Application of Hedgehog pathway inhibitors in the treatment of renal clear cell carcinoma

Abstract

The present invention discloses the use of a Hedgehog pathway inhibitor in the treatment of renal clear cell carcinoma. The present invention specifically relates to the use of an inhibitor of a Hedgehog pathway-related gene in the preparation of a drug for the treatment and / or prevention of renal cell carcinoma. The present invention also provides the use of a reagent for detecting primary cilia formation-related genes in a sample in the preparation of a product for diagnosing renal cell carcinoma. The present invention also provides the use of a reagent for detecting the expression level of a GLI1 biomarker in a renal cell carcinoma typing detection product.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to the application of a Hedgehog pathway inhibitor in treating renal clear cell carcinoma. Background Art

[0002] Renal cell carcinoma (RCC) accounts for 90% of adult renal malignancies and is the most lethal urinary tract malignancy, with an increasing incidence worldwide. Clear cell renal carcinoma (ccRCC) is the most common and aggressive renal malignancy, accounting for 70%-80% of RCC cases. Inactivation of the von Hippel-Lindau (VHL) gene is a hallmark of most sporadic ccRCC cases, and changes in its downstream HIF-VEGF signaling pathway have led to the use of anti-angiogenic targeted therapy, which has now become a first-line drug for the treatment of advanced renal tumors.

[0003] Primary cilia are microtubule-based organelles that behave like cellular antennae, controlling key signaling pathways during development and tissue homeostasis. Because primary cilia require the same structural components as chromosome segregation, they are often considered brakes on cell proliferation, migration, and invasion. Loss of primary cilia has been implicated in the initiation and progression of several human tumors, providing an advantage to these cancer cells to proliferate freely. Conversely, when the tumor-inducing event is an oncogenic mutation in Smo, basal cell carcinoma and medulloblastoma rely on cilia retention to activate Hedgehog (Hh) signaling and promote tumorigenesis. Summary of the invention

[0004] In order to solve the problems in the prior art, the following solutions are provided:

[0005] The first aspect of the present invention provides the use of an inhibitor of a primary cilia formation-related gene in the preparation of a drug for treating and / or preventing VHL-wt RCC, wherein the inhibitor of a primary cilia formation-related gene comprises one, more or all of the inhibitors of IFT88, KIF3A, and GLI1.

[0006] Furthermore, the inhibitors of primary cilia formation-related genes include GANT61 and reagents or targeting compounds used in homologous recombination technology, transcription activator-like effector nuclease technology, zinc finger nuclease technology, regularly clustered interspaced short palindromic repeat technology, RNA interference technology, anti-oligosense nucleotide technology, and Cre-loxP gene recombination technology.

[0007] Furthermore, the GANT61 is used at a concentration of 5 μm or an oral concentration of 50 mg / kg.

[0008] Furthermore, the inhibitors of primary cilia formation-related genes include shIFT88, shKIF3A, and shGLI1.

[0009] Furthermore, the F chain sequence of the shIFT88 is shown in SEQ ID NO:1, and the R chain sequence is shown in SEQ ID NO:2.

[0010] Furthermore, the F chain sequence of the shKIF3A is shown in SEQ ID NO:3, and the R chain sequence is shown in SEQ ID NO:4.

[0011] Furthermore, the F chain sequence of the shGLI1 is shown in SEQ ID NO:5, and the R chain sequence is shown in SEQ ID NO:6.

[0012] Furthermore, the RCC includes VHL-wt RCC.

[0013] Further, the RCC includes renal clear cell carcinoma, papillary renal cell carcinoma, chromophobe renal cell carcinoma, Bellini collecting duct carcinoma, renal medullary carcinoma, multilocular cystic renal cell carcinoma, neuroblastoma-associated renal cell carcinoma, myxoid tubular and spindle cell carcinoma, Wilms' tumor, clear cell sarcoma, leiomyosarcoma, angiosarcoma, malignant microscopic histiocytoma, Xp11.2 translocation / TFE3 gene fusion-associated renal cancer, and optionally, the RCC is ccRCC.

[0014] Furthermore, the treatment and / or prevention includes reducing the cell proliferation ability and / or cell migration ability of RCC.

[0015] Furthermore, the subjects to be treated and / or prevented include humans or non-human mammals, such as rodents, felines, canines and primates.

[0016] In some specific embodiments, the individual being treated and / or prevented is a human.

[0017] The second aspect of the present invention also provides a drug for treating and / or preventing RCC, which comprises one, more or all of the above-mentioned inhibitors of primary cilia formation-related genes in an effective amount for treating and / or preventing RCC.

[0018] Further, the RCC includes renal clear cell carcinoma, papillary renal cell carcinoma, chromophobe renal cell carcinoma, Bellini collecting duct carcinoma, renal medullary carcinoma, multilocular cystic renal cell carcinoma, neuroblastoma-associated renal cell carcinoma, myxoid tubular and spindle cell carcinoma, Wilms' tumor, clear cell sarcoma, leiomyosarcoma, angiosarcoma, malignant microscopic histiocytoma, Xp11.2 translocation / TFE3 gene fusion-associated renal cancer, and optionally, the RCC is ccRCC.

[0019] Furthermore, the RCC includes VHL-wt RCC.

[0020] Furthermore, the treatment and / or prevention includes reducing the cell proliferation ability and / or cell migration ability of RCC.

[0021] Furthermore, the subjects to be treated and / or prevented include humans or non-human mammals, such as rodents, felines, canines and primates.

[0022] Furthermore, the drug includes pharmaceutically acceptable additives.

[0023] Furthermore, the additives include buffers, stabilizers, surfactants, wetting agents, lubricants, emulsifiers, suspending agents, preservatives, antioxidants, covering agents, glidants, processing aids, colorants, sweeteners, fragrances, flavoring agents or diluents.

[0024] Furthermore, the inhibitor of primary cilia formation-related genes includes one, multiple or all of the inhibitors of IFT88, KIF3A and GLI1.

[0025] Furthermore, the inhibitors of primary cilia formation-related genes include GANT61 and reagents or targeting compounds used in homologous recombination technology, transcription activator-like effector nuclease technology, zinc finger nuclease technology, regularly clustered interspaced short palindromic repeat technology, RNA interference technology, anti-oligosense nucleotide technology, and Cre-loxP gene recombination technology.

