Application of lncRNA PRDM7-1:2 as a biomarker in the development of screening reagents for tuberculosis patients

By detecting the expression level of lncRNA PRDM7-1:2 in peripheral blood mononuclear cells, and using quantitative real-time PCR technology and setting a threshold, the problems of low positive rate and long culture time in existing tuberculosis diagnostic methods have been solved, enabling rapid and accurate tuberculosis screening and diagnosis.

CN116574799BActive Publication Date: 2026-06-26BEIJING CHEST HOSPITAL CAPITAL MEDICAL UNIV +1

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
BEIJING CHEST HOSPITAL CAPITAL MEDICAL UNIV
Filing Date
2023-05-26
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Existing tuberculosis diagnostic methods suffer from low positive rates and long culture times, making rapid and accurate diagnosis difficult, especially in the absence of sputum samples, which leads to challenges in clinical diagnosis of tuberculosis.

Method used

Using lncRNA PRDM7-1:2 as a biomarker, a kit for screening and diagnosis was developed by detecting the relative expression level in peripheral blood mononuclear cells of subjects and using real-time PCR technology with a threshold of 0.001008514.

Benefits of technology

It improves the accuracy and efficiency of tuberculosis diagnosis, especially in the absence of sputum samples, enabling rapid screening and diagnosis of tuberculosis, and has high diagnostic performance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The application discloses application of lncRNA PRDM7-1:2 as a marker in development of a tuberculosis patient screening reagent. The application provides application of a substance for detecting lncRNA PRDM7-1:2 or a characteristic fragment of lncRNA PRDM7-1:2 in preparation of a kit for screening tuberculosis patients or in preparation of a kit for diagnosing or assisting in diagnosing tuberculosis. The inventors have carried out whole genome RNA chip screening, completed lncRNA spectrum screening and comparative analysis in PBMCs from two types of people, i.e. tuberculosis patients and healthy people, and preliminarily obtained a large number of differentially expressed lncRNAs. The inventors have carried out qPCR verification on the preliminarily obtained lncRNAs in another independent sample, and screened two lncRNAs. The inventors have analyzed the performance of the two lncRNAs as separate markers in a new population. The application is very important for rapid diagnosis of tuberculosis and early treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of medical diagnostics, specifically involving the application of lncRNA PRDM7-1:2 as a biomarker in the development of screening reagents for tuberculosis patients. Background Technology

[0002] Tuberculosis (TB) is a chronic infectious disease caused by Mycobacterium tuberculosis (M.tb). It is characterized by its widespread prevalence and high mortality rate, affecting approximately one-quarter of the world's population, making it a pressing public health issue. Achieving rapid and accurate diagnosis of TB is crucial for alleviating public health pressures. Currently, the gold standard for TB diagnosis is etiological analysis; among these methods, smear testing is the most basic and, while simple and reliable, suffers from a low positive rate in practice. Culture methods, although offering slightly improved sensitivity, suffer from long culture times and low positive rates. With technological advancements, molecular biological detection techniques targeting Mycobacterium tuberculosis are routinely applied clinically, increasing the TB detection rate to approximately 60%. However, nearly half of patients still cannot receive an accurate diagnosis due to a lack of etiological evidence or sputum samples, thus diagnosing TB remains challenging in clinical practice. In order to cut off the source of infection and transmission route as early as possible to avoid the spread of M.tb and achieve rapid diagnosis of tuberculosis, the WHO also advocates the development of blood / body fluid molecular detection technology based on host "non-sputum" specimens. Therefore, it is necessary to vigorously carry out the identification and verification of new biomarkers from the perspective of the host to improve the diagnostic efficiency of tuberculosis.

[0003] Previous studies have found that after *M. tb.* infects the host, non-coding RNAs (ncRNAs) also participate in the anti-infection process, with lncRNAs accounting for 80% of the ncRNAs. lncRNAs are non-protein-coding RNAs composed of more than 200 nucleotides. They can exert biological functions at the transcriptional, post-transcriptional, and translational stages by binding to various biomolecules. Previous research results have shown that they are involved in the pathophysiological processes of various diseases, including infectious diseases. Although their specific mechanisms of action require further investigation and clarification, there is no doubt that lncRNAs play a crucial regulatory role in cellular function and disease development, suggesting their potential as diagnostic markers. Summary of the Invention

[0004] The purpose of this invention is to provide lncRNA. Application of PRDM7-1:2 as a biomarker in the development of screening reagents for tuberculosis patients.

