A polypeptide with activity of promoting structural and functional recovery after spinal cord injury and application thereof
By developing the spinal cord polypeptide VD11 from the flower frog, the problem of large side effects in existing spinal cord injury treatments has been solved, achieving safe and effective structural and functional recovery after spinal cord injury, which is superior to existing drugs.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-01-18
- Publication Date
- 2026-04-07
AI Technical Summary
Existing treatments for spinal cord injury, such as methylprednisolone, have serious side effects, and gene therapy and stem cell transplantation technologies are not yet mature, lacking safe and effective treatment options.
A polypeptide, VD11, derived from the spinal cord of the amphibian *Stachys pubescens*, with the amino acid sequence VDELWPPWLPC, was developed and prepared through chemical synthesis. It is intended to promote the structural and functional recovery of the spinal cord after injury.
The peptide VD11 significantly promotes structural and functional recovery after spinal cord injury, has low toxicity, significant activity and potential for development into a therapeutic drug, is superior to methylprednisolone, reduces scar formation and neuronal damage, and promotes nerve regeneration.
Smart Images

Figure CN116535482B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of biological medicine, and particularly relates to a polypeptide with activity of promoting recovery of structure and function after spinal cord injury and application thereof. BACKGROUND
[0002] Spinal cord injury (SCI) is a severe central nervous system (CNS) injury, which has the characteristics of high incidence, high disability rate and high mortality. It not only causes considerable physiological and psychological damage, but also brings serious economic burden to patients, families and society.
[0003] At present, there are few effective treatment methods for SCI. The only clinically approved drug for SCI by the Food and Drug Administration (FDA) in the United States is methylprednisolone (MPED), which has definite efficacy and is convenient to use. It can improve the prognosis by inhibiting the immune system and reducing inflammatory response. However, as a corticosteroid drug, MPED can cause serious complications such as osteoporosis, hyperglycemia, gastrointestinal ulcers, electrolyte disturbances, respiratory complications and infections. In addition, although new technologies such as gene therapy and stem cell transplantation show promise in treating SCI, many technical challenges need to be addressed before these therapies can be used in clinical treatment. Therefore, it is still urgent to explore safe, effective and convenient drugs for treating spinal cord injury.
[0004] Polypeptide drugs are increasingly attracting attention in drug research and development due to their high selectivity, high biological activity and low antigenicity. Small molecule polypeptides from amphibians are excellent natural sources of such polypeptides, and some polypeptides have been reported to have significant repair and regeneration activity in damaged tissues. Amphibians have strong spinal cord regeneration ability, for example, four-limbed newts can regenerate their spinal cords throughout their lives, while toads and frogs show spinal cord regeneration before metamorphosis. However, few studies have explored the effect of polypeptides derived from amphibian spinal cord on SCI.
[0005] The present application aims to provide a polypeptide derived from the spinal cord of amphibian flower toad ( Odorranaschmackeri ) with activity of promoting recovery of structure and function after spinal cord injury. SUMMARY
[0006] The first object of the present application is to provide a polypeptide VD11 with activity of promoting recovery of structure and function after spinal cord injury, and another object of the present application is to provide application of the polypeptide VD11.
[0007] A polypeptide VD11 with an amino acid sequence of VDELWPPWLPC.
[0008] Another object of the present application is achieved by the use of the polypeptide VD11 in the preparation of a medicament for treating spinal cord injury.
