A genetically engineered bacterium with high d-pantothenic acid yield, a construction method and application thereof

Abstract

The present application relates to the technical field of genetic engineering, and discloses a genetically engineered bacterium for high-yield D-pantothenic acid, a construction method and application.The genetically engineered bacterium for high-yield D-pantothenic acid is obtained by knocking out an ilvA gene in Corynebacterium glutamicum ATCC 13032 to reduce the consumption of pyruvic acid for isoleucine generation, overexpressing a 3-methyl-2-oxobutyric acid hydroxymethyltransferase gene panB and a pantothenate synthetase gene panC in a pantothenic acid synthesis pathway, and heterologously overexpressing a pantothenate reductase panE from Escherichia coli to further improve the yield of D-pantothenic acid in the Corynebacterium glutamicum ATCC 13032.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a genetically engineered bacterium that produces high levels of D-pantothenic acid, its construction method, and its applications. Background Technology

[0002] D-Pantothenic acid, a component of coenzyme A, participates in regulating the metabolism of proteins, sugars, and fats, improving hair color, and preventing diseases. In particular, poultry, livestock, and fish require calcium pantothenate for growth and development, as well as for fat synthesis and breakdown. A deficiency in pantothenate can lead to stunted growth, reproductive dysfunction, and reduced adaptability in poultry and livestock. As a B vitamin, calcium D-pantothenate is widely used in the pharmaceutical industry both domestically and internationally. Its single-ingredient preparations are primarily indicated for pantothenic acid deficiency, while compound B vitamins and multivitamin preparations are mainly used for vitamin supplementation. Compound preparations combined with different components have a wider range of indications, such as gastrointestinal diseases, respiratory diseases, skin diseases, lethargy, and neurasthenia. In addition, calcium pantothenate is also used in health foods. Currently, many health products both domestically and internationally contain calcium pantothenate, such as YST's "Adult Vitamins" and "Growth Happiness."

[0003] Among the known methods for synthesizing D-pantothenic acid, industrial production mainly relies on chemical synthesis, but this involves the use of highly toxic raw materials such as hydrogen cyanide or sodium cyanide, and also presents problems such as cumbersome optical separation and cyanide-containing wastewater pollution.

[0004] With the increasing understanding of microbial metabolic processes and the growing development of metabolic engineering technology, the production of D-pantothenic acid by microbial fermentation has gradually attracted attention due to its advantages such as low substrate cost, easy separation, and low toxicity.

[0005] The fermentation production of D-pantothenic acid primarily involves constructing high-yield pantothenic acid strains and then adding β-alanine exogenously. For example, in US patent 6686183, a series of modifications were made to the valine-resistant strain FE6 to obtain a high-yield D-pantothenic acid strain. However, certain drawbacks and problems remain, such as the complexity of the biosynthetic pathway and the need for strict control leading to instability in the fermentation process and low yields.

[0006] Therefore, finding a way to increase D-pantothenic acid production and constructing a high-yielding D-pantothenic acid strain remains a major challenge. Summary of the Invention

[0007] To address the aforementioned technical problems in increasing D-pantothenic acid (D-Pantothenic Acid) production, this invention provides a high-yield D-Pantothenic Acid genetically engineered bacterium, its construction method, and its applications. The high-D-Pantothenic Acid-producing genetically engineered bacterium provided by this invention uses *Corynebacterium glutamicum* ATCC13032 as the substrate bacterium. By knocking out the ilvA gene while simultaneously overexpressing the panB and panC genes in the *Corynebacterium glutamicum* ATCC 13032 genome and the panE gene in the *Escherichia coli* MG1655 genome, the D-Pantothenic Acid production in *Corynebacterium glutamicum* is increased. The resulting genetically engineered bacterium produces D-Pantothenic Acid with high potency through fermentation.

[0008] The specific technical solution of this invention is as follows: On one hand, this invention relates to a genetically engineered bacterium that produces high levels of D-pantothenic acid, constructed by the following method: (1) Knock out the ilvA gene in the genome of Corynebacterium glutamicum ATCC 13032 to obtain Corynebacterium glutamicum ATCC13032△ilvA; (2) Overexpress the panB and panC genes in the genome of Corynebacterium glutamicum ATCC 13032 and the panE gene in the genome of Escherichia coli MG1655 in Corynebacterium glutamicum ATCC 13032△ilvA, i.e. the genetically engineered bacterium that produces high levels of D-pantothenic acid.

[0009] In the metabolism of bacterial strains, there are non-linear relationships between different metabolic pathways, as well as competition and cooperation between cofactors and main metabolic pathways. The genetically engineered bacterium with high D-pantothenic acid production provided by this invention reduces the consumption of pyruvate to generate isoleucine by knocking out the ilvA gene in Corynebacterium glutamicum ATCC13032, while overexpressing the 3-methyl-2-oxo-bridging butyrate hydroxymethyltransferase gene panB and the pantothenic acid synthase gene panC in the pantothenic acid synthesis pathway, and heterologously overexpressing the pantothenic acid reductase gene panE from Escherichia coli, thereby further increasing the D-pantothenic acid production in Corynebacterium glutamicum ATCC 13032.