[0005] This invention provides a system for screening tuberculosis patients, including a detection system and an interpretation system;

[0006] The detection system is used to detect the relative expression levels of lncRNA PRDM7-1:2 or a characteristic fragment of lncRNA PRDM7-1:2 in peripheral blood mononuclear cells (PBMCs) of the subject.

[0007] The interpretation system is used to convert the relative expression levels of lncRNA PRDM7-1:2 or characteristic fragments of lncRNA PRDM7-1:2 in the PBMCs of subjects into interpretation results, which refer to tuberculosis patients or healthy individuals (non-tuberculosis patients).

[0008] The method for converting the relative expression levels of lncRNA PRDM7-1:2 or the characteristic fragment of lncRNA PRDM7-1:2 in the subjects' PBMCs into interpretation results is as follows: a relative expression level greater than or equal to a threshold is used to determine tuberculosis patients, and a relative expression level less than a threshold is used to determine healthy individuals (non-tuberculosis patients).

[0009] Specifically, the threshold is 0.001008514.

[0010] The present invention also provides a system for diagnosing or assisting in the diagnosis of tuberculosis, including a detection system and an interpretation system;

[0011] The detection system is used to detect the relative expression levels of lncRNA PRDM7-1:2 or a characteristic fragment of lncRNA PRDM7-1:2 in the subject's PBMCs;

[0012] The interpretation system is used to convert the relative expression levels of lncRNA PRDM7-1:2 or a characteristic fragment of lncRNA PRDM7-1:2 in the subject's PBMCs into interpretation results, which indicate whether tuberculosis has occurred or not.

[0013] The method for converting the relative expression levels of lncRNA PRDM7-1:2 or the characteristic fragment of lncRNA PRDM7-1:2 in the subjects' PBMCs into interpretation results is as follows: a relative expression level greater than or equal to a threshold is used to determine the occurrence of tuberculosis, and a relative expression level less than a threshold is used to determine the absence of tuberculosis.

[0014] Specifically, the threshold is 0.001008514.

[0015] The present invention also provides a kit comprising substances for detecting lncRNA PRDM7-1:2 or a characteristic fragment of lncRNA PRDM7-1:2;

[0016] The kit is intended for use as follows (a) or (b):

[0017] (a) Screening for tuberculosis patients;

[0018] (b) Diagnosis or auxiliary diagnosis of tuberculosis.

[0019] The kit also includes a carrier containing the following information:

[0020] (1) Detect the relative expression levels of lncRNA PRDM7-1:2 or characteristic fragments of lncRNA PRDM7-1:2 in the subjects' PBMCs;

[0021] (2) Those with a relative expression level greater than or equal to the threshold are judged as tuberculosis patients, and those with a relative expression level less than the threshold are judged as healthy individuals (non-tuberculosis patients).

[0022] Specifically, the threshold is 0.001008514.

[0023] The kit also includes a carrier containing the following information:

[0024] (1) Detect the relative expression levels of lncRNA PRDM7-1:2 or characteristic fragments of lncRNA PRDM7-1:2 in the subjects' PBMCs;

[0025] (2) A relative expression level greater than or equal to the threshold is considered as tuberculosis, and a relative expression level less than the threshold is considered as tuberculosis.

[0026] Specifically, the threshold is 0.001008514.

[0027] This invention provides the use of a substance for detecting lncRNA PRDM7-1:2 or a characteristic fragment of lncRNA PRDM7-1:2 in the preparation of a kit for screening patients with tuberculosis.

[0028] The present invention also provides the use of lncRNA PRDM7-1:2 or a characteristic fragment of lncRNA PRDM7-1:2 as a biomarker in the development of kits for screening patients with tuberculosis.

