Use of CircRAB3IP in preparation of a drug for promoting angiogenesis

Abstract

The present application relates to the application of CircRAB3IP in the preparation of a drug for promoting angiogenesis, and belongs to the technical field of biological medicine; the present application provides the application of CircRAB3IP in the preparation of a drug for preventing or treating heart failure; in the preparation of a drug for promoting angiogenesis; in the preparation of a heart failure prognosis diagnosis kit; and in the preparation of a myocardial hypertrophy prognosis diagnosis kit; the present application proves through in-vivo and in-vitro experiments that circRAB3IP can promote angiogenesis, and can effectively improve heart function disorder caused by high blood pressure mechanical stress, slow down cardiac remodeling, myocardial fibrosis, and reduce cardiac inflammation. The present application provides a new target and theoretical basis for the treatment of hypertensive cardiac remodeling.

Description

Technical Field

[0001] The present invention relates to the application of CircRAB3IP in preparing a drug for promoting angiogenesis, and belongs to the technical field of biomedicine. Background Art

[0002] Cardiovascular disease (CVD) has become the leading cause of death in my country and even worldwide. Continuous mechanical stress stimulation from hypertension can lead to structural and functional changes in myocardial or non-cardiac cells, causing adverse cardiac remodeling, often manifested as functional damage to the cardiac vascular system, myocardial interstitial fibrosis, and myocardial cell apoptosis, ultimately leading to heart failure. The progression of cardiovascular disease to heart failure is often accompanied by myocardial hypertrophy, which is one of the common characteristics of heart failure. Therefore, actively exploring the regulatory factors that cause myocardial hypertrophy caused by mechanical stress from hypertension and clarifying the regulatory mechanisms involved in adverse cardiac remodeling have certain clinical significance for delaying or even reversing cardiac remodeling and improving cardiac function.

[0003] Angiogenesis, a complex factor in the development of heart failure and myocardial hypertrophy, has also garnered significant attention. Angiogenesis is the formation of new blood vessels within the body to meet the needs of tissues and organs. Physiological myocardial hypertrophy increases the myocardium's demand for oxygen and nutrients. During this process, the heart's blood vessels dilate and repair. The resulting new blood vessels increase blood flow to the myocardium, increasing the supply of oxygen and nutrients, supporting normal heart function under high stress and helping to maintain myocardial function. In physiological myocardial hypertrophy, angiogenesis is proportional to the increase in cardiomyocyte volume, and capillary density generally remains unchanged. Myocardial hypertrophy and angiogenesis are closely linked, working synergistically to ensure that the heart responds and adapts to the increased demands. However, the relationship and connection between pathological myocardial hypertrophy and angiogenesis are more complex. When pathological myocardial hypertrophy occurs in response to pathological external stimuli, increased metabolic demand and insufficient capillary density cause myocardial cells to experience hypoxia, leading to the secretion of signaling molecules, including VEGF, that promote angiogenesis. However, researchers have only been able to observe angiogenesis in the early stages of pathological myocardial hypertrophy; no new blood vessels are produced under subsequent, persistent pathological stimulation. Therefore, pathological myocardial hypertrophy is often accompanied by a relatively low capillary density, resulting in insufficient oxygen and nutrient supply, leading to cardiomyocyte death or myocardial fibrosis. In the transition from myocardial remodeling to heart failure, the disharmony between capillary density and cardiomyocyte fibrosis is a key factor. Therefore, a certain degree of neovascularization can help the heart adapt to the mechanical stress of hypertension and play a protective role. Regulating angiogenesis has also been considered a treatment for myocardial hypertrophy, and simulation experiments have also found that angiogenesis can delay heart failure. Further in-depth research on the mechanism of angiogenesis in myocardial hypertrophy is extremely valuable and meaningful for the treatment of the disease.