[0010] While existing technologies, such as patents US662394 and US6787334, disclose that overexpression of panBCD is beneficial for D-pantothenic acid accumulation, these modifications were performed on the anti-valine strain FE6. Furthermore, there are no reports in the existing literature that heterologous overexpression of the panE gene from *E. coli* can further increase D-pantothenic acid production in *Corynebacterium glutamicum*. Our research team discovered that in *Corynebacterium glutamicum*, overexpression of panBC, heterologous overexpression of the panE gene from *E. coli*, and knockout of the ilvA gene can further increase D-pantothenic acid production.

[0011] On the other hand, the present invention also relates to a method for constructing a genetically engineered bacterium that produces high levels of D-pantothenic acid, the method comprising the following steps: S1: knocking out the ilvA gene: knocking out the ilvA gene in the genome of Corynebacterium glutamicum ATCC 13032 to obtain Corynebacterium glutamicum ATCC 13032△ilvA; S2: Overexpression of panB, panC, and panE genes: The panB and panC genes from the genome of Corynebacterium glutamicum ATCC 13032 and the panE gene from the genome of Escherichia coli MG1655 were introduced into Corynebacterium glutamicum ATCC 13032△ilvA for overexpression, which is the genetically engineered bacterium that produces high levels of D-pantothenic acid.

[0012] Specifically, the nucleotide sequence of the ilvA gene is shown in SEQ ID NO.1 of the sequence listing.

[0013] Specifically, the nucleotide sequence of the panB gene is shown in SEQ ID NO.2 of the sequence listing.

[0014] Specifically, the nucleotide sequence of the panC gene is shown in SEQ ID NO.3 of the sequence listing.

[0015] Specifically, the nucleotide sequence of the panE gene is shown in SEQ ID NO.4 of the sequence listing.

[0016] Specifically, the method for knocking out the ilvA gene is as follows: knocking out the gene using homologous recombination editing technology.

[0017] As a preferred embodiment of the present invention, the construction method of Corynebacterium glutamicum ATCC 13032△ilvA is as follows: using the genome of the starting strain Corynebacterium glutamicum ATCC 13032 as a template, the upstream and downstream homologous arm fragments of ilvA are amplified using primers ilvA-1, ilvA-2 and ilvA-3, ilvA-4; the shuttle plasmid pK18mobsacB is double-digested with HindIII and EcoRI at 37℃ for 1 h to obtain linearized pK18mobsacB; the linearized pK18mobsacB is ligated with the upstream and downstream homologous arm fragments to obtain the recombinant plasmid pK18mobsacB-ilvA; the recombinant plasmid is electroporated into electroporated competent Corynebacterium glutamicum ATCC 13032, and the ilvA gene is knocked out using homologous recombination editing technology to construct the strain Corynebacterium glutamicum ATCC 13032△ilvA.

[0018] As a preferred embodiment of the present invention, the method for introducing the panB and panC genes from the genome of Corynebacterium glutamicum ATCC 13032 and the panE gene from the genome of Escherichia coli MG1655 into Corynebacterium glutamicum ATCC 13032△ilvA is as follows: using the genome of Corynebacterium glutamicum ATCC 13032 as a template, the panBC1 gene fragment is amplified using primers panBC-1 and panBC-3; using the genome of E. coli MG 1655 as a template, the panE gene fragment is amplified using primers panBC-3 and panE-R, and then cloned in one step with the linearized plasmid pXMJ19 and electroporated into electroporated competent Corynebacterium glutamicum ATCC13032△ilvA.

[0019] Meanwhile, the present invention also relates to the application of this genetically engineered bacterium that produces high levels of D-pantothenic acid in the microbial fermentation preparation of D-pantothenic acid.

[0020] Specifically, the application method is as follows: inoculate the fermentation medium with an inoculum concentration of 2-4% by volume, and ferment and culture it under the conditions of pH 6.7-7.0 and temperature 25-35℃.

[0021] As a preferred embodiment of the present invention, the fermentation culture medium is composed of the following: 20 g / L glucose, 10 g / L (NH4)2SO4, 0.5 g / L KH2PO4, 0.5 g / L MgSO4, 3 g / L yeast extract, 10 g / L CaCO3, and 1 ml / L trace element solution in deionized water with a natural pH. The trace element solution is composed of: 10 g / L CuCl2, 10 g / L FeSO4·7H2O, 1 g / L ZnSO4·7H2O, 0.20 g / L CuSO4, and 0.02 g / L NiCl2·7H2O in deionized water.