[0029] The present invention also provides the use of a substance for detecting lncRNA PRDM7-1:2 or a characteristic fragment of lncRNA PRDM7-1:2 in the preparation of a kit for the diagnosis or auxiliary diagnosis of tuberculosis.

[0030] The present invention also provides the use of lncRNA PRDM7-1:2 or a characteristic fragment of lncRNA PRDM7-1:2 in the development of kits for the diagnosis or auxiliary diagnosis of tuberculosis.

[0031] The substances described above for detecting characteristic fragments of lncRNA PRDM7-1:2 or lncRNA PRDM7-1:2 include primer pairs for detecting characteristic fragments of lncRNA PRDM7-1:2 or lncRNA PRDM7-1:2.

[0032] The substances described above for detecting lncRNA PRDM7-1:2 or the characteristic fragments of lncRNA PRDM7-1:2 also include primer pairs for detecting the internal reference gene.

[0033] Specifically, detecting the characteristic fragments of lncRNA PRDM7-1:2 or lncRNA PRDM7-1:2 refers to detecting the relative expression levels of the characteristic fragments of lncRNA PRDM7-1:2 or lncRNA PRDM7-1:2 in human PBMCs.

[0034] Specifically, detecting the characteristic fragments of lncRNA PRDM7-1:2 or lncRNA PRDM7-1:2 refers to detecting the relative expression levels of the characteristic fragments of lncRNA PRDM7-1:2 or lncRNA PRDM7-1:2 in human PBMCs by quantitative real-time PCR.

[0035] Specifically, lncRNA PRDM7-1:2 is shown in Sequence 1 of the sequence listing.

[0036] Specifically, the characteristic fragment of lncRNA PRDM7-1:2 is shown at positions 2797-2858 in Sequence 1 of the sequence listing.

[0037] Specifically, the primer pair used to detect the characteristic fragment of lncRNA PRDM7-1:2 consists of the primers shown in Sequence 3 of the sequence listing and the primers shown in Sequence 4 of the sequence listing.

[0038] Specifically, any of the screening methods described above involves screening healthy individuals (non-tuberculosis patients).

[0039] Specifically, any of the internal reference genes mentioned above is the GAPDH gene.

[0040] Specifically, the primer pair used to detect the internal reference gene consists of the primers shown in Sequence 7 of the sequence listing and the primers shown in Sequence 8 of the sequence listing.

[0041] The method for calculating relative expression levels is as follows:

[0042] △Ct=Ct lncRNA PRDM7-1:2 -Ct 内参基因 ;

[0043] Relative expression level = 2 -△Ct .

[0044] Specifically, any of the tuberculosis cases mentioned above refers to pulmonary tuberculosis.

[0045] To identify potentially differentially expressed lncRNAs for tuberculosis diagnosis and to reveal their involvement in the pathophysiological processes of tuberculosis development, the inventors of this invention conducted a genome-wide RNA microarray screening, completing a comparative analysis of lncRNA expression profiles in PBMCs from two populations: tuberculosis patients and healthy individuals. A large number of differentially expressed lncRNAs were initially obtained.

[0046] Furthermore, the inventors performed qPCR verification on the initially obtained lncRNAs in other independent samples and screened two lncRNAs (lncRNA CHI3L1-2:3 and lncRNA PRDM7-1:2). The intergroup expression trends of these two lncRNAs were consistent with the microarray results, and the expression of these two lncRNAs in the tuberculosis patient group was significantly higher than that in the healthy group, with statistically significant differences.

[0047] Furthermore, the inventors analyzed the diagnostic performance of the two lncRNAs as individual biomarkers in a new population. Receiver operating characteristic (ROC) curve analysis showed that the areas under the ROC curve for both lncRNAs used independently for tuberculosis diagnosis were both greater than 0.70, with lncRNA PRDM7-1:2 showing significantly better performance as a diagnostic biomarker than lncRNA CHI3L1-2:3. This invention is crucial for the rapid diagnosis and early treatment of tuberculosis. Attached Figure Description

[0048] Figure 1 The relative expression levels of the two lncRNAs in the PBMCs of all subjects in Example 4.

[0049] Figure 2 The ROC curves for Example 4 show the independent use of two lncRNAs as diagnostic markers. Detailed Implementation

[0050] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0051] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. Fc (fold change): fold change.