[0009] The present application has the advantages that the present application provides a new polypeptide VD11, which has significant activity in the recovery of structure and function after spinal cord injury, low toxicity, and has the prospect of developing into a medicament for treating spinal cord injury. The polypeptide of the present application can be prepared by chemical synthesis, and has the advantages of high purity, small molecular weight, safety and reliability, etc. BRIEF DESCRIPTION OF DRAWINGS
[0010] Figure 1 A primary structure diagram of the polypeptide VD11;
[0011] Figure 2 A diagram showing the influence of the polypeptide VD11 of the present application on the secretion levels of NGF and BDNF in vivo and in vitro in BV2 cells; Figure 2 A is the influence of VD11 on the transcription of NGF mRNA in BV2 cells, Figure 2 B is the influence of VD11 on the transcription of BDNF mRNA in BV2 cells; the expression levels of NGF and BDNF are normalized to β-actin. Figure 2 C is the secretion of NGF determined by enzyme-linked immunosorbent assay; Figure 2 D is the secretion of BDNF determined by enzyme-linked immunosorbent assay; Figure 2 E and Figure 2 F are respectively Western blot experimental result diagrams of the influence of the polypeptide VD11 on the secretion of BDNF (n = 4) and NGF (n = 3) after spinal cord injury in rats, with the control group set to 1, and the data represented by the average value ± standard deviation of three independent experiments. *, **, ***, and **** represent p<0.05, 0.01, 0.001, 0.0001 (t-test), respectively;
[0012] Figure 3 A diagram showing the influence of the polypeptide VD11 of the present application on the proliferation of PC12 cells and the length of axon sprouts, Figure 3 A is the influence of VD11 on the viability of PC12 cells, normalized to the control group set to 1 (n = 9); Figure 3 B is a representative immunofluorescence diagram showing the influence of OGD / R and the polypeptide VD11 on cell survival and axon growth in PC12 cells (scale bar: 20 μm), wherein DAPI labels the cell nucleus and Tau-FITC labels the axon; Figure 3 C is a diagram showing the change in the number of PC12 cells;Figure 3 D represents the variation in axon length in PC12 cells. Each group was repeated three times, and each value represents the average number of cells in three random 10× / 0.25 fields of view (n=3). Data are expressed as mean ± SD, and * and ** represent... p< 0.05, 0.01 (t-test);
[0013] Figure 4 This is a graph showing the effect of the present invention's peptide VD11 on hindlimb function recovery after spinal cord injury in rats. Figure 4 A is a graph showing the changes in animal treatment and the number of survivors over time; Figure 4 B shows the changes in BBB motor function scores at different time points in rats in the Vehicle (SCI + saline), MPED (SCI + MPED), and VD11 (SCI + VD11) groups. The data are the average scores from three independent observers. Data are expressed as mean ± standard deviation. *, **, ***, **** represent... p< 0.05, 0.01, 0.001, and 0.0001 (two-way ANOVA analysis); Figure 4 C represents the animal weight 28 days after injury (n=9 in the vehicle group, n=7 in the MPED group, and n=9 in the VD11 group). Data are expressed as mean ± SD, * indicates... p< 0.05;
[0014] Figure 5 This is a diagram showing the effect of the present invention's polypeptide VD11 on the length of spinal cord scar tissue after spinal cord injury in rats. Figure 5 A and Figure 5 B shows representative photographs of the dorsal and ventral sides of the spinal cord 30 days after spinal cord injury; Figure 5 C and Figure 5 D represents the scar length (mm) on the dorsal and ventral sides of the rat spinal cord 30 days post-surgery. Data are expressed as mean ± SD (n=3), with * and ** indicating... p< 0.05, 0.01 ( t- test);
[0015] Figure 6 This describes the effect of the present invention's peptide VD11 on the repair of rat tissue structure. Figure 6 A and Figure 6 B represents representative images of H&E and Nissl staining of rat spinal cord tissue 30 days after spinal cord injury; among them, Figure 6 The second row of images in B is a magnified view of the red box in the first row. The third row of images is a high-magnification representation of a neuron with a diameter of 5mm at the lesion center; red arrows indicate tissue cavities, and black arrows indicate neurons; Figure 6 C and Figure 6D represents the statistical analysis of H&E staining cavity area and Nissl staining neuron number (D) in rat spinal cord tissue 30 days after surgery. Data are expressed as mean ± SD (n=3), and * and ** indicate p<0.05 and 0.01 respectively (t-test).