[0022] Compared with the prior art, the present invention has the following technical effects: (1) The genetically engineered bacteria provided by the present invention reduce the consumption of pyruvate and generate isoleucine by knocking out the threonine dehydrogenase gene, thereby further increasing the production of D-pantothenic acid.

[0023] (2) The genetically engineered bacteria provided by the present invention enhance the expression of key enzymes in the D-pantothenic acid synthesis pathway, namely 3-methyl-2-oxobridged butyrate hydroxymethyltransferase gene panB, pantothenic acid synthase gene panC, and 2-dehydropantothenic acid reductase gene panE, thereby further increasing the yield of D-pantothenic acid.

[0024] (3) The genetically engineered bacteria provided by this invention are used in the microbial fermentation production of D-pantothenic acid. They have the characteristics of high yield, low substrate cost, easy separation and low toxicity, and have industrialization prospects. Attached Figure Description

[0025] Figure 1 A schematic diagram of the D-pantothenic acid synthesis pathway and its modification in Corynebacterium glutamicum; Figure 2 In Example 1 of this invention, the biomass OD of CG02 (CG01ΔilvA) 600 And the graph showing the change in D-pantothenic acid potency; Figure 3 In Example 3 of this invention, the biomass OD of CG01-1 (CG01 / pXMJ19-panBC) 600 And the graph showing the change in D-pantothenic acid potency; Figure 4 In Example 3 of this invention, the biomass OD of CG01-2 (CG01 / pXMJ19-panBCE) 600 And the graph showing the change in D-pantothenic acid potency; Figure 5 In Example 4 of this invention, the biomass OD of CG02-1 (CG01ΔilvA / pXMJ19-panBC) 600 And the graph showing the change in D-pantothenic acid potency; Figure 6 In Example 4 of this invention, the biomass OD of CG02-2 (CG01ΔilvA / pXMJ19-panBCE) 600 Graph showing the change in D-pantothenic acid potency. Detailed Implementation

[0026] Figure 1 This is a schematic diagram of the D-pantothenic acid synthesis pathway and modification in Corynebacterium glutamicum. In this invention, the ilvA gene is knocked out in Corynebacterium glutamicum ATCC 13032, and then the panB and panC genes in the Corynebacterium glutamicum ATCC 13032 genome and the panE gene in the Escherichia coli MG1655 genome are overexpressed to obtain a genetically engineered bacterium that produces high levels of D-pantothenic acid.

[0027] The present invention will be further described below with reference to embodiments.

[0028] The starting strain of this invention, Corynebacterium glutamicum ATCC 13032 (hereinafter referred to as CG01), is deposited at the Institute of Synthetic Biotechnology, Zhejiang University of Technology.

[0029] In the following examples, the final concentration of kanamycin in the culture medium was 0.05 mg / L; the final concentration of chloramphenicol in the culture medium was 0.03 mg / L.

[0030] The primer sequence information used in Examples 1-4 is shown in Table 1.

[0031] Table 1 panBC-1 GCATGCCTGCAGGTCGACTCTAGAAAGGAGATATAGATGCCCATGTCAGGCATTGA panBC-2 CCAAAACAGCCAAGCTGAATTCTTACTAGAGCTCGATATTGTCGATCAAC panBC-3 CATGGTCTTACTAGAGCTCGATATTGTCGATCAAC panE-R CCAAAACAGCCAAGCTGAATTCTTACTACCAGGGGCGAGGCAAACCAG ilvA-1 GTGGGGAGACAATGGAACCAATCACTGG ilvA-2 GGTTGACTAGTGTAATCTTCTCC ilvA-3 AACATAGCTGAAGGCCACCTCAATC ilvA-4 CCTCGCGCTTTGTCACCTACAC ilvA-5 CGTCATTGCGTCCACTGACTGTG ilvA-6 CCGCACAAACAGGCATCCCACG M1 CATAACGGTTCTGGCAA M2 CGTTCTGATTTAATCTGT In the following examples, the D-pantothenic acid content was determined by HPLC detection, and the specific detection method is as follows: (1) Chromatographic conditions: C18 column (250×4.6mm, particle size 5μm, Agilent Technologies Co., Santa Clara, CA, USA), detection wavelength: 200nm, column temperature: 30℃; (2) Sample preparation: Dilute the sample with ultrapure water to maintain the D-pantothenic acid content at 0.05-0.40 g / L; (3) Mobile phase: Acetonitrile / water / phosphoric acid (volume ratio 50 / 949 / 1); (4) Data acquisition time: 15 min.

[0032] In the following examples, the culture medium composition is as follows: (1) LB medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, solvent is tap water, pH value is natural.

[0033] (2) BHIS+Gly medium: brain-heart infusion medium 71g / L, D-sorbitol 37g / L, Gly 40g / L, solvent is tap water, pH value is natural.