[0026] Furthermore, the inhibitors of primary cilia formation-related genes include shIFT88, shKIF3A, and shGLI1.

[0027] Furthermore, the F chain sequence of the shIFT88 is shown in SEQ ID NO:1, and the R chain sequence is shown in SEQ ID NO:2.

[0028] Furthermore, the F chain sequence of the shKIF3A is shown in SEQ ID NO:3, and the R chain sequence is shown in SEQ ID NO:4.

[0029] Furthermore, the F chain sequence of the shGLI1 is shown in SEQ ID NO:5, and the R chain sequence is shown in SEQ ID NO:6.

[0030] Furthermore, the GANT61 is used at a concentration of 5 μm or an oral concentration of 50 mg / kg.

[0031] Furthermore, the therapeutic and / or preventive administration routes include entering the body of an individual via the mouth, cheek, tongue, skin, mucosa, nose, eye, lung, rectum, vagina, and stomach in various conventional ways.

[0032] In certain specific embodiments, the route of administration used by the subject is oral.

[0033] The third aspect of the present invention provides the use of a reagent for detecting primary cilia formation-related genes in a sample in the preparation of a product for diagnosing VHL-wt RCC, wherein the primary cilia formation-related genes include one, multiple or all of the IFT88, KIF3A, and GLI1 biomarkers.

[0034] Furthermore, the products include probes, test kits, chips, and test strips.

[0035] Furthermore, the reagents include reagents for detecting mRNA or protein expression levels, including primers or probes that specifically bind to genes, or binding agents that specifically bind to proteins encoded by genes.

[0036] Furthermore, the test sample is from a human or a non-human mammal.

[0037] Furthermore, the test sample includes a body fluid sample, a pre-treated sample or a tissue sample.

[0038] Furthermore, the body fluid sample includes blood, serum, plasma, urine, saliva, sputum, tears, sweat, nasal secretions and bronchoalveolar lavage (BAL) fluid.

[0039] Furthermore, the body fluid sample includes blood, plasma, serum or urine.

[0040] Furthermore, the pretreatment method includes dilution, filtration, centrifugation, concentration, sedimentation, precipitation or dialysis.

[0041] Furthermore, the pretreatment may also include adding chemical or biochemical substances to the solution.

[0042] Furthermore, the chemical or biochemical agent includes acids, bases, buffers, salts, solvents, reactive dyes, detergents, emulsifiers, chelating agents.

[0043] The fourth aspect of the present invention provides the use of primary cilia formation-related genes in constructing a computational model for diagnosing RCC, wherein the primary cilia formation-related genes include one, multiple or all of the IFT88, KIF3A, and GLI1 biomarkers.

[0044] The fifth aspect of the present invention provides the use of the inhibitor of primary cilia formation-related genes described in the first aspect in inhibiting the proliferation ability of RCC cells or tissues in vitro.

[0045] Furthermore, the inhibitors of primary cilia formation-related genes include GANT61 and reagents or targeting compounds used in homologous recombination technology, transcription activator-like effector nuclease technology, zinc finger nuclease technology, regularly clustered interspaced short palindromic repeat technology, RNA interference technology, anti-oligosense nucleotide technology, and Cre-loxP gene recombination technology.

[0046] Furthermore, the inhibitors of primary cilia formation-related genes include shIFT88, shKIF3A, and shGLI1.

[0047] Furthermore, the F chain sequence of the shIFT88 is shown in SEQ ID NO:1, and the R chain sequence is shown in SEQ ID NO:2.

[0048] Furthermore, the F chain sequence of the shKIF3A is shown in SEQ ID NO:3, and the R chain sequence is shown in SEQ ID NO:4.

[0049] Furthermore, the F chain sequence of the shGLI1 is shown in SEQ ID NO:5, and the R chain sequence is shown in SEQ ID NO:6.

[0050] Further, the RCC includes renal clear cell carcinoma, papillary renal cell carcinoma, chromophobe renal cell carcinoma, Bellini collecting duct carcinoma, renal medullary carcinoma, multilocular cystic renal cell carcinoma, neuroblastoma-associated renal cell carcinoma, myxoid tubular and spindle cell carcinoma, Wilms' tumor, clear cell sarcoma, leiomyosarcoma, angiosarcoma, malignant microscopic histiocytoma, Xp11.2 translocation / TFE3 gene fusion-associated renal cancer, and optionally, the RCC is ccRCC.

[0051] Furthermore, the RCC includes VHL-wt RCC.

[0052] The sixth aspect of the present invention also provides the use of the inhibitor of primary cilia formation-related genes described in the first aspect in inhibiting the metastatic ability of RCC cells or tissues in vitro.

[0053] Furthermore, the inhibitors of primary cilia formation-related genes include GANT61 and reagents or targeting compounds used in homologous recombination technology, transcription activator-like effector nuclease technology, zinc finger nuclease technology, regularly clustered interspaced short palindromic repeat technology, RNA interference technology, anti-oligosense nucleotide technology, and Cre-loxP gene recombination technology.

[0054] Furthermore, the inhibitors of primary cilia formation-related genes include shIFT88, shKIF3A, and shGLI1.

[0055] Furthermore, the F chain sequence of the shIFT88 is shown in SEQ ID NO:1, and the R chain sequence is shown in SEQ ID NO:2.

[0056] Furthermore, the F chain sequence of the shKIF3A is shown in SEQ ID NO:3, and the R chain sequence is shown in SEQ ID NO:4.

[0057] Furthermore, the F chain sequence of the shGLI1 is shown in SEQ ID NO:5, and the R chain sequence is shown in SEQ ID NO:6.

[0058] Further, the RCC includes renal clear cell carcinoma, papillary renal cell carcinoma, chromophobe renal cell carcinoma, Bellini collecting duct carcinoma, renal medullary carcinoma, multilocular cystic renal cell carcinoma, neuroblastoma-associated renal cell carcinoma, myxoid tubular and spindle cell carcinoma, Wilms' tumor, clear cell sarcoma, leiomyosarcoma, angiosarcoma, malignant microscopic histiocytoma, Xp11.2 translocation / TFE3 gene fusion-associated renal cancer, and optionally, the RCC is ccRCC.