[0016] Figure 7 This invention relates to the effect of peptide VD11 of the present invention on the regeneration of nerve tissue after SCI in rats. Figure 7 A is a representative image of spinal cord immunofluorescence staining 30 days after spinal cord injury, where DAPI represents cell nuclei, GFAP represents astrocytes, and Tau represents neuronal axons. Figure 7 B and Figure 7 C represents the statistical analysis of cavity area stained by GFAP and Tau, respectively. Data are expressed as mean ± SD (n=3), and * and ** represent the statistical analysis of cavity area stained by GFAP and Tau, respectively. p< 0.05, 0.01 ( t- test). Detailed Implementation
[0017] The present invention will be further described below with reference to embodiments, but this is not intended to limit the present invention in any way. Any modifications or substitutions made based on the teachings of the present invention shall fall within the protection scope of the present invention.
[0018] The present invention discloses a polypeptide VD11, the amino acid sequence of which is VDELWPPWLPC, as shown in SEQ ID NO.1.
[0019] The present invention also provides the application of the peptide VD11 in the preparation of drugs for treating spinal cord injury.
[0020] The present invention further provides a pharmaceutical composition comprising the polypeptide VD11 and a pharmaceutically acceptable excipient.
[0021] Example 1: Screening and Synthesis of Peptide VD11
[0022] Clean the flower frog with deionized water. Odorranaschmackeri Afterwards, the spinal cord was destroyed and the animal was euthanized. The spinal cord was removed and immediately ground in liquid nitrogen. After grinding, it was placed in RNA ISO for total RNA extraction. The mRNA was purified using an Absolutely mRNA Purification Kit (Stratagene, Canada). First and second strand cDNAs were synthesized using SMART technology, and cDNAs encoding biological precursors from the frog spinal cord were screened from the library. Figure 1The signal peptide region was encoded using specific 5' PCR primers (5'-CCAAA(G / C)ATGTTCACC(T / A)TGAAGAAA-3') and 3' PCR primers (5'-ATTCTAGAGGCCGAGGCGGCCGACATG-3'). PCR products were recovered using a DNA gel extraction kit and finally sequenced using Illumina MiSeq. The main steps are as follows: 50-100 ng of PCR product was amplified again for 3 cycles using KAPA HiFi hot-start premix. Primers F (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT - specific 5' PCR primer) and primer R (CAAGCAGAAGACGGCATACGAGATCTCAGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT - specific 3' PCR primer) were injected. Amplicons were purified using Agencourt AMPure XP beads (Beckman Coulter Diagnostics, Inc., USA) according to the instructions and quantified using a Qubit 2.0 fluorometer (Life Invitrogen, Inc., Carlsbad, CA, USA). The purified amplicons were pooled into equimolecular-weight amplicons and paired for sequencing (2×300) on the Illumina MiSeq platform according to the standard protocol of Universal Biotechnology (Shanghai, China). The adapter sequence was removed from the original file using Trim Galore software. Paired-end readings were performed using FLASH-1.2.11 software, meeting the following conditions: overlap between 10 bp and 300 bp, and a maximum mismatch rate of 0.1%. A fastq format file was then obtained, which was converted to fasta format, and repeating sequences were removed using Fastx-toolkit software. The results are as follows. Figure 1 As shown, the full-length cDNA sequence is 221 bp, encoding 58 amino acid residues, and the mature peptide sequence is “VDELWPPWLPC”. Figure 1 (Identified in italics and underscores), named VD11.
[0023] The amino acid sequence of the peptide VD11 is VDELWPPWLPC. It was artificially synthesized by Wuhan Bioyeargene Biotechnology Co., Ltd. (Wuhan, China). The molecular weight is 1357 Da and the purity is >95%.
[0024] Example 2: Detection of peptide VD11 activity
[0025] Two types of cells were used in this experiment:
[0026] BV2 and PC12 cells were cultured in Dulbecco's Modified Eagle Medium / Nutrient Mixture F-12 (DMEM-F12, GIBCO, Thermo Fisher Scientific, Waltham, MA, USA) with 10% fetal bovine serum (FBS, GIBCO, Thermo Fisher Scientific, Waltham, MA, USA), 0.1 mg / mL streptomycin, and 100 U / mL penicillin at 37°C and 5% CO2. The medium was changed daily, and cells were passaged when the culture flasks reached 70-80% confluence.