[0034] (3) LBS solid culture medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 100 g / L sucrose, 4 g / L agar, solvent is tap water, pH value is natural.

[0035] (4) Fermentation medium: glucose 20g / L, (NH4)2SO4 10g / L, KH2PO4 0.5g / L, MgSO4 0.5g / L, yeast extract 3g / L, CaCO3 10g / L, 1ml / L trace element solution, solvent is deionized water, pH value is natural; the trace element solution composition is: 10g / L CuCl2, 10g / L FeSO4·7H2O, 1g / L ZnSO4·7H2O, 0.20g / L CuSO4, 0.02g / L NiCl2·7H2O, solvent is deionized water.

[0036] Example 1: Knockout of the threonine dehydrogenase encoding gene ilvA Using Corynebacterium glutamicum ATCC 13032 as the starting strain, the ilvA gene was knocked out using homologous recombination gene editing technology mediated by shuttle plasmid pK18mobsacB. The nucleotide sequence of the ilvA gene is shown in SEQ ID NO.1.

[0037] (1) Extraction of the genome of Corynebacterium glutamicum ATCC 13032: A small amount of bacterial solution was taken from the -80℃ glycerol tube and streaked onto an LB solid culture plate. The plate was incubated at 30℃ for 24 h. A single colony was picked and inoculated into 10 ml of LB liquid medium. The plate was incubated at 30℃ and 200 rpm for 12 h. Then, 5 ml of fresh bacterial solution was taken and the procedure was performed according to the instructions of the bacterial genome FAST kit. The extracted genome was used to determine the nucleic acid concentration using Nano Drop and then stored at -20℃.

[0038] (2) Using the above genome as a template, the upper homologous arm of gene ilvA was obtained by PCR with primers ilvA-1 and ilvA-2; the lower homologous arm of gene ilvA was obtained by PCR with primers ilvA-3 and ilvA-4. The obtained PCR stock solution was subjected to nucleic acid gel electrophoresis and the correct band fragment was purified by gel extraction and recovery according to the Axygen PCR Cleanup kit. The nucleic acid concentration was determined by Nano Drop and then stored at -20℃.

[0039] Table 2. PCR system for amplifying the upper and lower homologous arm gene fragments of ilvA Template (genome) 1μL ilvA-1 (10μM) 1μL ilvA-2 (10μM) 1μL 2×Phanta Max Buffer 25μL dNTP Mix (10mM) 1μL Phanta Max Super-Fidelity DNA Polymerase 0.5μL <![CDATA[dd H2O]]> Up to 50μL (3) Extraction of pK18mobsacB plasmid: Escherichia coli containing pK18mobsacB plasmid was streaked onto Kan resistant LB agar and cultured overnight at 37°C. Single colonies were picked from the agar and inoculated into 10 ml of Kan resistant LB liquid and cultured at 37°C for 12 h. 8 ml of fresh bacterial culture was taken and extracted according to the Axygen Plasmid kit. The nucleic acid concentration was determined by Nano Drop and stored at -20°C.

[0040] (4) The above plasmid was double-digested with restriction endonucleases HindIII and EcoRI at 37℃ for 1 h, and then linearized. The linearized plasmid was recovered using the Axygen PCR Cleanup kit, and the nucleic acid concentration was determined by Nano Drop before storage at -20℃. The purification digestion system is shown in the table below: Table 3 pK18mobsacB double digestion system pK18mobsacB 20μL HindIII 5μL EcoRII 5μL 10×buffer 10 <![CDATA[dd H2O]]> Up to 100μL (5) Preparation of E. coli DH5α-competent cells: Dip an inoculation loop into a streaked LB agar plate containing DH5α and incubate overnight at 37°C. Pick a single colony and inoculate it into a 10ml LB tube and incubate at 37°C and 200rpm for 12h. Inoculate 1% (v / v) into 40ml LB liquid medium and incubate at 37°C and 200rpm until OD500. 600 =0.4~0.6, centrifuge at 4000rpm for 5min in a 50ml sterile centrifuge tube at 4℃ to recover the bacterial cells, then resuspend in 30ml of 0.1M CaCl2 solution and incubate on ice for 30min, centrifuge at 4000rpm for 5min to collect the bacterial cells, then resuspend in 1ml of 0.1M CaCl2 solution containing 15% glycerol and aliquot into 1.5ml EP tubes (100μL per tube) and store at -80℃.

[0041] (6) Add the linearized pK18mobsacB plasmid fragment and the upstream and downstream homologous arm fragments of ilvA to the reaction system according to the instructions of the Clone Express Ultra One Step Cloning Kit. After placing it at 50℃ for 15 min, immediately place it on ice to cool down. The ilvA homologous arm gene fragment can be integrated into the multiple cloning site of the pK18mobsacB plasmid. Then, transform the ligation product into E. coli DH5α competent cells and culture overnight at 37℃. After successful colony PCR verification, the recombinant plasmid pK18mobsacB-ilvA can be obtained by picking bacteria and inoculating test tubes and extracting with the Axygen Plasmid kit. Take 10 μL of the plasmid for sequencing and store the remaining plasmid at -20℃.