[0059] Furthermore, the RCC includes VHL-wt RCC.

[0060] The seventh aspect of the present invention further provides the use of a reagent for detecting the expression level of the GLI1 biomarker in a RCC typing detection product, wherein the typing of RCC includes VHL-wt RCC and VHL-mut RCC.

[0061] Further, the RCC includes renal clear cell carcinoma, papillary renal cell carcinoma, chromophobe renal cell carcinoma, Bellini collecting duct carcinoma, renal medullary carcinoma, multilocular cystic renal cell carcinoma, neuroblastoma-associated renal cell carcinoma, myxoid tubular and spindle cell carcinoma, Wilms' tumor, clear cell sarcoma, leiomyosarcoma, angiosarcoma, malignant microscopic histiocytoma, Xp11.2 translocation / TFE3 gene fusion-associated renal cancer, and optionally, the RCC is ccRCC.

[0062] Furthermore, the detection products include probes, test kits, chips, and test strips.

[0063] Furthermore, the reagents include reagents for detecting the expression level of GLI1 mRNA or protein, including primers or probes that specifically bind to the GLI1 gene, or binding agents that specifically bind to the protein encoded by the GLI1 gene.

[0064] Furthermore, the test sample is from a human or a non-human mammal.

[0065] Furthermore, the test sample includes a body fluid sample, a pre-treated sample or a tissue sample.

[0066] Furthermore, the body fluid sample includes blood, serum, plasma, urine, saliva, sputum, tears, sweat, nasal secretions and bronchoalveolar lavage (BAL) fluid.

[0067] Furthermore, the body fluid sample includes blood, plasma, serum or urine.

[0068] Furthermore, the pretreatment method includes dilution, filtration, centrifugation, concentration, sedimentation, precipitation or dialysis.

[0069] Furthermore, the pretreatment may also include adding chemical or biochemical substances to the solution.

[0070] Furthermore, the chemical or biochemical agent includes acids, bases, buffers, salts, solvents, reactive dyes, detergents, emulsifiers, chelating agents.

[0071] The eighth aspect of the present invention provides a product for diagnosing whether a subject suffers from RCC, wherein the product comprises a reagent for detecting the gene or protein expression level of the primary cilia formation-related gene described in the fourth aspect in a sample.

[0072] Furthermore, the products include probes, test kits, chips, and test strips.

[0073] The ninth aspect of the present invention provides an in vitro method for inhibiting the proliferation ability of RCC cells or tissues for non-therapeutic purposes, the method comprising the following steps: treating RCC cells or tissues with the drug described in the second aspect.

[0074] The tenth aspect of the present invention provides an in vitro method for inhibiting the metastatic ability of RCC cells or tissues for non-therapeutic purposes, the method comprising the following steps: treating RCC cells or tissues with the drug described in the second aspect.

[0075] The eleventh aspect of the present invention provides a system for classifying RCC using the GLI1 biomarker, the system comprising a judgment module for classifying RCC into VHL-wt RCC and VHL-mut RCC according to the gene or protein expression level of the GLI1 biomarker.

[0076] Furthermore, the system also includes a data collection module and a data processing module. BRIEF DESCRIPTION OF THE DRAWINGS

[0077] Figure 1The three-dimensional antibody staining images and the bar graphs of cilia number of normal renal cell lines, VHL wild-type ccRCC cell lines and VHL mutant ccRCC cell lines, wherein A is the three-dimensional antibody staining image, Arl13b antibody staining (red) marks cilia, DAPI (blue) marks DNA, scale bar = 10 μm, B is the bar graph of cilia number of the three cell lines;

[0078] Figure 2 Figure 1 is a quantitative analysis of IHC and IF staining of tissue samples and the presence / absence of primary cilia in VHL wild-type ccRCC cell lines (n=25) and VHL mutant ccRCC cell lines (n=57), wherein A is an IHC and IF staining of tissue samples, Arl13b antibody staining (red) marks cilia, and DAPI (blue) marks DNA, and B is a quantitative analysis of the presence / absence of primary cilia in VHL wild-type ccRCC cell lines and VHL mutant ccRCC cell lines;

[0079] Figure 3 The immunofluorescence staining, western blot and column results analysis of VHL knockdown SN12-PM6, where A is the immunofluorescence staining and western blot results, B is the column results analysis of the percentage of ciliated cells, Arl13b antibody staining (red) marks cilia, DAPI (blue) marks DNA, scale bar = 10 μm;

[0080] Figure 4 The immunofluorescence staining and quantitative analysis results of the percentage of primary cilia in ccRCC (Caki-1, SN12-PM6) cell lines with IFT88 or KIF3A knockdown are shown in Figure 1, where A is an immunofluorescence staining image, Arl13b antibody staining (red) marks cilia, and DAPI (blue) marks DNA, and B is a quantitative analysis result of the percentage of primary cilia, scale bar = 10 μm;

[0081] Figure 5 It is a western blot experiment result of ccRCC (Caki-1, SN12-PM6) cell lines with IFT88 or KIF3A knockdown;

[0082] Figure 6 : is an absorbance analysis graph of the MTT cell proliferation assay of ccRCC (Caki-1, SN12-PM6) cell lines with IFT88 or KIF3A knockdown, wherein A is an absorbance analysis graph of the MTT cell proliferation assay of the Caki-1 cell line, and B is an absorbance analysis graph of the MTT cell proliferation assay of the SN12-PM6 cell line;

[0083] Figure 7These are transwell assay diagrams of ccRCC (Caki-1, SN12-PM6) cell lines with IFT88 or KIF3A knockdown, where A is a cell staining result diagram of the transwell assay, and B is a statistical analysis diagram of the number of transwell cells;

[0084] Figure 8 It is a representative bioluminescence image of nude mice orthotopically transplanted with SN12-PM6 cells (stable transfection of LUC-labeled shKIF3A, shIFT88 or scramble vector) 4 weeks after the cells were transplanted, wherein A is a three-dimensional representative bioluminescence image of nude mice, and B is a measurement statistical result analysis diagram of the bioluminescence signal;