[0027] In this embodiment, two models were established for the experiment:
[0028] Lipopolysaccharides (LPS)-induced inflammation model: BV2 cells were fed at a rate of 1×10⁻⁶. 6 Cells were seeded in 6-well plates and allowed to adhere before experiments. BV2 cells were stimulated with 1 mg / mL LPS for 6 hours. The culture medium was then aspirated, and serum-free DMEM-F12 medium and serum-free DMEM-F12 medium containing VD11 (concentrations of 1, 10, and 100 nM, respectively) were added. Cells were collected after 12 hours for subsequent experiments (qPCR and ELISA).
[0029] Oxygen-glucose deprivation / reoxygenation (OGD / R) model: PC12 cells were added to serum-free and glucose-free medium and incubated in a tri-gas incubator (37℃, 90% N2, 5% O2, 5% CO2) for 4 hours. The cells were then removed, and the medium was replaced with DMEM-F12 (with or without added VD11 peptide), and the PC12 cells were cultured in a conventional incubator (5% CO2, 95% air) for 24 hours. Cells were divided into 8 groups: control group (no special treatment), 3 VD11 groups (treated with 1, 10, and 100 nM VD11, respectively), model group (OGD / R model), and 3 Model + VD11 groups (treated with 1, 10, and 100 nM VD11 after OGD / R modeling, respectively). Each group had 3 replicates.
[0030] In this embodiment, experimental data are expressed as mean ± standard deviation (SD). Results were analyzed using GraphPad Prism 8.0 software (California, USA). BBB exercise scores were analyzed using multivariate analysis of variance (ANOVA). Other data were analyzed using... t The test results were analyzed. p< A value of 0.05 is considered statistically significant.
[0031] I. Effects of peptide VD11 on the secretion of NGF and BDNF in BV2 cells in vitro and in vivo
[0032] 1. qPCR detection of NGF and BDNF secreted by BV2 cells stimulated by LPS and treated with VD11.
[0033] Total RNA was extracted from BV2 cells using a total RNA extraction kit (Tiangen Biotech, Beijing, China). RNA purity and concentration were determined using a microspectrophotometer (Thermo Fisher, USA). cDNA was reverse transcribed using SureScript (GeneCopoeia, Guangzhou, China) at a total volume of 20 μL. Transcription was performed at 25°C for 5 min, 42°C for 15 min, and 85°C for 5 min, followed by storage at 4°C. PCR amplification was performed using a BlazeTaq assay kit (GeneCopoeia, Guangzhou, China). Primers for β-actin, NGF, and BDNF were obtained from GeneCopoeia in Guangzhou. qPCR was performed using a PCR instrument (Life Technologies, THERMOs, USA). -ΔΔCt The method was used to convert β-actin to 1, and the mRNA expression level was calculated.
[0034] 2 -ΔΔCt The specific calculation method is as follows:
[0035] 1) Calculate ΔCt: ΔCt = Ct of the gene to be tested - Ct of the internal reference gene
[0036] 2) Calculate ΔΔCt: ΔΔCt = ΔCt of the gene to be tested - ΔCt of the control group
[0037] 3) Calculate 2 -ΔΔCt : Calculate 2 using Excel -ΔΔCt The specific formula is POWER(2, -ΔΔCt).
[0038] Result: As Figure 2 A and Figure 2As shown in B, these changes were most pronounced at a VD11 concentration of 100 nM. In normal BV2 cells, the mRNA expression level of NGF in the VD11 (100 nM) group was 260 times that of the control group (n=9, p <0.0001), the mRNA expression level of BDNF was 30 times that of the control group (n=9, p <0.001). In BV2 cells stimulated with LPS, the mRNA expression levels of NGF and BDNF were 1.29 times that of the control group (n=9, p <0.0001) and 1.66 times (n=9, p <0.0001). The mRNA expression level of NGF in the LPS+VD11 (100 nM) group was 262 times that of the control group (n=9, p <0.0001), the mRNA expression level of BDNF was 90 times that of the control group (n=9, p <0.0001). This indicates that VD11 can significantly promote the mRNA transcription of NGF and BDNF in normal and LPS-stimulated BV2 cells in a dose-dependent manner.