[0042] (7) Preparation of CG01 electrocompetent cells: Wild-type Corynebacterium glutamicum CG01 was streaked onto LB solid medium and cultured at 30°C for 48 hours. A single colony was picked and inoculated into 10 ml of LB liquid medium. After culturing at 30°C for 12 hours, 2% of the colony was inoculated into 40 ml of liquid BHIS medium and cultured at 30°C and 180 rpm for 10 hours. OD600 =0.9~1.2, transfer the bacterial culture to a pre-chilled 50ml sterile centrifuge tube, centrifuge at 5000rpm for 10min, discard the supernatant, centrifuge at 5000rpm for 10min with pre-chilled 10% sterile glycerol, repeat the washing three times, and finally resuspend with 1ml of 10% glycerol and aliquot into sterile 1.5ml EP tubes, 100μL per tube, and store at -80℃.

[0043] (8) Plasmid pK18mobsacB-ilvA was introduced into CG01: 5 μL of pK18mobsacB-ilvA was added to the electrotransfer competent cells CG01 and gently mixed by pipetting. After 5 min on ice, the cells were electrolyzed twice at 1.8 KV. Then 1 ml of preheated 46℃ LB medium was added and the cells were immediately heat-shocked at 46℃ for 6 min. After that, the cells were cultured at 30℃ and 200 rpm for 2 h. The cells were then plated on Kan resistance LB plates (single exchange screening) and cultured at 30℃ for 40 h. Single colonies were picked and inoculated into 10 ml of liquid Kan resistant LB medium and cultured for 12 hours. Then, 1% of the colony was transferred to 10 ml of antibiotic-free LB medium and cultured for 12 hours. After that, the bacterial culture was streaked onto LBS solid medium for a second screening (double exchange screening). Single colonies were picked from LBS medium and imprinted onto Kan resistant and antibiotic-free LB solid medium respectively. Strains that grew on antibiotic-free plates but not on Kan resistant plates were selected as templates. Colony PCR was performed using ilvA-5 and ilvA-6 primers to verify whether ilvA was knocked out. Strains with the correct bands were selected, inoculated into 10 ml of LB liquid medium, cultured overnight at 30°C and 200 rpm, and then sent for sequencing. The correctly sequenced strain was named CG02.

[0044] (9) Fermentation of strain CG02: Using CG01 as a control strain, CG01 and CG02 were inoculated into 10 mL of LB medium and cultured at 30℃ and 200 rpm to obtain the seed culture. After 12 h, 1 mL of the seed culture was inoculated into a 500 mL shake flask containing 50 mL of fermentation medium and then cultured at 30℃ and 180 rpm into the fermentation broth. When the cell concentration reached OD200... 600 When the concentration of iodine (I0.8-1.0) is reached, IPTG is added to a final concentration of 0.1 mM, and the culture continues for 48 h. After fermentation, 1 mL of fermentation broth is centrifuged at 12000 rpm for 2 min at room temperature, and the supernatant is collected. HPLC analysis is performed according to Example 1. Another 1 mL of fermentation broth is used to determine the biomass OD0. 600 D-pantothenic acid content and OD in fermentation broth supernatant 600 like Figure 2 As shown.

[0045] Depend on Figure 2 It can be seen that knocking out ilvA did not significantly change the production of D-pantothenic acid, and the bacterial OD... 600 The reduction in D-pantothenic acid titer and the lengthening of the growth cycle, based solely on the knockout of the ilvA gene, do not necessarily contribute to the improvement of D-pantothenic acid titer.

[0046] Example 2: Construction of overexpression plasmids pXMJ19-panBC and pXMJ19-panBCE. Using the genomes of *Corynebacterium glutamicum* ATCC 130322 and *E. coli* DH5αMG 1655 as templates, the shuttle plasmid pXMJ19 was used to overexpress the key genes panB, panC, and panE in the pantothenic acid synthesis pathway. The nucleotide sequences of genes panB, panC, and panE are shown in SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4, respectively. Genome extraction was performed according to the instructions of the bacterial genome FAST kit. After confirming the nucleic acid concentration using Nano Drop, the extracted genome was stored at -20°C.

[0047] (1) Obtaining the panBC gene: Using the genome of Corynebacterium glutamicum ATCC13032 as a template, the panBC gene fragment was obtained by PCR using panBC-1 and panBC-2 as primers. At the same time, the panBC gene fragment containing the panE homologous arm was obtained by PCR using panBC-1 and panBC-3 as primers. The PCR system is as described in step (2) of Example 2 and Table 2.