[0085] Fig. 9 The representative bioluminescence images of lung tissues and H&E staining results of kidney and lung tissues, and statistical result graphs of nude mice orthotopically transplanted with SN12-PM6 cells (stable transfection of LUC-labeled shKIF3A, shIFT88 or scramble vector) for 4 weeks, wherein A is a representative bioluminescence image of lung tissues in each group, B is a representative H&E staining image of kidneys in each group, scale bar (left panel) = 2 mm, scale bar (right panel) = 50 μm, C is a representative H&E staining image of lung tissues in each group, scale bar (left panel) = 1 mm, scale bar (right panel) = 100 μm, and D is a result analysis graph of the percentage of lung metastasis incidence;

[0086] Fig.10 It is a statistical chart of hedgehog signaling pathway and VHL gene mutation frequency in renal cancer based on the TCGA database and 132 ccRCC patients collected from the self-collection. Among them, A is a statistical chart of hedgehog signaling pathway and VHL gene mutation frequency in renal cancer based on the data analysis of the TCGA database, and B is a statistical chart of hedgehog signaling pathway and VHL gene mutation frequency in renal cancer based on the data analysis of 132 ccRCC patients collected from the self-collection.

[0087] Fig.11 This is an analysis chart of the frequency of mutant genes in the hedgehog signaling pathway in exome sequencing data;

[0088] Fig.12 It is the qPCR detection result of the mRNA expression level of Hedgehog pathway factor GLI1 in ccRCC cell lines (Caki-1, Caki-2, SN12-PM6) and normal kidney cell lines (293TN, HK2, HKC);

[0089] Fig.13These are the immunofluorescence staining images and percentage statistical results of SMO in ccRCC ciliated cell lines (Caki-1, Caki-2, SN12-PM6) and normal kidney cell lines (293TN, HK2, HKC), where A is the immunofluorescence staining image of SMO, marked with Arl13b (red), SMO (green) and DAPI (blue), the white arrow indicates SMO in cilia, and B is the statistical result of the accumulation percentage of SMO in cilia;

[0090] Fig.14 Figure 1 is a graph showing the Caki-1 cell line transfected with or not transfected with shIFT88 or shKIF3A for 72 hours, then starved for 48 hours, treated with DMSO or SAG (1 μM), fixed and stained, the transwell assay results of each group, and the qPCR detection results of the mRNA expression level of GLI1, wherein A is the staining result graph, marked with Arl13b (red), SMO (green) and DAPI (blue), the white arrow indicates SMO in cilia, B is the accumulation percentage of SMO in cilia, C is the transwell result graph of the Caki-1 cell line transfected, D is the transwell cell number statistical result graph, and E is the qPCR detection result graph of the mRNA level of GLI1 in each combination;

[0091] Fig.15 This is the result diagram of the difference in GLI1 expression levels between ccRCC tumors and normal tissues in the TCGA database;

[0092] Fig.16 are the IHC detection and immunofluorescence staining images of VHL, GLI1 and primary cilia in clinical ccRCC samples (n=49), where A is the immunofluorescence staining image, scale bar=20 μm, and B is the bar chart analysis of GLI1 expression level;

[0093] Fig.17 is the western blot detection result of GLI1 protein expression level in VHL-wt ccRCC cell line and VHL-mut ccRCC cell line;

[0094] Fig.18The three-dimensional quantitative morphological graph, MTT cell proliferation experiment graph, Transwell experiment result graph, and representative bioluminescent images of nude mice orthotopically transplanted with SN12-PM6 cells transfected with LUC-labeled shGLI1 interference vector after knocking out GLI1 in ccRCC cells (Caki-1, Caki-2), wherein A is a three-dimensional morphological graph after knocking out GLI1 in ccRCC cells (Caki-1, Caki-2), B is an MTT experiment analysis graph after knocking out GLI1 in Caki-1, C is an MTT experiment analysis graph after knocking out GLI1 in Caki-2, D is a transwell experiment result graph after knocking out GLI1 in ccRCC cells (Caki-1, Caki-2), E is a statistical graph of the number of invasive cells after knocking out GLI1 in Caki-1, F is a statistical graph of the number of invasive cells after knocking out GLI1 in Caki-2, G is a three-dimensional representative bioluminescent image of nude mice, and H is a statistical result analysis graph of the measurement of bioluminescent signals;

[0095] Fig.19 The transwell experiment results of SN12-PM6 and Caki-1 using GANT61 (5 μm) are shown in Figure 1, where A is a three-dimensional result diagram, B is a statistical result diagram of the number of invasive cells of SN12-PM6 cells, and C is a statistical result diagram of the number of invasive cells of Caki-1 cells;

[0096] Fig. 20 These are representative bioluminescent images of LUC-labeled SN12-PM6 cells and nude mice orally administered with GANT61 (50 mg / kg) or DMSO for orthotopic transplantation, where A is a three-dimensional representative bioluminescent image and B is a statistical graph of the number of invasive cells;

[0097] Note: Significant differences were indicated by *p<0.05, **p<0.01, ***p<0.001. DETAILED DESCRIPTION

[0098] The terms "primary cilium", "primary cilium", "primary cilium" or "cilia" in the present invention are synonymous and refer to a hair-like organelle protruding from the cell surface, with a length ranging from a few microns to two millimeters and a diameter of about 0.25 μm. Primary cilia are based on microtubules and originate from the mother centriole of the cell. They are anchored on the cell membrane and protrude from the cell surface like an "antenna". As a cell receptor, primary cilia receive various types of signals from the environment and transmit them to the cell to cause a cellular response.

[0099] The term "individual" or "patient" as used in the present invention refers to an animal (including, for example, mammals, such as dogs, cats, horses, rabbits, zoo animals, cattle, pigs, sheep, non-human primates, and humans) suitable for treatment who is experiencing, has experienced, is at risk of developing one or more signs, symptoms, or other indicators of a cell proliferation, cell metastasis disease or disorder (such as cancer), or has a family history thereof. It is intended that any patient participating in a clinical research trial, participating in an epidemiological study, or once used as a control who does not show any clinical signs of the disease be included as a patient.