[0039] 2. ELISA method for detecting changes in NGF and BDNF levels after VD11 treatment.
[0040] BV2 cells were digested with trypsin and centrifuged at 1000 rpm for 20 min to obtain the supernatant. The concentrations of NGF and BDNF in the supernatant were measured using an ELISA kit (Neobio Science, Shanghai, China) according to the manufacturer's instructions.
[0041] Result: As Figure 2 C and Figure 2 As shown in Figure D, in normal BV2 cells, the expression level of NGF in the VD11 (100 nM) group was 1.13 times that of the control group (n=9, p <0.0001), the expression level of BDNF was 1.23 times that of the control group (n=9, p <0.001). In BV2 cells stimulated with LPS, the expression levels of NGF and BDNF were 1.52 times and 2.31 times that of the control group, respectively (n=9, ...). p <0.0001). The expression level of BDNF in the LPS+VD11 (100 nM) group was 3.04 times that of the control group, which was significantly higher than that in the LPS group (n=9). p <0.0001), the expression level of NGF was 2.60 times that of the control group, which was significantly higher than that of the LPS group (n=9, p <0.0001). This indicates that VD11 can promote the secretion of NGF and BDNF in BV2 cells in a dose-dependent manner.
[0042] 3. Detection of the promoting effect of VD11 on the secretion of BDNF and NGF in vivo by Western blotting.
[0043] Experimental Methods: Normal SD rats and rats 30 days after SCI were perfused with physiological saline. Spinal cord tissue was collected, ground in liquid nitrogen, and placed in centrifuge tubes. Pre-chilled lysis buffer containing RIPA and benzoyl sulfonyl fluoride (PMSF, Meilun Biotechnology, Dalian, China) was added to the centrifuge tubes, and the tubes were incubated on ice for 30 min. The tubes were then centrifuged at 12,000 × g for 15 min at 4 °C. After protein quantification using the BCA method, the protein supernatant was mixed with 2X loading buffer in equal proportions and boiled at 95 °C for 15 min to denature the protein. The denatured protein was then allowed to cool naturally and stored at -20 °C.
[0044] After protein extraction, the effect of VD11 on protein expression was verified by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting (WB).
[0045] Result: As Figure 2 E and Figure 2 F showed that the NGF / β-actin ratio in the normal group rats was 0.53±0.08 (n=3).
[0046] The SCI group had a value of 0.73 ± 0.09 (n = 3), which was significantly higher than that of the normal group. p <0.05); while the SCI+VD11 group rats had a value of 0.98±0.04 (n=3), which was significantly higher than the SCI group ( p <0.01). The BDNF / β-actin ratio was 0.14±0.06 in the normal group (n=4); 0.82±0.11 in the SCI group (n=4), significantly higher than the normal group (p<0.0001); while the ratio in the SCI+VD11 group was 1.02±0.10 (n=4), significantly higher than the SCI group (p<0.0001). p <0.05). This indicates that, compared to normal rats, the secretion of NGF and BDNF increased after SCI. Furthermore, rats treated with SCI+VD11 showed increased NGF and BDNF secretion compared to the SCI-only group.
[0047] The above results indicate that VD11 can promote the secretion of NGF and BDNF both in vivo and in vitro.