[0048] (2) Obtaining the panE gene: Using the genome of E.coli DH5αMG 1655 as a template, the panE gene fragment containing the homologous arm of panBC was obtained by PCR using panBC-3 and panE-R as primers.

[0049] (3) Obtaining plasmid pXMJ19: Escherichia coli containing pXMJ19 plasmid was streaked onto chloramphenicol (cm) resistant LB solid culture plate with an inoculation loop and cultured overnight at 37°C. Single colonies were picked from the plate and inoculated into 10 ml cm resistant LB liquid medium and cultured at 37°C for 12 h. 8 ml of fresh bacterial culture was taken and extracted according to the Axygen Plasmid kit. The nucleic acid concentration was determined by Nano Drop and stored at -20°C.

[0050] (4) Linearization of plasmid pXMJ19: The plasmid was linearized after double digestion with restriction endonucleases HindIII and XbaI at 37℃ for 1 h. The linearized plasmid was recovered using the Axygen PCR Cleanup kit, and the nucleic acid concentration was determined by Nano Drop before storage at -20℃. The purification and digestion system is shown in Table 3 of Example 2.

[0051] (5) Construction of pXMJ19-panBC plasmid: The linearized pXMJ19 plasmid fragment and the panBC gene fragment were added to the reaction system according to the instructions of the Clone Express Ultra One Step Cloning Kit. After reacting at 50℃ for 15 min, the mixture was immediately placed on ice to cool down. The panBC gene fragment was then integrated into the multiple cloning site of the pXMJ19 plasmid. The ligation product was then transformed into E. coli DH5α competent cells and cultured overnight at 37℃. After successful colony PCR verification and sequencing using primers M1 and M2, a single successful colony was picked and transferred to a 10 ml LB tube. The recombinant plasmid pXMJ19-panBC was obtained by extraction using the Axygen Plasmid kit. The nucleic acid concentration was determined by Nano Drop and the plasmid was stored at -20℃.

[0052] (6) Construction of pXMJ19-panBCE plasmid: The linearized pXMJ19 plasmid fragment, the panBC gene fragment containing the panE homologous arm, and the panE gene fragment containing the panBC homologous arm were added to the reaction system according to the instructions of the Clone Express Ultra One Step Cloning Kit. After reacting at 50℃ for 15 min, the mixture was immediately placed on ice to cool down. The panBC and panE gene fragments were then integrated into the multiple cloning site of the pXMJ19 plasmid. The ligation product was then transformed into E. coli DH5α competent cells and cultured overnight at 37℃. After successful colony PCR verification and sequencing using primers M1 and M2, a single successful colony was picked and transferred to a 10ml LB tube. The recombinant plasmid pXMJ19-panBCE was obtained by extraction using the Axygen Plasmid kit. The nucleic acid concentration was determined by Nano Drop and the plasmid was stored at -20℃.

[0053] Example 3: Construction of strains CG01-1 and CG01-2 (1) Preparation of CG01 electrocompetent cells: CG01 was streaked on LB solid medium and cultured at 30℃ for 48 hours. A single colony was picked and inoculated into 10 ml of LB liquid medium and cultured at 30℃ for 12 hours. Then, 2% of the cell culture was inoculated into 40 ml of liquid BHIS medium and cultured at 30℃ and 180 rpm for 10 hours until OD. 600 =0.9~1.2, transfer the bacterial culture to a pre-cooled 50ml sterile centrifuge tube, centrifuge at 5000rpm for 10min, discard the supernatant, centrifuge at 5000rpm for 10min with pre-cooled 10% sterile glycerol, repeat the washing three times, and finally resuspend in 1ml of 10% glycerol and aliquot into sterile 1.5ml EP tubes, 100μL per tube, and store at -80℃.

[0054] (2) Electroporation of plasmid pXMJ19-panBC into CG01 electrocompetent cells: Take 3 μL of pXMJ19-panBC and add it to the electrocompetent cells CG01. Gently pipette and mix well. Incubate on ice for 5 min. Electrolyze twice at 1.8 KV. Add 1 ml of preheated 46℃ LB medium. Immediately heat shock at 46℃ for 6 min. Then incubate at 30℃ and 200 rpm for 2 hours. Spread on cm resistant LB plates and incubate at 30℃ for 36 h. Pick single colonies and use M-1 and M-2 primers for PCR to verify whether the recombinant plasmid has been electroporated into CG01. Pick colonies with correct PCR bands and inoculate them into 10 ml LB cm resistant test tubes. Incubate at 30℃ and 200 rpm for 12 h. Take 500 μL of bacterial solution and add 1 ml of sterile water containing 50% glycerol. Place it in a 2 ml sterile glycerol tube and store at -80℃. This strain is named CG01-1.