[0100] The term "VHL" in the present invention is the abbreviation of "Von Hippel-Lindau syndrome", i.e., CNS hemangioblastoma combined with kidney or pancreatic cysts, pheochromocytoma, renal cancer, and pericytotic cystadenoma and other diseases. It is currently believed that VHL syndrome is caused by mutations in the VHL gene. The VHL gene is a tumor suppressor gene located in the chromosome 3P25 region, encoding a cell protein containing 214 amino acids and a molecular weight of 30ku. The protein encoded by VHL participates in the formation of a multiprotein complex, which can negatively regulate hypoxia-induced mRNA expression of vascular endothelial growth factor (VEGF). VHL gene mutations can cause the protein to lose function, VEGF expression increases, and vascular-rich hemangioblastomas occur.

[0101] The term "RCC" in the present invention refers to renal cell carcinoma (RCC for short), which is a highly malignant tumor in the urinary system and one of the most common tumors. It is a malignant tumor originating from the urinary tubular epithelial system of the renal parenchyma, also known as renal adenocarcinoma, accounting for 80% to 90% of renal malignant tumors.

[0102] The term "ccRCC" in the present invention is short for clear cell renal cell carcinoma, which is a malignant tumor with heterogeneous morphology derived from renal tubular epithelial cells. The tumor cells mainly have clear and occasionally eosinophilic cytoplasm, accompanied by a rich vascular network, and are associated with biallelic inactivation of VHL.

[0103] The terms "VHL-wt RCC" and "VHL-wt renal cell carcinoma" in the present invention refer to renal cell carcinoma with normal VHL gene, including its cells, tissues or extracts thereof.

[0104] The terms "VHL-mut RCC" and "VHL-mut renal cell carcinoma" in the present invention refer to renal cell carcinoma in which the VHL gene loses its function after mutation, including cancer cells, tissues or extracts thereof.

[0105] The term "route of administration" as used herein includes, but is not limited to, oral (e.g., by ingestion); buccal; lingual; transdermal (including, for example, by patches, plasters, etc.); transmucosal (including, for example, by patches, plasters, etc.); nasal (e.g., by nasal spray, drops, or by a nebulizer or dry powder delivery device); ocular (e.g., by eye drops); pulmonary (e.g., by inhalation or insufflation therapy, such as by using an aerosol, for example, through the mouth or nose); rectal (e.g., by suppository or enema); vaginal (e.g., by vaginal ring); parenteral, for example, by injection, including subcutaneous, intradermal, intramuscular, intravenous, intraarterial, intracardiac, intrathecal, intraspinal, intracapsular, subcapsular, intraorbital, intraperitoneal, intratracheal, subcutaneous, intraarticular, subarachnoid, and intrasternal implantation of a depot or reservoir, for example, subcutaneous or intramuscular.

[0106] As used herein, the term "inhibitor" refers to a molecule, such as a compound, drug, enzyme or hormone, that blocks or otherwise interferes with a specific biological activity. The term "inhibitor" is synonymous with the term antagonist.

[0107] The term "effective amount" as used herein is meant to describe the amount of the pharmaceutical composition of the present invention that can be used to induce a desired result when used in the methods of the present invention. In various aspects of the present invention, the term effective amount is used in conjunction with treatment or prevention.

[0108] The present invention is further illustrated by the following examples, from which other features, embodiments and advantages can be obtained. Likewise, the specific modifications discussed should not be construed as limiting the scope of the present invention. It will be apparent to those skilled in the art that various equivalent schemes, changes and modifications can be made without departing from the scope of the present invention, and therefore it should be understood that such equivalent embodiments are included herein.

[0109] Example

[0110] 1. Experimental Materials and Methods

[0111] 1. Human samples

[0112] 132 human ccRCC tissues were obtained from the clinical database of PLA General Hospital. Informed consent was obtained from each patient, and the study was approved by the Institutional Review Board of PLA General Hospital. All cancer tissue samples were pathologically confirmed as ccRCC according to the 2011 Union for International Cancer Control TNM classification of malignant tumors. All patients were informed and signed a consent form regarding the use of clinical specimens for scientific research.

[0113] 2. Cell culture

[0114] Human ccRCC cell lines Caki-1, Caki-2, 786-O, 769-P, A498, and normal kidney cell lines 293TN, HK2, and HKC cells were purchased from the National Science and Technology Experimental Cell Resource Platform. SN12-PM6 cells were maintained in this laboratory. Caki-1 and Caki-2 were cultured in McCoy 5A medium (HyClone), 786-O, 769-P, A498, HK2, and HKC were cultured in RPMI 1640 (Gibco), and SN12-PM6 and 293TN cells were cultured in DMEM (HyClone) with 10% FBS (Gibco). All cells were cultured at 37°C in a 5% CO2 incubator.

[0115] 3. TCGA database data analysis

[0116] The Cancer Genome Atlas (TCGA) database (http: / / cancergenome.nih.gov) was analyzed using UALCAN (http: / / ualcan.path.uab.edu / index.html) to identify Hedgehog signaling gene mutations. All analyses were performed using GraphPad Prism 8.0.1 (GraphPad Software, CA, USA), unless otherwise stated. Data are presented as mean ± standard deviation (SD). Categorical data were analyzed using the chi-square test or Fisher's exact test. Unpaired Student's t-test was used for comparison between the two groups. Kaplan-Meier survival analysis was performed using SPSS software (version 23.0) with the log-rank test. Significant differences were indicated as *P<0.05, **P<0.01, ***P<0.001, ****p<0.0001, unless otherwise stated.

[0117] 4. Western blot analysis

[0118] The total protein was separated by radioimmunoprecipitation (RIPA; Beyotime, Shanghai, China) buffer using a BCA protein detection kit (AR0197; Boster, Wuhan, China). Equal amounts of total protein were separated by SDS PAGE and transferred to a 0.25 μm (polyvinylidene difluoride membrane) PVDF membrane (Millipore, Billerica, USA). The primary antibodies included anti-β-actin antibody (1:500, 66009-1-Ig; Proteintech); anti-vhl antibody (1:500, sc135657; Santa Cruz); anti-P62 (1:10000, ab109012, Abcam); anti-LC3B (1:2000, ab192890; Abcam), anti-kif3a antibody (1:1000, 13930-1-AP; Proteintech); anti-ift88 (1:1000, 13967-1-AP; Proteintech); anti-gli1 antibody (1:2000, 66905-1-Ig; Proteintech). After washing three times with TBST, the membrane was bound to HRP (horseradish peroxidase); secondary antibody: 1:500, diluted at room temperature for 1 hour. Antibody binding was detected using SuperSignal West Pico chemiluminescent substrate (Thermo Scientific). The experiment was repeated at least three times, and the band intensity was quantified using ImageJ software.