[0052] Receiver operating characteristic (ROC) curve: A curve plotted with sensitivity on the ordinate and (1-specificity) on the abscissa. The area under the ROC curve (AUC) is between 1.0 and 0.5. When AUC > 0.5, the closer the AUC is to 1, the better the diagnostic effect. An AUC between 0.5 and 0.7 indicates low accuracy. An AUC between 0.7 and 0.9 indicates some accuracy. An AUC ≥ 0.9 indicates high accuracy. An AUC = 0.5 indicates that the diagnostic method is completely ineffective and has no diagnostic value. An AUC < 0.5 is unrealistic and rarely occurs in practice.

[0053] All tuberculosis patients in the examples are pulmonary tuberculosis patients.

[0054] Inclusion criteria for pulmonary tuberculosis patients: Patients with clinical manifestations (symptoms and signs) of tuberculosis according to the diagnostic criteria for pulmonary tuberculosis (WS 288-2017) and with imaging features of tuberculosis and meeting at least one of the following conditions: ① positive sputum culture for Mycobacterium tuberculosis; ② positive sputum acid-fast staining; ③ positive sputum Xpert MTB / RIF test; ④ pathological examination of lung biopsy reveals Mycobacterium tuberculosis and / or positive acid-fast staining and / or caseous granulomatous lesions.

[0055] Exclusion criteria for pulmonary tuberculosis patients (meeting any one or more of the following): ① having received anti-tumor treatment or having received anti-tuberculosis treatment for more than 2 weeks; ② having other immune diseases; ③ being under 18 years old; ④ being pregnant or lactating; ⑤ having infectious diseases such as HIV or syphilis; ⑥ having a history of tuberculosis or tuberculosis exposure.

[0056] Inclusion criteria for healthy individuals: no obvious clinical symptoms related to respiratory diseases, normal imaging examinations, no history of tuberculosis or contact with tuberculosis, and negative T-cell test for tuberculosis infection.

[0057] Example 1: Using high-throughput microarray chips for preliminary screening of biomarkers that can be used for tuberculosis patient screening.

[0058] Test samples: 19 peripheral blood samples from 19 tuberculosis patients (referred to as TB group samples) and 9 peripheral blood samples from 9 healthy individuals (referred to as HC group samples). Each test sample was subjected to steps 1 through 5.

[0059] 1. Obtain PBMCs from the test sample.

[0060] 2. RNA extraction

[0061] Total RNA was extracted using the miRNeasy Mini Kit (Cat#217004, QIAGEN, GmBH, Germany) following the instructions. The extracted total RNA was then subjected to electrophoresis and quality control using an Agilent Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, US) before being used.

[0062] 3. cRNA markers

[0063] Total RNA was amplified and labeled using the Agilent Expression Profiling Microarray Kit (Cat.#5190-2305, Agilent Technologies, Santa Clara, CA, US) following the manufacturer's instructions. The labeled cRNA was then purified using the RNeasy minikit (Cat.#74106, QIAGEN, GmBH, Germany).

[0064] 4. Chip hybridization

[0065] Following the standard hybridization procedure and kit provided with the Agilent expression profiling chip, the GeneExpression Hybridization Kit (Cat.#5188-5242, Agilent Technologies, Santa Clara, CA, US) was used for hybridization at 65°C and 10 rpm for 17 hours in a rolling hybridization oven (Cat.#G2545A, Agilent Technologies, Santa Clara, CA, US). The hybridization cRNA loading was 1.65 μg. The chips were then washed in staining dishes (Cat.#121, Thermo Shandon, Waltham, MA, US) using the GeneExpression Wash Buffer Kit (Cat.#5188-5327, Agilent Technologies, Santa Clara, CA, US).

[0066] 5. Chip scanning

[0067] The hybridized chip was scanned using an Agilent Microarray Scanner (Cat.#G2565CA, Agilent Technologies, Santa Clara, CA, US), with the software set to Dye. Channel: Green, Scanresolution = 3μm, PMT 100%, 20bit. Data was read using Feature Extraction software 10.7 (Agilent Technologies, Santa Clara, CA, US), and finally normalized using the limma package in R software, with the Quantile algorithm used.