[0055] (7) Electroporation of pXMJ19-panBCE into CG01 electrocompetent cells: Take 3 μL of pXMJ19-panBCE and add it to the electrocompetent cells CG01. Gently pipette and mix well. Place on ice for 5 min. Electrolyze twice at 1.8 KV. Add 1 ml of preheated 46℃ LB medium. Immediately heat shock at 46℃ for 6 min. Then incubate at 30℃ and 200 rpm for 2 hours. Spread on cm resistant LB plates and incubate at 30℃ for 36 h. Pick single colonies and use M-1 and M-2 primers for PCR to verify whether the recombinant plasmid has been electroporated into CG01. Pick colonies with correct PCR bands and inoculate them into 10 ml LB cm resistant test tubes. Incubate at 30℃ and 200 rpm for 12 h. Take 500 μL of bacterial solution and add 1 ml of sterile water containing 50% glycerol. Place in a 2 ml sterile glycerol tube and store at -80℃. This strain is named CG01-2.

[0056] (8) Using CG01 as the control strain, CG01, CG01-1, and CG01-2 were inoculated into 10 mL of LB medium and cultured at 30 °C and 200 rpm to prepare the seed culture. After 12 h, 1 mL of the seed culture was inoculated into a 500 mL shake flask containing 50 mL of fermentation medium, and then cultured at 30 °C and 200 rpm until the cell concentration reached OD600. 600 When the concentration of iodine (I0.8-1.0) is 0.1 mM IPTG, the mixture is cultured for another 48 h. After fermentation, 1 mL of the fermentation broth is centrifuged at 12,000 rpm for 2 min at room temperature. The supernatant is collected and analyzed by HPLC according to Example 1. Another 1 mL of the fermentation broth is used to determine the biomass OD0. 600 D-pantothenic acid content and OD in fermentation broth supernatant 600 like Figure 3 , 4 As shown.

[0057] Depend on Figure 3It can be seen that overexpression of panBC did not significantly change the D-pantothenic acid titer or the bacterial cell concentration, indicating that overexpression of panBC had little effect on improving the D-pantothenic acid titer.

[0058] Depend on Figure 4 It can be seen that overexpression of panBCE increased the D-pantothenic acid titer from 0.01 g / L to 0.56 g / L, and the cell concentration increased slightly. This indicates that overexpression of panBCE may enable the D-pantothenic acid produced in the cells to be excreted in a timely manner, thereby reducing the negative feedback regulation caused by product accumulation and effectively increasing the yield. Overall, overexpression of panBCE is beneficial to improving the D-pantothenic acid titer.

[0059] Example 4: Construction of strains CG02-1 and CG02-2 (1) Preparation of CG02 electrocompetent cells: CG02 was streaked on LB solid medium and cultured at 30℃ for 48 hours. A single colony was picked and inoculated into 10 ml of LB liquid medium and cultured at 30℃ for 12 hours. Then, 2% of the cell culture was inoculated into 40 ml of liquid BHIS medium and cultured at 30℃ and 180 rpm for 10 hours until OD. 600 =0.9~1.2, transfer the bacterial culture to a pre-cooled 50ml sterile centrifuge tube, centrifuge at 5000rpm for 10min, discard the supernatant, centrifuge at 5000rpm for 10min with pre-cooled 10% sterile glycerol, repeat the washing three times, and finally resuspend in 1ml of 10% glycerol and aliquot into sterile 1.5ml EP tubes, 100μL per tube, and store at -80℃.

[0060] (2) Electroporation of plasmid pXMJ19-panBC into CG02 electrocompetent cells: Take 3 μL of pXMJ19-panBC and add it to the electrocompetent cells CG02. Gently pipette and mix well. Incubate on ice for 5 min. Electrolyze twice at 1.8 KV. Add 1 ml of preheated 46℃ LB medium. Immediately heat shock at 46℃ for 6 min. Then incubate at 30℃ and 200 rpm for 2 hours. Spread on cm resistant LB plates and incubate at 30℃ for 36 h. Pick single colonies and use M-1 and M-2 primers for PCR to verify whether the recombinant plasmid has been electroporated into CG02. Pick colonies with correct PCR bands and inoculate them into 10 ml LB cm resistant test tubes. Incubate at 30℃ and 200 rpm for 12 h. Take 500 μL of bacterial solution and add 1 ml of sterile water containing 50% glycerol. Place it in a 2 ml sterile glycerol tube and store at -80℃. This strain is named CG02-1.