[0119] 5. MTT cell proliferation assay

[0120] Each group of cells was inoculated in a 96-well plate (1000 cells per well). The absorbance was measured at 37°C, 5% CO2 24, 48, 72 and 96 hours after inoculation. (CTB) Cell viability assay (CTB169, Promega, Beijing, China) was used to evaluate cell viability. The assay was performed every 24 h, and 20 μl of MTT reagent was added to each well at different time points and incubated at 37 °C for 2 h. The absorbance was measured at a wavelength of 490 nm. All experiments were repeated 3 times.

[0121] 6. Cell migration and invasion assay

[0122] Diluted Matrigel (BD Biosciences) was used in the experiment. Cancer cells (2000 cells / well) were planted in 200 μl of culture medium without FBS and inoculated in the upper chamber of Matrigel-uncoated (356224, BD Biosciences). The lower chamber was filled with 500 μl of culture medium containing 15% FBS. After incubation for 24 h at 37 ° C in 5% CO2, the cells were fixed with 4% paraformaldehyde, and the migrated cells were stained with 0.5% crystal violet (C8470, Solarbio, china), and photographed and counted under an optical microscope.

[0123] 7. Immunofluorescence

[0124] 24 hours before the experiment, different groups of cells were seeded on slides and allowed to grow. After fixing with 4% paraformaldehyde / PBS for 15 minutes, the cells were washed once with PBS, permeabilized with 0.5% Triton X-100 for 10 minutes, and then blocked with 3% NGS (Gibco) for 30 minutes. Cells were incubated with primary antibodies at 37°C for 2 hours, including anti-Ac-tubulin (1:500, 66200-1-Ig; Proteintech); anti-SMO (1:200, sc166685 Santa Cruz), and then incubated with secondary antibodies at 37°C for 1 hour. 0.2mg / mL DAPI was used for nuclear staining.

[0125] 8. Immunohistochemistry

[0126] Immunohistochemical (IHC) staining was performed using antibodies specific for VHL, GLI1, and Ki-67 as described previously. The degree of positivity was initially classified based on the proportion of positively stained tumor cells and the staining intensity score. The score representing the proportion of positively stained tumor cells was graded as follows: 0 (<10%), 1 (11–25%), 2 (26–50%), 3 (51–75%), and 4 (>75%). The staining intensity was determined as follows: 0 (no staining), 1 (weak staining = pale yellow), 2 (moderate staining = yellow-brown), and 3 (strong staining = brown). The staining index was calculated as the product of staining intensity × percentage of positive tumor cells and scored as 0, 1, 2, 3, 4, 6, 8, 9, 12. Only cells with clear tumor cell morphology were scored.

[0127] 9. Plasmid construction, transfection and infection

[0128] Short hairpin RNA (shRNA) sequences targeting human IFT88 (Gene ID: 8100), KIF3A (Gene ID: 11127), GLI1 (Gene ID: 2735), VHL (Gene ID: 7428) were prepared as shIFT88, shKIF3A, shGLI1, shVHL. Oligonucleotides (IFT88: 5′-GAACAAGTTACAACTCCAGAA-3′; KIF3A: 5′-GCAACTAATATGAACGAACAT-3′) were designed and synthesized by BGI (Shenzhen, China) and cloned into pLKO.1. Lentivirus was produced in 293T cells. Cells were transfected with 6 μg of vector plasmid, 4.5 μg of psPAX2, and 1.5 μg of pMD2-VSVG by standard calcium chloride transfection method. Calcium transfection kit was purchased from McGinn Biotech (Beijing, China). 48h and 72h after transfection, the viral supernatant containing the released virus was collected and filtered with a 0.45μm filter. The target cells were infected with the virus and 10ug / ml polystyrene for 24 hours. Then they were treated with 2μg / mL puromycin (Sigma, USA) for 3-4 days until the infected cells were stable. The knockdown plasmids of IFT88, KIF3A, and GLI1 were transfected into SN12-PM6, Caki-1, and Caki-2 cells for 72 hours. Among them,

[0129] The F chain sequence of the shIFT88 sequence is shown in SEQ ID NO: 1. The specific sequence of SEQ ID NO: 1 is:

[0130] CCGGCTCTGGCATCATCAATAGGAACTCGAGTTCCTATTGATGATGCC AGAGTTTTTG;

[0131] The R chain sequence of the shIFT88 sequence is shown in SEQ ID NO: 2. The specific sequence of SEQ ID NO: 2 is:

[0132] AATTCAAAAACTCTGGCATCATCAATAGGAACTCGAGTTCCTATTGAT GATGCCAGAG;

[0133] The F chain sequence of the shKIF3A sequence is shown in SEQ ID NO: 3. The specific sequence of SEQ ID NO: 3 is:

[0134] CCGGGCCTGTTTGAACACATTCTAACTCGAGTTAGAATGTGTTCAAAC AGGCTTTTTG;

[0135] The R chain sequence of the shKIF3A sequence is shown in SEQ ID NO: 4. The specific sequence of SEQ ID NO: 4 is:

[0136] AATTCAAAAAGCCTGTTTGAACACATTCTAACTCGAGTTAGAATGTGT TCAAACAGGC;

[0137] The F chain sequence of shGLI1 is shown in SEQ ID NO:5. The specific sequence of SEQ ID NO:5 is:

[0138] CCGGCATCCATCACAGATCGCATTTCTCGAGAAATGCGATCTGTGATG GATGTTTTTG;

[0139] The R chain sequence of shGLI1 is shown in SEQ ID NO:6. The specific sequence of SEQ ID NO:6 is:

[0140] AATTCAAAAACATCCATCACAGATCGCATTTCTCGAGAAATGCGATC TGTGATGGATG;

[0141] The F chain sequence of the shVHL sequence is shown in SEQ ID NO: 7. The specific sequence of SEQ ID NO: 7 is:

[0142] CCGGCAATGTTGACGGACAGCCTATCTCGAGATAGGCTGTCCGTCAACATTGTTTTTG;

[0143] The R chain sequence of the shVHL sequence is shown in SEQ ID NO: 8. The specific sequence of SEQ ID NO: 8 is:

[0144] AATTCAAAAACAATGTTGACGGACAGCCTATCTCGAGATAGGCTGTC CGTCAACATTG.