[0004] Circular RNAs (circRNAs) are a special class of noncoding RNAs that form circular structures through covalent bonds. As a type of noncoding RNA, circRNAs were initially considered nonfunctional byproducts of splicing errors. In recent years, with the advancement of bioinformatics and the iterative updates of sequencing technologies, researchers have continuously deepened their discovery and research on circRNAs, exploring their biological properties and gaining increasing attention for their potential as diagnostic and therapeutic tools for diseases. Werfel et al. discovered changes in circRNA expression in a TAC-induced cardiac hypertrophy mouse model, marking the first time that a correlation between circRNAs and cardiac hypertrophy was noted. Currently, researchers have discovered that multiple circRNAs play important roles in cardiac hypertrophy, both positive and negative. Wang et al. found that the cardiac-related circRNA (HRCR) can bind to miR-223 and act as an endogenous miR-223 sponge to inhibit miR-223 activity, thereby increasing the expression of ARC (a target of miR-223). Overexpression of HRCR can alleviate the development of cardiac hypertrophy and heart failure in mice. Lim et al. found that inhibition of the circRNA circSlc8a1 alleviated cardiac hypertrophy and heart failure, with the mechanism being related to circSlc8a1 binding and inhibiting miR-133a. Li et al. found that circRNA 000203 could increase Gata4 levels by inhibiting miR-26b-5p and miR-140-3p, leading to worsening cardiac hypertrophy. Lavenniah et al. delivered a synthetic circRNA sponge targeting the pro-hypertrophic factors miR-132 and -212 into mouse cardiomyocytes via adenovirus and alleviated the pathological features of cardiac hypertrophy. Notably, circRNAs lack 5' caps and 3' poly(A) tails, possessing stable circular structures, and therefore have great potential as therapeutic targets. Yang et al. explained the potential mechanism by which circRNAs regulate cardiac hypertrophy, stating that circRNA wwp1 inhibits cardiac hypertrophy by downregulating its downstream targets ANF and miR-23a. Xu et al. found that circHIPK3 can act as a sponge for miR-185-3p to regulate cardiac hypertrophy.

[0005] Therapeutic angiogenesis can maintain metabolic needs by forming new blood vessels or promoting the maturation of existing vasculature, thereby alleviating or preventing the symptoms of certain diseases. CircRNAs have attracted extensive research due to their regulatory roles in angiogenesis. Wu et al. demonstrated that circGNAQ can act as a miR-146a-5p sponge to induce PLK2 expression, thereby regulating the senescence and angiogenesis of human umbilical vein endothelial cells. CircGNAQ overexpression can promote angiogenesis. Chang et al. found that overexpression of circ-100338 can promote the proliferation, migration, and tubule formation of human umbilical vein endothelial cells by targeting miR-220a-3p. Because circFASTKD1 inhibits the expression of LATS1 and LATS2 by targeting miR-06a, silencing circFASTKD1 in human cardiac microvascular endothelial cells promotes cell proliferation and migration, thereby enhancing angiogenesis. Wang et al. found in vivo that circHIPK3 in hypoxia-induced exosomes can reduce infarct size in mice with myocardial infarction and promote angiogenesis in the infarct margin. Based on existing research results, circRNAs play a very important role in angiogenesis. In-depth research has great value and potential significance for the diagnosis and treatment of myocardial hypertrophy and heart failure using angiogenesis.

[0006] In the prior art, a circRNA, circRAB3IP, exists in human lymphatic endothelial cells (hLEC). In the circbase database, the circRNA ID is hsa_circ_0099132, and its genomic location is chr12:70149163-70150443. Figure 1 As shown in . Summary of the Invention

[0007] The purpose of the present invention is to solve the technical problem of how to apply CircRAB3IP.

[0008] To achieve the purpose of the present invention, the present invention provides the use of CircRAB3IP in preparing a medicament for preventing or treating heart failure.

[0009] The present invention provides use of CircRAB3IP in preparing a drug for promoting angiogenesis.

[0010] Preferably, the dosage form of the drug includes tablets, powders, granules, capsules, oral solutions, injections or sustained-release preparations.

[0011] The present invention provides the use of CircRAB3IP in preparing a heart failure prognosis diagnosis kit.

[0012] The present invention provides the use of CircRAB3IP in preparing a myocardial hypertrophy prognosis diagnosis kit

[0013] The present invention provides a heart failure prognosis and diagnosis system, comprising a substance for detecting CircRAB3IP expression.

[0014] The present invention provides a prognostic diagnostic system for myocardial hypertrophy, comprising a substance for detecting CircRAB3IP expression

[0015] The present invention provides a heart failure treatment system, comprising a medication system; the medication system contains CircRAB3IP.

[0016] The present invention provides a primer for preparing circRAB3IP, wherein the sequence of the primer is as shown in SEQ ID NO 1 and SEQ ID NO 2; or as shown in SEQ ID NO 3 and SEQ ID NO 4.