[0048] II. Effects of VD11 on PC12 cells and cells modeled by OGD / R
[0049] 1. Evaluation of the effect of VD11 on PC12 cell viability using the MTS assay
[0050] PC12 cells are derived from rat adrenal medullary pheochromocytomas and their membranes contain NGF receptors. Under physiological NGF stimulation, PC12 cells cease division, axonal germination occurs, and they differentiate into cells with sympathetic neuronal characteristics, commonly used in in vitro studies of nervous system diseases. This invention aims to investigate the effects or toxicity of VD11 on PC12 cells and cells modeled in the OGD / R model. The MTS method was used to assess PC12 cell viability. Specifically, in the OGD / R model, the concentrations of CO2 and O2 in the three-gas incubator were reduced to 5% by introducing N2, using sugar-free medium and without added FBS, thereby creating a hypoxic environment within the cells to simulate ischemic-hypoxic neuronal injury in vivo. The specific method is as follows: PC12 cells were seeded in 96-well plates at a density of 1 × 10⁶ cells / well. 4 Cells were cultured overnight in 100 μL / well medium. An OGD / R model was then established. After adding peptide VD11 (VD11 group) for 24 h, MTS (20 μL / well) was added, and the cells were incubated at 37°C in a 5% CO2 incubator for 4 h. Finally, absorbance was measured at 490 nm using a microplate reader, and cell viability was expressed as a percentage.
[0051] Result: As Figure 3 As shown, cell viability increases with increasing drug concentration. With the control group set at 100%, compared to the control group, the cell viability of the 1, 10, and 100 nM VD11 groups was significantly increased, with cell viability of 111.97% ± 5.07%, respectively. p< 0.001), 113.67%±6.37% (n=9, p< 0.001), 120.71%±5.05% (n=9, p< 0.0001). After OGD / R modeling, cell viability decreased to 68.72%±7.72% compared to the Control group, indicating successful modeling. Compared with the Model group, after treatment with 1, 10, and 100 nM VD11, cell viability was 71.67%±7.38% (n=9, ns), 76.25%±4.27% (n=9, ns), and 100 nM VD11, respectively. p< 0.05), 82.06%±7.62% (n=9, p< 0.01) Figure 3 A).
[0052] 2. Immunofluorescence staining method was used to evaluate the effect of VD11 on axonal length of PC12 cells.
[0053] Results: After OGD / R modeling, the number of PC12 cells and axon length decreased, while VD11 rescued PC12 cells whose viability had decreased due to OGD / R stimulation. Figure 3BD). Microscopic observation after fluorescent staining showed that, compared with normally cultured cells (Control group, cell count per 10× / 0.25 field of view, axon length set to 100%), the cell count 48 h after OGD / R (Model group) was 65.33±12.50 / 10× / 0.25 field of view; n=3. p< 0.01) Axon length (20.69%±5.51%; n=3, p< The cell count was significantly reduced (0.01). However, compared with the Model group, the cell count in the Model+VD11 (100 nM) group was 115.00±16.09 after 48 h (n=3). p< 0.01) and axon length (66.79%±6.90%; n=3, p< 0.01) Significantly increased ( Figure 3 B and Figure 3 C).
[0054] The above results indicate that VD11 can promote the proliferation and axonal elongation of PC12 cells after hypoxic injury.
[0055] III. Effects of VD11 on hindlimb function recovery, tissue repair, and nerve tissue regeneration after spinal cord injury in rats
[0056] Experimental Methods: Female Sprague-Dawley (SD) rats were randomly divided into three groups: Vehicle, MPED, and VD11. T10 total spinal cord transect was performed under sodium pentobarbital anesthesia. An incision was made centered at T10, exposing the muscle layer, followed by T10 laminectomy. The spinal cord was then completely severed using ophthalmic scissors, and a subcutaneous catheter was inserted into the subdural space to facilitate subsequent intraspinal drug administration. The incision was then sutured in layers. Before anesthesia recovery, all rats were subcutaneously injected with 0.4 mL of ketoprofen (10 mg / mL) for analgesia and placed on a heating pad until complete recovery. Penicillin (200,000 units / 100g, twice daily intramuscular injection) was administered for 7 days post-surgery to combat infection. Rats in the Vehicle, MPED, and VD11 groups were administered 0.9% saline, MPED (30 mg / kg), and VD11 peptide (0.1 mg / kg) intraspinally, respectively, twice daily. Artificial urination was assisted three times daily. All rats had normal limb function before and after surgery (21.00±0.00), but hind limb paralysis occurred after surgery, with the lowest hind limb function score on 3 days after surgery.
