge at 12,000 rpm at 4°C for 10 min, discard the supernatant, and dry in a fume hood.

[0092] (11) Dissolve in 30 μL of water and store at -20°C.

[0093] 5. MdHDG5 promoter fragment amplification and CAPS verification of SNP sites

[0094] (1) Amplification of MdHDG5 promoter fragment.

[0095] The promoter fragment containing SNP was amplified using the DNA of different germplasms extracted as above as template, and the system was as follows:

[0096]

[0097]

[0098] Among them, F:GTAGGGAACCCATTATGCCTCAAG;

[0099] R:GGTGGGGTCTATTAGTTCAAGACAG.

[0100] The PCR reaction procedure is as follows:

[0101] Pre-denaturation at 95°C for 3 min; 35 cycles of 95°C for 15 s, 56°C for 15 s, and 72°C for 30 sec; and finally extension at 72°C for 5 min.

[0102] (2) CAPS verifies SNP sites.

[0103] The sequence of the amplified promoter fragment containing SNP was analyzed using http: / / helix.wustl.edu / dcaps / , and the Hph I restriction site (the sequence recognized by the enzyme is GGTGA) was found. CAPS detection was performed on the promoter fragments containing SNP amplified from different apple germplasm resources.

[0104] Enzyme digestion reaction system

[0105]

[0106] The results were analyzed by agarose gel electrophoresis at 37°C for 3 h.

[0107] CAPS was used to analyze the promoters of different apple germplasms (including high and low wax content). The SNP position bases of the high wax content germplasm were A / G or A / A, and the SNP position bases of the low wax content germplasm were G / G. The results are as follows Figure 2 RNA was extracted from different germplasms (including high and low wax content) and reverse transcribed. The expression level of MdHDG5 was analyzed in these germplasms. It was found that the expression level of MdHDG5 was high in high wax content germplasms and low in low wax content germplasms. The results are shown in Figure 3 shown.

[0108] Example 2: Waxy phenotype of leaves of MdHDG5 transgenic plants

[0109] 1. Agrobacterium-mediated leaf infection of apple leaves

[0110] (1) Take the overnight cultured Agrobacterium out of the incubator, harvest the bacteria at 5000 rpm for 5 min, and wash the bacteria twice with a resuspension solution. Pour off the supernatant and resuspend the bacteria with a resuspension solution.

[0111] (2) Select wild-type GL-3 tissue culture seedlings with young and sterile leaves, remove appropriate leaves with tweezers, place the leaves with the back facing down in the resuspension solution, use a surgical blade to quickly scratch the back of the leaves, transfer the scratched leaves to the bacterial solution and shake for 30 minutes to ensure full contact between the bacterial solution and the wound.

[0112] (3) Remove the leaf with tweezers, place it with the back of the leaf facing down on sterile filter paper to absorb moisture, and then spread it with the back of the leaf facing up on the co-culture medium and culture it in the dark at room temperature for 3 days.

[0113] (4) Take out the apple leaves that have been cultured for 3 days from the incubator, observe whether there is any sign of contamination, and place them in the clean bench together with the screening culture medium.

[0114] (5) After sterilizing with high temperature in a sterilizer, tweezers and scalpels are allowed to cool. Remove the sealing film and move the leaves on the co-culture medium with the back facing up to the screening medium. When laying the leaves, keep 10 to 15 leaves on each screening medium, with a certain distance between the leaves. Press lightly on the undamaged parts of the leaves to fix them to prevent them from moving.

[0115] (6) The leaves were cultured in the dark at room temperature in an incubator for 30 days, and then leaves with buds were selected again and replaced with new screening medium for culture in the light at room temperature.

[0116] 2. Chlorophyll leaching experiment

[0117] (1) Wild-type GL-3 and transgenic seedlings with robust and consistent growth were selected, and leaves of uniform tenderness were picked from the same part of each seedling. Five leaves were collected for each sample, with three biological replicates.

[0118] (2) Prepare a clean 50 mL centrifuge tube, pour in 30 mL of 80% ethanol, add the leaves to the centrifuge tube so that they are soaked in alcohol, mark it, cover it with a black cloth and keep it in a dark place to reduce the error caused by the loss of chlorophyll due to light decomposition.