[0017] SEQ ID NO 1:GAAGCCCATCTGTTTTGGAA;

[0018] SEQ ID NO 2: CCGGAGAAGTAGGTGAAGCA;

[0019] SEQ ID NO 3: CAAAAGCTCAGAGGGTTGTCC;

[0020] SEQ ID NO 4: TCGGGGAGGTAGTCTGCTC.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] This study demonstrates, through in vivo and in vitro experiments, that circRAB3IP can promote angiogenesis and effectively improve cardiac dysfunction caused by mechanical stress in hypertension, slowing cardiac remodeling and myocardial fibrosis, and reducing cardiac inflammation. This study provides a new target and theoretical basis for the treatment of hypertensive cardiac remodeling. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Schematic diagram of the genomic location of the gene expressing circRAB3IP;

[0024] Figure 2 Schematic diagram of the successful circularization of the AAV vector plasmid overexpressing circRAB3IP in 293T cells;

[0025] Figure 3 Echocardiogram of mouse hearts 7 weeks after aortic arch constriction (TAC);

[0026] Figure 4 Figure 2 shows the experimental results of overexpressing circRAB3IP to improve TAC-induced cardiac function impairment;

[0027] Figure 5 The ultrasound parameters of the left ventricle of mice showed the changes in morphological structure 7 weeks after TAC surgery;

[0028] Figure 6 The results of myocardial tissue pathology staining in mice 7 weeks after TAC surgery;

[0029] Figure 7 This is the result of RT-qPCR detection of myocardial hypertrophy marker genes and myocardial fibrosis indicator genes;

[0030] Figure 8 This figure shows the effect of overexpression of circRAB3IP on the expression of various genes in neonatal mouse primary cardiomyocytes after stretching;

[0031] Figure 9 This figure shows that the supernatant secreted by cardiomyocytes overexpressing circRAB3IP after stretch stimulation promotes HUVEC cell tube formation in vitro;

[0032] Figure 10 This is a graph showing the upregulation of circRAB3IP expression after mechanical stretching of HUVEC cells;

[0033] Figure 11 RT-qPCR confirmed the upregulation of circRAB3IP expression after lentiviral infection of HUVEC cells;

[0034] Figure 12 Figure 2 is the functional effect of overexpression of circRAB3IP on HUVEC cells;

[0035] Figure 13 The results of the experiment related to constructing circRAB3IP stable knockdown cells HUVEC;

[0036] Figure 14 This is a diagram showing the functional effects of knocking down circRAB3IP on HUVEC cells; DETAILED DESCRIPTION

[0037] In order to make the present invention more clearly understood, preferred embodiments are described in detail below with reference to the accompanying drawings:

[0038] The present invention provides use of CircRAB3IP in preparing a medicament for preventing or treating heart failure.

[0039] The present invention provides use of CircRAB3IP in preparing a drug for promoting angiogenesis.

[0040] The dosage forms of the above-mentioned drugs include tablets, powders, granules, capsules, oral solutions, injections or sustained-release preparations.

[0041] The present invention provides the use of CircRAB3IP in preparing a heart failure prognosis diagnosis kit.

[0042] The present invention provides the use of CircRAB3IP in preparing a myocardial hypertrophy prognosis diagnosis kit

[0043] The present invention provides a heart failure prognosis and diagnosis system, comprising a substance for detecting CircRAB3IP expression.

[0044] The present invention provides a prognostic diagnostic system for myocardial hypertrophy, comprising a substance for detecting CircRAB3IP expression

[0045] The present invention provides a heart failure treatment system, comprising a medication system; the medication system contains CircRAB3IP.

[0046] Example

[0047] In the following examples, mice were provided by Jiangsu Jicui Yaokang Biotechnology Co., Ltd., and pK25ssAAV-circRAB3IP AAV9 virus and pAV-CMV-GFP AAV9 control virus were purchased from Shandong Weizhen Biotechnology Co., Ltd. All other conventional reagents were commercially available.