[0145] 10. RNA extraction and qRT-PCR

[0146] Total RNA was extracted using TRIzol reagent (Invitrogen). Ⅱ First-Strand cDNA Synthesis Kit (E6300S, NEB, USA) was used to synthesize complementary DNA according to the manufacturer's instructions. SYBR Green SuperMix Plus (E096-01A, novoprotein, China) was used to detect the mRNA expression level of genes. -ΔΔCT The activity was normalized to that of peptidylproline isomerase A (PPIA).

[0147] 11. Primary renal cancer cell culture

[0148] Tumor specimens from two patients with renal cell carcinoma were separated by collagenase digestion and sent to the laboratory within 10 min. After removing blood clots, the specimens were rinsed twice with sterile phosphate-buffered saline (PBS) and cut into approximately 1 mm 3 The fragments were then incubated with 1% collagenase (Solarbio) in a gently shaking water bath. After collagenase incubation, the remaining samples were collected and placed in a 24-well plate. The isolated and split cells were cultured using F medium containing 25% Ham's F-12 nutrient mixture (Thermo Fisher Scientific, Carlsbad, CA) supplemented with 10% FBS.

[0149] 12. In vivo transfer experiment

[0150] Prepare SN12-PM6 cells (for imaging) with luciferase, knockdown / non-knockdown of KIF3A, IFT88, GLI1. 1×10 6 Cells (dissolved in 0.1 mL sterile PBS) were mixed with Matrigel matrix gel 1:1 and injected into the renal capsule of 4- to 5-week-old male nude mice (6 mice per group). A molecular imaging system (NightOWL II LB983) was used for in vivo monitoring, including orthotopic xenograft tumors and lung metastatic nodules. The signal intensity of luc-labeled lung tissue cells represents the number of lung metastases. Mice were killed 2 months after injection, tissue samples were collected and measured, and HE, IHC, and IF staining were performed.

[0151] 2. Experimental Results

[0152] 1. Various renal cell lines were stained with the cilia marker Arl13b. In fact, normal renal cell lines have cilia, while VHL mutant (VHL-mut) ccRCC cell lines mostly lack primary cilia. In contrast, VHL wild-type (VHL-wt) ccRCC cell lines retain a higher incidence of primary cilia, with the frequency of ciliated cells ranging from 40% to 70%. Figure 1To further strengthen the link between cilia and VHL status, 83 patients were analyzed for VHL genetic mutations using Sanger sequencing of ccRCC clinical tumor samples, of which 26 had no VHL genetic mutations. VHL antibody immunohistochemical staining and cilia marker Arl13b immunofluorescence staining were used to detect tumor tissues and adjacent normal tissues. The results are shown in Figure 2 As shown in the results, VHL-wt ccRCC had a higher expression level of VHL and maintained a higher incidence of primary cilia compared with VHL-mut ccRCC, indicating that VHL status was positively correlated with the presence of cilia. To test whether VHL regulates primary cilia formation, a VHL knockdown renal cancer cell line (SN12-PM6) was established using stable RNA interference technology, and the frequency of cilia was analyzed. The results are shown in Figure 3 As shown, the results showed that knocking out VHL significantly reduced ciliary motility in SN12-PM6. In summary, primary cilia are widely present in VHL-wt ccRCC, and their presence indicates a significant deterioration in progression-free survival (PFS) in ccRCC.

[0153] 2. Since the incidence of primary cilia in the VHL-wt ccRCC cell lines caki-1 and SN12-PM6 with metastatic potential is high, and clinical patients with cilia are more likely to relapse and metastasize, we investigated whether cilia destruction mediated by ciliary gene inhibition affects renal cancer cell behavior. The results showed that silencing of KIF3A and IFT88 in Caki-1 and SN12-PM6 significantly blocked cilia formation. Figure 4 As shown, the knockout efficiency was confirmed at the protein level by western blot. Figure 5 Then the MTT method was used to detect the effect of ciliary genes on ccRCC cell proliferation. The results are shown in Figure 6 As shown in Figure 2, the results showed that inhibition of osteogenesis significantly reduced the proliferation of Caki-1 and SN12-PM6 cells. Further transwell analysis yielded the following results: Figure 7 As shown, the results showed that ciliary gene knockout significantly reduced the number of migrated ccRCC cells compared with the scrambled control group.

[0154] Next, to verify whether inhibiting osteogenesis would affect the tumorigenic and metastatic ability of ccRCC cells in vivo, luciferase-labeled SN12-PM6 cells were transfected with scramble, shIFT88, and shKIF3A, respectively. Scramble was used as the control group and implanted in situ into the subrenal capsule of the mouse kidney. After 4 weeks, the bioluminescence signals of the shIFT88 and shKIF3A groups were significantly lower than those of the scramble group. Figure 8Ex vivo bioluminescence imaging was performed immediately after the mice were sacrificed to monitor lung metastasis. Fig. 9 As shown, lung metastasis occurred in the scramble group, while neither the shIFT88 group nor the shKIF3A group had lung metastasis. H&E staining of the kidney confirmed the ccRCC tumor type and showed that the tumor volume of the shIFT88 and shKIF3A groups was significantly reduced compared with the scramble group. In addition, H&E staining of lung tissue confirmed that the scramble group had lung metastasis, while the shIFT88 and shKIF3A groups did not have lung metastasis.

[0155] In summary, primary cilia play an oncogenic role in the proliferation and metastasis of VHL wild-type ccRCC in both in vivo and in vitro experiments.