[0057] 1. Effect of VD11 on the recovery of hindlimb function after spinal cord injury in rats
[0058] The recovery of motor function was measured 4 weeks after surgery based on the BBB score.
[0059] Results: 28 days after spinal cord injury, the VD11 score increased to 15.15±0.31 (n=9, p< The value was 0.0001, significantly higher than that in the Vehicle group (10.96 ± 0.39, n = 9). p< 0.001), MPED group (13.79±0.22, n=7, p< 0.01). The above results indicate that VD11 significantly promotes hindlimb function recovery, with better efficacy than MPED. Furthermore, the mortality rate of rats in the VD11 group and Vehicle group was similar at 28 days post-surgery (both 40.0%), significantly lower than that in the MPED group (64.7%). At 28 days post-injury, there was no significant difference in body weight between the VD11 group and Vehicle group, while the MPED group showed a significant decrease in body weight (n=9, ...). p< 0.05), indicating that VD11 is less toxic to rats than MPED ( Figure 4 C).
[0060] 2. The repair effect of VD11 on spinal cord injury tissues in rats
[0061] Thirty days post-surgery, rat hearts were perfused with 0.9% saline under anesthesia, and the entire spine was removed and fixed overnight with 4% paraformaldehyde. The spinal cord was carefully removed from the spine, taking care to preserve the integrity of the tissue structure, and photographs were taken.
[0062] Result: As Figure 5 As shown, the presence of scars on the ventral and dorsal sides of the spinal cord indicates that the transverse incision was successful. Figure 5 (AB). The length of the dorsal spinal cord scar in group VD11 (2.33±0.58, n=3) was significantly shorter than that in the control group (6.83±1.04, n=3). p< 0.01) and MPED group (5.83±1.89, n=3, p< 0.01) Figure 5 A and Figure 5 C). The length of the ventral spinal cord scar in the VD11 group (1.50±0.87, n=3) was also significantly shorter than that in the control group (5.33±0.58, n=3). p< 0.01), MPED group (4.33±1.89, n=3, p< 0.05), no significant difference ( Figure 5 B and Figure 5 D). Therefore, compared with rats treated with saline or MPED, rats treated with VD11 had less scarring and improved spinal cord healing.
[0063] like Figure 6 As shown, based on H&E staining of spinal cord tissue, compared with the control group, the VD11 group showed a significant reduction in spinal cord cavitation. Figure 6A). Nissl staining showed that the spinal cord tissue cavitation rate was (0.10±0.04, n=3) compared to the Vehicle group (set as 1, 1.00±0.29, n=3). p< 0.01) and MPED group (0.41±0.15, n=3, p< The number of surviving neurons in the VD11 group (9.67±3.06, n=3) was significantly reduced (0.05), and the number of surviving neurons in the VD11 group (9.67±3.06, n=3) was significantly increased compared to the Vehicle group (2.00±1.00, n=3) and the MPED group (3.33±1.53, n=3). Figure 6 B. Figure 6 C and Figure 6 D), from Figure 6 As shown in line B, the third row indicates that some neurons remained in the VD11 group, while almost none remained in the control group and the MPED group. This suggests that VD11 has a strong activity in promoting SCI repair.