[0048] Example 1

[0049] 1. Determination of circRAB3IP amplification primers:

[0050] Circular RNAs differ from traditional linear RNAs in that they possess a unique closed circular structure and are abundant in the eukaryotic transcriptome. Primer design for these RNAs differs from that for traditional linear RNAs. We designed primers for human and mouse circRAB3IP. The full-length sequence of circRAB3IP and the sequence information for the homologous mouse circRAB3IP were found in the Circbank-Human circRNA Database (http: / / www.circbank.cn / ). Because circular RNAs require their unique circular structure, primers must be designed to flank the splice junction to ensure that the PCR amplification product contains the junction. RT-qPCR primers for the circularized sequence are designed using the same method as conventional primer design, but ensure that both primers flank the circularized splice site to ensure that the amplification product contains the circular RNA junction. After RNA extraction from experimental samples, oligo dT cannot be used for reverse transcription. Random primers must be used for reverse transcription to ensure that the circular RNA is transcribed into cDNA.

[0051] 2. Primers for human circRAB3IP:

[0052]

[0053] 3. Primers for mouse circRAB3IP:

[0054]

[0055] Right now

[0056] SEQ ID NO 1:GAAGCCCATCTGTTTTGGAA;

[0057] SEQ ID NO 2: CCGGAGAAGTAGGTGAAGCA;

[0058] SEQ ID NO 3: CAAAAGCTCAGAGGGTTGTCC;

[0059] SEQ ID NO 4: TCGGGGAGGTAGTCTGCTC.

[0060] Example 2

[0061] Under continuous mechanical stress, overexpression of circRAB3IP can promote cardiac microangiogenesis and improve cardiac dysfunction caused by continuous mechanical stress in mice:

[0062] 1. AAV vector overexpressing circRAB3IP was successfully constructed:

[0063] The control plasmid pK25ssAAV-ciR(GFP) and the constructed vector plasmid pK25ssAAV-circRAB3IP were transfected into 293T cells respectively. After 48 hours, the cell RNA was collected and the results of RT-qPCR after reverse transcription showed that circRAB3IP was significantly overexpressed in the experimental group compared with the control group ( Figure 2 ). This vector plasmid can successfully circularize the target sequence carried and overexpress circRAB3IP.

[0064] 2. Experiments on the effects of TAC surgery on cardiac function in mice overexpressing circRAB3IP:

[0065] Seven weeks after aortic arch constriction (TAC), the hearts of mice were examined by ultrasound (e.g. Figure 3 The heart weight to body weight ratio of mice in the circRAB3IP-TAC group (overexpression group) was significantly lower than that in the Ctrl-TAC7w group (e.g. Figure 4Echocardiographic analysis showed that the cardiac contractile function of mice was significantly weakened 7 weeks after surgery, and overexpression of circRAB3IP could improve the decrease in left ventricular ejection fraction (EF) and left ventricular fractional shortening (FS) caused by TAC (Figure 2A). Figure 4 (Figures B and C in the middle).

[0066] Seven weeks after TAC surgery, the left ventricle in the TAC surgery group showed significant morphological changes compared with the sham group. Echocardiographic data analysis showed that the anterior and posterior walls of the left ventricle were thicker, and the left ventricular internal diameter and volume were larger (e.g. Figure 5 Compared with the TAC control group, LVPWs, LVPWd, LVIDs, LVIDd, LVEVs, and LVEVd in the TAC overexpression group showed a downward trend (e.g. Figure 5 These morphological changes are consistent with the better cardiac function in the TAC overexpression group, suggesting that high expression of circRAB3IP in the heart can delay the progression of myocardial hypertrophy to heart failure.

[0067] HE staining and Masson staining of mouse heart tissue paraffin sections showed that overexpression of circRAB3IP could significantly reduce the degree of myocardial interstitial and perivascular fibrosis during myocardial hypertrophy after TAC surgery. CD31 and WGA immunofluorescence staining analysis of tissue sections showed that overexpression of circRAB3IP significantly increased myocardial microvascular density after TAC surgery (such as Figure 6 ). The formation of microvessels is beneficial to maintaining heart function and delaying the occurrence of heart failure.

[0068] After RNA was extracted from the heart tissues of each group, RT-qPCR was used to detect the expression levels of myocardial hypertrophy marker genes. The results showed that overexpression of circRAB3IP could significantly reduce the expression of hypertrophy marker genes Nppa, Nppb, Acta1, and Myh7 caused by TAC, and also reduce the expression levels of type I collagen α1 (Col1a1) and type III collagen α1 (Col3a1), which are indicators of cardiac fibrosis (such as Figure 7 ), further indicating that high expression of circRAB3IP could ameliorate TAC-induced cardiac hypertrophy.