[0061] (3) Electroporation of pXMJ19-panBCE into CG02 electrocompetent cells: Take 3 μL of pXMJ19-panBCE and add it to the electrocompetent cells CG02. Gently pipette and mix well. Place on ice for 5 min. Electrolyze twice at 1.8 KV. Add 1 ml of preheated 46℃ LB medium. Immediately heat shock at 46℃ for 6 min. Then incubate at 30℃ and 200 rpm for 2 hours. Spread on cm resistant LB plates and incubate at 30℃ for 36 h. Pick single colonies and use M-1 and M-2 primers for PCR to verify whether the recombinant plasmid has been electroporated into CG02. Pick colonies with correct PCR bands and inoculate them into 10 ml LB cm resistant test tubes. Incubate at 30℃ and 200 rpm for 12 h. Take 500 μL of bacterial solution and add 1 ml of sterile water containing 50% glycerol. Place in a 2 ml sterile glycerol tube and store at -80℃. This strain is named CG02-2.

[0062] (4) Using CG02 as the control strain, CG02, CG02-1, and CG02-2 were inoculated into 10 mL of LB medium and cultured at 30 °C and 200 rpm to prepare the seed culture. After 12 h, 1 mL of the seed culture was inoculated into a 500 mL shake flask containing 50 mL of fermentation medium, and then cultured at 30 °C and 200 rpm until the cell concentration reached OD600. 600 When the concentration of iodine (I0.8-1.0) is 0.1 mM IPTG, the mixture is cultured for another 48 h. After fermentation, 1 mL of the fermentation broth is centrifuged at 12,000 rpm for 2 min at room temperature. The supernatant is collected and analyzed by HPLC according to Example 1. Another 1 mL of the fermentation broth is used to determine the biomass OD0. 600 D-pantothenic acid content and OD in fermentation broth supernatant 600 like Figure 5 , Figure 6 As shown.

[0063] Depend on Figure 5 It can be seen that expressing panBC did not significantly change the D-pantothenic acid titer, but slightly increased the bacterial concentration. This indicates that overexpression of panBC has little effect on increasing the D-pantothenic acid titer, but is beneficial to bacterial growth.

[0064] Depend on Figure 6 It can be seen that overexpression of panBCE increased the D-pantothenic acid titer from 0.01 g / L to 0.79 g / L, while the cell concentration did not change significantly. This indicates that overexpression of panBCE may enable the timely excretion of D-pantothenic acid produced in the cells, thereby reducing the negative feedback regulation caused by product accumulation and effectively increasing the yield. Overall, overexpression of panBCE is beneficial to improving the D-pantothenic acid titer. At the same time, knocking out ilvA increased the accumulation of pyruvate, an important precursor in the D-pantothenic acid synthesis pathway, and reduced the consumption of pyruvate to generate isoleucine, thus significantly increasing the pantothenic acid yield by about 0.23 g / L compared to CG01-2.

[0065] Unless otherwise specified, the raw materials and equipment used in this invention are all commonly used in the field; unless otherwise specified, the methods used in this invention are all conventional methods in the field.

[0066] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications, alterations, and equivalent transformations made to the above embodiments based on the technical essence of the present invention shall still fall within the protection scope of the present invention.

Claims

1. A genetically engineered bacterium that produces high levels of D-pantothenic acid, characterized in that: It is constructed using the following methods: (1) The genome of the basal bacteria Corynebacterium glutamicum ATCC 13032 ilvA Gene knockout yielded Corynebacterium glutamicum ATCC 13032 △ilvA; ilvA The nucleotide sequence of the gene is shown in SEQ ID NO.1 of the sequence listing; (2) Overexpressing the gene shown in SEQ ID NO.2, the gene shown in SEQ ID NO.3 and the gene shown in SEQ ID NO.4 in Corynebacterium glutamicum ATCC 13032 △ilvA, i.e. the genetically engineered bacterium that produces high levels of D-pantothenic acid.

2. The method for constructing the genetically engineered bacteria of claim 1, characterized in that: Includes the following steps: S1: Knock out the ilvA gene in the genome of Corynebacterium glutamicum ATCC 13032 to obtain Corynebacterium glutamicum ATCC 13032 △ilvA; the nucleotide sequence of the ilvA gene is shown in SEQ ID NO.1 in the sequence listing; S2: The genes shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 are introduced into Corynebacterium glutamicum ATCC 13032 △ilvA for overexpression, which is the genetically engineered bacterium that produces high levels of D-pantothenic acid.

3. The method as described in claim 2, characterized in that: In S1, the ilvA The gene knockout method is to use homologous recombination editing technology to knock out the gene.

4. The method as described in claim 2, characterized in that: In S2, the import method is electro-transfer.

5. The application of the genetically engineered bacteria as described in claim 1 or the genetically engineered bacteria constructed by the method described in any one of claims 2-4 in the microbial fermentation preparation of D-pantothenic acid, characterized in that: The fermentation was carried out without the addition of β-alanine.

6. The application as described in claim 5, characterized in that: The application includes the following steps: inoculating the genetically engineered bacteria into a fermentation medium at a volume concentration of 2-4%, and fermenting and culturing it under conditions of pH 6.7-7.0 and temperature 25-35℃.

Images