[0064] 3. Effects of VD11 on nerve tissue regeneration after spinal cord injury in rats
[0065] Immunofluorescence labeling of astrocytes and neuronal axons was performed using GFAP and Tau, respectively, to assess neural tissue regeneration at the site of spinal cord injury in rats. Spinal cord tissue was dehydrated sequentially with 10%, 20%, and 30% sucrose. After embedding in OCT embedding medium, the spinal cord was sectioned into 8 μm thick tissue sections using a cryostat (Leica, Germany). The tissue sections were washed three times with PBS, punched with 0.3% Triton-100-PBS (PBST), and then treated with blocking buffer containing 5% normal goat serum and PBST at room temperature for 1 h for immunofluorescence staining and labeling. The tissue sections were then incubated overnight at 4°C with the following primary antibodies: rabbit anti-tau (1:200, Genetex) for labeling neuronal axons and mouse anti-glial fibrillary acidic protein (GFAP; 1:20, CellSignaling Inc.) for labeling astrocytes. After rinsing with PBS, sections were incubated with the following secondary antibodies at room temperature in the dark for 1 hour: Cy3-goat anti-rabbit (1:200, Proyrintech) to make Tau appear red, and FITC-goat anti-rat (1:200, Proyrintech) to make GFAP appear green. Sections were rinsed again with PBS, stained, and mounted with DAPI (to make cell nuclei appear blue) in the dark. In addition, PC12 cells were also labeled with Tau in the fluorescence staining experiment. Tau-positive areas indicate axonal growth, and control data were normalized to 100%. Data are expressed as 10 × 0.25 units per field.
[0066] Result: As Figure 7As shown in Figure A, 30 days after SCI, typical GFAP-positive astrocytes and Tau-positive neuronal axons were observed at the lesion site in the VD11 group. Astrocyte regeneration and axonal elongation were significantly more frequent in the VD11 group than in the vehicle and MPED groups. In particular, large cavities were observed in the center of the lesion, whereas GFAP was almost absent in the vehicle and MPED groups. + Astrocytes and Tau + Axons. The central cavity area of the lesion site was analyzed in each group, with the vehicle group set at 100%. The GFAP cavity area in the VD11 group (23.79%±8.90%) was significantly lower than that in the control group (100.00%±12.82%, n=3). p< 0.01) and MPED group (47.16%±10.57, n=3, p< 0.05) Figure 7 B). The Tau cavity area in group VD11 (11.38%±4.82%) was significantly lower than that in the control group (100.00%±22.39%, n=3). p< 0.01) and MPED group (49.99%±10.25%, n=3, p< 0.01) Figure 7 C). This indicates that VD11 can reduce nerve damage after spinal cord injury and promote nerve regeneration.
[0067] In summary, MPED has a long history of clinical application in the treatment of acute spinal cord injury (SCI). It can improve the prognosis of SCI patients by suppressing the immune system, reducing the inflammatory response, and decreasing the frequency of secondary infections. Although the use of MPED is currently controversial, and some animal studies have questioned its neuroprotective effects, the use of locally delivered MPED or MPED delivered via specific carriers can significantly enhance motor function after SCI by reducing the side effects of glucocorticoids. Therefore, MPED is still used as a positive control drug in some SCI experiments. In this invention, a low dose of MPED was used in the spinal canal of the positive control group, and the results showed that this treatment enhanced motor function in rats after spinal cord injury. 28 days after spinal cord injury, the BBB motor score of the VD11 group was significantly higher than that of the control group and the MPED group, and the mortality rate and weight loss of the VD11 group were lower than those of the MPED group. In addition, compared with MPED, VD11 has a more positive effect on the recovery of motor function after spinal cord injury and has fewer toxic side effects. Subsequent histological examination also showed that less scarring and cavity formation were observed in the VD11 group both macroscopically and microscopically. Furthermore, the dosage of MPED is 300 times that of VD11, indicating that VD11 has superior activity at low doses and therefore higher efficiency.
Claims
1. A polypeptide VD11 with activity promoting structural and functional recovery after spinal cord injury, the amino acid sequence of which is VDELWPPWLPC.
2. The use of the polypeptide VD11 of claim 1 in the preparation of a drug for treating spinal cord injury.
3. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the polypeptide VD11 of claim 1 and a pharmaceutically acceptable excipient.
Citation Information
Patent Citations
Systemic administration of peptides for treatment of spinal cord injury and / or remyelination
CN114555630A
Recombinant decoy receptor 3 for treating spinal cord injury
US20170051038A1