[0069] Example 3

[0070] Overexpression of circRAB3IP promotes the secretion of angiogenic factors in cardiomyocytes and promotes angiogenesis through paracrine effects.

[0071] Primary mouse neonatal cardiomyocytes (mCMs) were infected with adenovirus overexpressing circRAB3IP. After 48 hours, the cells were mechanically stretched (MS) for 24 hours and harvested. Overexpression of circRAB3IP upregulated the mRNA expression of the angiogenic factors Vegfa, Fgf2, and Igf1, as well as the Igf1 receptor gene Igf1r, but had no effect on Tgfb1 mRNA expression. Western blot analysis showed that overexpression of circRAB3IP upregulated the protein expression of HSF1, VEGFA, and HSP27 in primary neonatal cardiomyocytes after stretch. Heat shock transcription factor 1 (HSF1) in hypertrophic myocardial tissue promotes myocardial microangiogenesis and protects myocardial tissue. High expression of heat shock protein 27 (Hsp27) in the heart has a protective effect against myocardial remodeling. Studies have shown that high expression of Hsp27 can improve cardiac contractile function by inhibiting the degradation of cardiac troponin I (cTnI) and troponin T (cTnT) induced by myocardial ischemia / reperfusion, thus protecting the myocardium. Figure 8 shown).

[0072] The myocardial cell supernatant was collected and used to perform a HUVEC (Human Umbilical Vein Endothelial Cells) tube formation experiment. The results were as follows: Figure 9 As shown, without stretching the cardiomyocytes, their supernatant could not make HUVECs form tubes. After stretching the cardiomyocytes, their supernatant could promote the migration and connection of HUVEC cells into lines. Overexpression of circRAB3IP significantly promoted the tube-forming activity of HUVECs.

[0073] Example 4

[0074] circRAB3IP can promote the proliferation and tube formation of HUVEC cells, while knockdown of circRAB3IP inhibits the proliferation and tube formation of HUVEC cells:

[0075] Compared with normal heart tissue, circRab3ip expression was upregulated in mouse hypertrophic myocardial tissue, and the expression of circRAB3IP was also increased after mechanical stretching of HUVEC cells for 24 hours ( Figure 10 HUVEC cells were infected with lentivirus and screened with puromycin for 3 days, and RT-qPCR was used to verify the successful overexpression of circRAB3IP ( Figure 11), and the tubule formation ability of HUVEC was detected by tubule formation assay, the migration ability of HUVEC was detected by cell scratch assay, the cell proliferation ability was detected by CCK-8 assay, and the population dependence and proliferation ability of HUVEC were detected by monoclonal formation assay. These abilities were enhanced after overexpression of circRAB3IP ( Figure 12 ).

[0076] Specific siRNA was designed for the circRAB3IP cyclization site. When the confluence of HUVEC reached 90%, siRNA was transfected. After 48 hours of culture, cell RNA was collected to detect the knockdown efficiency of circRAB3IP. Serum-free basal medium was used throughout the process to inhibit HUVEC proliferation and interfere with the verification of siRNA knockdown efficiency (such as Figure 13 ). The expression of circRAB3IP was detected by RT-qPCR, and the results showed that siRNA4 had the highest knockdown efficiency (such as Figure 13 Figure A); The siRNA4 sequence was used to construct the shRNA knockdown plasmid, which was packaged into lentivirus. After lentivirus infection of HUVEC cells, 3 days after screening, RT-qPCR was used to verify the knockdown efficiency of circRAB3IP. At the same time, the tubule formation ability of HUVEC was detected by tubule formation assay, the migration ability of HUVEC was detected by cell scratch assay, the cell proliferation ability was detected by CCK-8 assay, and the population dependence and proliferation ability of HUVEC were detected by monoclonal formation assay. After knocking down circRAB3IP, these abilities were weakened ( Figure 14 ).

[0077] like Figure 1 Shown is a schematic diagram of the genomic location of the gene expressing circRAB3IP;

[0078] like Figure 2 Figure 2 shows the successful circularization of the AAV vector plasmid overexpressing circRAB3IP in 293T cells.

[0079] like Figure 3 Shown are echocardiograms of mouse hearts 7 weeks after aortic arch constriction (TAC);

[0080] like Figure 4 Figures show experimental results showing that overexpression of circRAB3IP improves TAC-induced decreased cardiac function. Panel A shows the heart weight / body weight ratio of mice in each group 7 weeks after TAC surgery (n=5-7). Panels B and C show left ventricular systolic function (EF) and left ventricular systolic function (FS). ***p<0.001, **p<0.01.