[0119] (3) Every 10 minutes, take 1 mL of alcohol from each sample and add it to a new 1.5 mL centrifuge tube and label it with the sample name and sampling time. Before sampling, shake the centrifuge tube to make the sample uniform. All samples should be stored in a dark place.

[0120] (4) After 80 minutes of leaching, place all samples in a dark place. After 24 hours of leaching, place all samples in a dark place.

[0121] (5) The chlorophyll content of all samples was measured using an ELISA instrument (647 nm and 664 nm).

[0122] 3. Determination of wax content in leaves of transgenic plants

[0123] (1) Select transgenic plants and wild-type GL-3 plants that grow vigorously and uniformly. Take intact apple leaves, scan the leaf area first, and then immerse them in a beaker with chloroform to extract epidermal wax for 60 seconds. After the extraction, add 20 μL of 1 μg / μL n-tetracosane as an internal standard to each sample.

[0124] (2) Filtration and volatilization: When the extracted wax mixture evaporates to about 1 / 2 of its previous volume, filter it with a 0.45 μm organic filter membrane, transfer it to another clean glass centrifuge tube of about 10 mL, place it in a fume hood and evaporate it to less than 3 mL, then blow it dry with a nitrogen blower.

[0125] (3) In a fume hood, add 40 μL of pyridine and 40 μL of BSTFA to a glass centrifuge tube, mix gently, quickly cover the tube, and place it in a water bath at 70°C for 60 min. Immediately dry the derivatization agent with nitrogen, add about 1 mL of chloroform to re-dissolve the sample, and then filter it with a 0.22 μm organic filter membrane into a GC chromatography vial.

[0126] (4) Analyze the samples using gas chromatography-mass spectrometry.

[0127] The MdHDG5 interference strain was obtained by infecting apple leaves with Agrobacterium-mediated leaf infection. The expression level of the interference strain was detected as follows: Figure 4 Then, the present invention identified the leaf wax phenotype of the interference strains. Through chlorophyll extraction experiments and GC-MS determination of leaf wax, it was found that the leaf wax of the MdHDG5 interference strain was lower than that of GL-3. Figure 5 and Figure 6 shown.

[0128] The above description is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Any modifications, equivalent substitutions and improvements made by any technician familiar with the technical field within the technical scope disclosed by the present invention and within the spirit and principle of the present invention should be covered by the protection scope of the present invention.

Claims

1. Application of a primer for detecting SNP molecular markers of apple leaf wax in identifying germplasm resources with high or low wax content in apple leaves, characterized in that: The primers for detecting the SNP molecular marker of apple leaf wax include a forward primer F and a reverse primer R, wherein the nucleotide sequence of the forward primer F is 5'-GTAGGGAACCCATTATGCCTCAAG-3'; the nucleotide sequence of the reverse primer R is 5'-GGTGGGGTCTATTAGTTCAAGACAG-3'; the SNP is located in the gene HkDJ The gene HkDJ The residue was LOC103420161. The endonuclease used for restriction digestion was Hph I, and the base at the SNP position was A / G.

2. The method for using the primers for detecting SNP molecular markers of apple leaf wax as claimed in claim 1 in identifying germplasm resources with high or low wax content in apple leaves, characterized in that: The following steps are involved: Step 1, extracting genomic DNA from different apple germplasms; Step 2, using the extracted DNA as a template and primers for PCR amplification; Step 3, using CAPS technology to digest the PCR product; In the step three, if the SNP site in the amplified product is A / G or A / A, and the agarose gel result after enzyme cutting is three bands or one band, the apple plant to be tested belongs to a variety with high leaf wax content; if the SNP site in the amplified product is G / G, and the agarose gel result after enzyme cutting is two bands, the apple plant to be tested belongs to a variety with low leaf wax content; at the same time, the PCR product is sequenced using primers, and in varieties with relatively high leaf wax, the sequencing peak graph at the SNP position is a single peak A or a set of peaks A; in varieties with relatively low leaf wax, the sequencing peak graph at the SNP position is a single peak G.

Images