[0156] 3. Through the analysis of the TCGA database, it was found that mutations in five genes encoding components of the canonical Hedgehog pathway accounted for 8.26% of renal cancer patients (n=37 out of 448 people). Fig.10 As shown in Figure 2, surprisingly, Hedgehog pathway mutations were enriched in VHL-wt renal cancer, accounting for 64.9%, while in the VHL-mutated ccRCC subtype, accounting for 35.1%. To further verify this phenomenon, targeted exome sequencing data of renal cancer patients in our hospital were integrated, and the results were as follows Fig.11 As shown, Hedgehog pathway gene mutations were found to account for 18% (n=24 out of 132 cases). In addition, the percentage of hedgehog gene mutations in VHL-wt ccRCC was 66.7%, which was twice that of VHL mutant ccRCC, indicating that Hedgehog signaling may play a key role in the malignant progression of VHL-wt ccRCC.

[0157] 4. To demonstrate whether Hedgehog signaling is activated in VHL-wt ccRCC cell lines and that its activation depends on primary cilia, real-time quantitative PCR (qPCR) was performed to detect the mRNA levels of Hedgehog target genes of GLI1 in VHL-wt ccRCC cell lines and normal kidney cell lines. Fig.12 As shown in Figure 2, the mRNA level of GLI1, a terminal effector transcription factor of the Hedgehog pathway, was significantly higher in VHL-wt ccRCC cell lines compared with normal renal cell lines. Since a key step in the activation of Hedgehog signaling is the accumulation of Smoothened (SMO) protein in cilia, the results Fig.13 Double immunostaining results showed that SMO ciliary localization was more in VHL-wt ccRCC cell lines than in normal renal cell lines. The above data indicate that hedgehog signaling is activated in VHL-wt ccRCC.

[0158] To functionally link hedgehog signaling activation to primary cilia formation, serum-free cell cultures were used, which have low baseline SMO ciliary localization but are induced more strongly upon treatment with SAG, a potent agonist of SMO, to activate the hedgehog pathway. Fig.14 As shown, under serum starvation conditions, transwell analysis revealed that SAG treatment significantly promoted the migration of Caki-1 in the Caki group but not in the ciliary gene inhibition group. In addition, the primary ciliary structure disrupted the GLI1 signaling pathway activated by SAG treatment.

[0159] Thus, these findings demonstrate an important role for primary cilia as a platform for Hedgehog signaling activation in VHL-wt ccRCC.

[0160] 5. Analysis of the TCGA database revealed that GLI1 expression in ccRCC tumors was higher than that in normal tissues ( Fig.15 A, p<0.01), and high expression of GLI1 was associated with poor survival ( Fig.15 B, p<0.01), the results are as follows Fig.15 Next, the clinical specimens were immunostained, and the results were shown in Fig.16 As shown in Figure 2, it was found that high expression of GLI1 was mainly detected in VHL-wt ccRCC, and the increase of GLI1 protein was positively correlated with cilia formation. In addition, western blot analysis also showed that the expression level of GLI1 protein in VHL-wt ccRCC cell lines was higher than that in VHL-mut ccRCC cell lines. Fig.17 We knocked down GLI1 in Caki-1 and Caki-2 cells and performed functional studies. The results are shown in Fig.18 As shown, the results showed that downregulation of GLI1 could significantly inhibit cell proliferation and migration. SN12-PM6 stably expressing luciferase and knocking down GLI1 were transplanted under the right kidney capsule of nude mice to verify the in vivo inhibitory phenotype of knocking down GLI1. After 4 weeks, bioluminescence imaging showed that the intrarenal signal of the control group was significantly higher than that of the shGLI1 group. IHC staining demonstrated that the percentage of positively stained cells in the cancer cell nuclei (Ki67) expression was reduced in GLI1-silenced xenograft tumors.

[0161] Hedgehog pathway inhibitors have shown promising efficacy in the treatment of Hedgehog-mediated malignancies such as basal cell carcinoma and medulloblastoma. We then used GANT61, an inhibitor of GLI1, to test its effects in VHL-wtccRCC cells in vitro and in vivo. Fig.19 As shown, the results showed that GANT61 could significantly inhibit the proliferation and migration of SN12-PM6 cells.

[0162] To confirm the inhibitory effect of the hedgehog pathway inhibitor in vivo, GANT61 (50 mg / kg) or DMSO was administered to the SN12-PM6-LUC xenograft mouse model by oral gavage three times a week. After 4 weeks, bioluminescence imaging showed that the renal signal of the GANT61-treated rats was significantly lower than that of the control group. Fig. 20 Taken together, our results demonstrate the dependency of Hedgehog signaling GLI1 in the malignant progression of VHL-wt ccRCC.

[0163] The description of the above embodiments is only used to understand the method and core idea of ​​the present invention. It should be pointed out that, for those skilled in the art, several improvements and modifications can be made to the present invention without departing from the principle of the present invention, and these improvements and modifications will also fall within the scope of protection of the claims of the present invention.

Claims

1. Use of an inhibitor of primary cilia formation-related gene IFT88 in the preparation of a drug for treating and / or preventing renal cell carcinoma, wherein the IFT88 inhibitor is shIFT88, and the shIFT88 sequence is 5'-GAACAAGTTACAACTCCAGAA-3'; and the renal cell carcinoma is VHL-wt renal clear cell carcinoma.

2. The use according to claim 1, characterized in that: The treatment and / or prevention includes reducing the cell proliferation ability and / or cell migration ability of renal cell carcinoma.

3. The use according to claim 1, wherein the subject to be treated and / or prevented comprises a human or a non-human mammal.

4. The use according to claim 3, wherein the non-human mammal comprises a rodent, a feline, a canine or a primate.

5. A drug for treating and / or preventing VHL-wt renal clear cell carcinoma, characterized in that: The drug comprises an effective amount for treating and / or preventing renal cell carcinoma and an inhibitor of the primary cilia formation-related gene IFT88 according to any one of claims 1 to 4. The medicament according to claim 5 , comprising a pharmaceutically acceptable additive.

7. The drug according to claim 6, wherein the additive comprises a buffer, a stabilizer, a surfactant, a wetting agent, a lubricant, an emulsifier, a preservative, an antioxidant, a covering agent, a glidant, a processing aid, a colorant, an aroma, a flavoring agent or a diluent.

8. The drug according to claim 5, wherein the therapeutic and / or preventive administration routes include administration into the subject's body in various conventional ways through the mouth, cheek, tongue, skin, mucosa, nose, eye, lung, rectum, vagina, and stomach.

Images