[0081] like Figure 5Figures 7 weeks after TAC surgery show changes in left ventricular ultrasound parameters showing morphological changes in each group of mice. Panels A and B show the left ventricular anterior wall thickness (LVAWs) and LVAWd during systole and diastole; Panels C and D show the left ventricular posterior wall thickness (LVPWs) and LVPWd during systole and diastole; Panels E and F show the left ventricular internal diameter (LVIDs) and LVIDd during systole and diastole; Panels G and H show the left ventricular volumes (LVEVs) and LVEVd during systole and diastole. ***p < 0.001, **p < 0.01, *p < 0.05, ns, not statistically significant.

[0082] like Figure 6 Shown are the results of myocardial tissue pathology staining of mice in each group 7 weeks after TAC surgery;

[0083] like Figure 7 Shown are the results of RT-qPCR detection of myocardial hypertrophy marker genes and myocardial fibrosis index genes;

[0084] like Figure 8 Figures 2 and 3 show the effects of circRAB3IP overexpression on gene expression in neonatal mouse primary cardiomyocytes after stretch. Panels A to H show the relative mRNA expression levels of circRAB3IP, Nppa, Myh7, Acta1, Vegfa, Fgf2, Igf1, and Igf1r, respectively. *p < 0.05; **p < 0.01; ns, no statistically significant differences. Panel I shows changes in HSF1, VEGFA, and HSP27 protein expression in cardiomyocytes as determined by western blot.

[0085] like Figure 9 The figure shows that the supernatant secreted by cardiomyocytes overexpressing circRAB3IP after stretch stimulation promotes HUVEC cell tube formation in vitro;

[0086] like Figure 10 Shown is the up-regulation of circRAB3IP expression after mechanical stretching of HUVEC cells;

[0087] like Figure 11 Shown is the up-regulation of circRAB3IP expression confirmed by RT-qPCR after lentiviral infection of HUVEC cells;

[0088] like Figure 12 Figure 2 shows the functional effects of overexpression of circRAB3IP on HUVEC cells; Figure A shows the tubule formation assay to detect HUVEC tubule formation ability; Figure B shows the cell scratch assay to detect HUVEC migration ability; Figure C shows the CCK-8 assay to detect cell proliferation ability; and Figure D shows the monoclonal formation assay to detect HUVEC population dependence and proliferation ability.

[0089] like Figure 13 Figures 2 and 3 show the experimental results for constructing HUVEC cells with stable knockdown of circRAB3IP. Panel A shows the knockdown efficiency of small interfering RNA (siRNA) targeting circRAB3IP as assessed by RT-qPCR. Panel B shows the mRNA expression levels of circRAB3IP and its parent gene after circRAB3IP knockdown as assessed by RT-qPCR. **p < 0.01; ns: Not statistically significant.

[0090] like Figure 14 The figure shows the functional effect of knocking down circRAB3IP on HUVEC cells; Figure A is a tubule formation assay to detect the tubule formation ability of HUVEC; Figure B is a cell scratch assay to detect the migration ability of HUVEC; Figure C is a CCK-8 assay to detect cell proliferation ability; Figure D is a monoclonal formation assay to detect the population dependence and proliferation ability of HUVEC.

[0091] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any form or substance. It should be pointed out that ordinary technicians in this technical field can make several improvements and supplements without departing from the present invention, and these improvements and supplements should also be regarded as the scope of protection of the present invention. Any equivalent changes, modifications and evolutions made by technicians familiar with this profession without departing from the spirit and scope of the present invention by using the technical content disclosed above are all equivalent embodiments of the present invention; at the same time, any equivalent changes, modifications and evolutions made to the above embodiments based on the essential technology of the present invention are still within the scope of the technical solution of the present invention.

Claims

1. Application of CircRAB3IP in the preparation of a drug for treating myocardial hypertrophy, characterized in that: The circRNA ID of the CircRAB3IP is: hsa_circ_0099132.

2. The use according to claim 1, characterized in that The dosage forms of the medicine include tablets, powders, granules, capsules, oral solutions and injections.

3. The use according to claim 1, characterized in that The dosage form of the drug includes a sustained-release formulation.

Images