[0068] 6. The lncRNA profiles in PBMCs of the TB group and the HC group were screened and compared, and several differentially expressed lncRNAs were obtained (P<0.05, Fold change>2).

[0069] The microarray analysis results of two exemplary lncRNAs (which were subsequently validated as effective biomarkers) are shown in Table 1.

[0070] Table 1

[0071]

[0072] Note: P-values ​​are the comparison results of standardized signal values ​​between the TB group and the HC group; p < 0.05 is considered statistically significant.

[0073] Example 2: Further screening of effective biomarkers

[0074] Using cell models and new clinical group samples (i.e. TB group samples and HC group samples), further screening was conducted on the differentially expressed lncRNAs obtained in the initial screening in Example 1 to obtain two effective biomarkers.

[0075] Two effective biomarkers were lncRNA PRDM7-1:2 and lncRNA CHI3L1-2:3.

[0076] lncRNA PRDM7-1:2 is shown in Sequence 1 of the sequence listing.

[0077] lncRNA CHI3L1-2:3 is shown as sequence 2 in the sequence listing.

[0078] Example 3: Establishment of a method for screening tuberculosis patients using biomarkers

[0079] New clinical group samples (i.e. TB group samples and HC group samples).

[0080] I. Detecting the relative expression level of each biomarker

[0081] 1. Peripheral blood (4 ml) was collected from the subjects using EDTA anticoagulant blood collection tubes, and PBMCs were separated.

[0082] 2. Take the PBMCs obtained in step 1, wash them with PBS buffer, lyse them using QIAzol Lysis Reagent (QIAGEN, catalog number 79306), and then extract RNA using miRNeasy Mini Kit (QIAGEN, catalog number 217004).

[0083] 3. Take the RNA obtained in step 2 and prepare a 20 μl reaction system in a 0.2 ml PCR tube according to Table 2, and then perform reverse transcription.

[0084] Table 2

[0085]

[0086]

[0087] 5×RT Buffer, Enzyme Mix, and Primer Mix are all components of the ReverTra Ace qPCR RT Kit (TOYOBO, catalog number FSQ-101).

[0088] Reverse transcription reaction procedure: 37℃ for 15 min, 95℃ for 5 min, store at 4℃.

[0089] 4. After completing step 3, prepare a 20 μl reaction system in a 96-well plate according to Table 3, and then perform PCR amplification.

[0090] Table 3

[0091] Components volume <![CDATA[PowerUp TM SYBR Green premixed solution 10μl Primer working solution 2μl The product of step 3 2μl <![CDATA[ddH2O]]> 6μl

[0092] PowerUp TM SYBR Green premix: ABI Pharmaceuticals, USA, catalog number A25742.

[0093] The primer working solution provides the active ingredients for detecting the target: upstream and downstream primers. The concentration of both the upstream and downstream primers in the primer working solution is 10 μM.

[0094] PCR amplification was performed using an ABI QuantStudio 7FLEX real-time PCR instrument. The PCR amplification reaction program was: 50℃ for 2 min, 95℃ for 10 min; 95℃ for 15 s, 60℃ for 1 min, for 40 cycles.

[0095] The primers used for PCR amplification to detect lncRNA PRDM7-1:2 gene expression are as follows:

[0096] lncRNA PRDM7-1:2 upstream primer (sequence 3 in the sequence listing): CCATGGGTTCTACGTGTTTCTTG;

[0097] lncRNA PRDM7-1:2 downstream primer (sequence 4 in the sequence listing): CATTCCTGGTGCCCATTCTG.

[0098] The primers used for PCR amplification to detect lncRNA CHI3L1-2:3 gene expression are as follows:

[0099] lncRNA CHI3L1-2:3 upstream primer (sequence 5 in the sequence listing): CACTACTCTCCCAAGCCCTTCTAT;

[0100] lncRNA CHI3L1-2:3 downstream primer (sequence 6 in the sequence listing): GAAGGACTAATGGCTGGACACTAATAT.

[0101] The primers used for PCR amplification to detect the expression of the internal reference gene (GAPDH gene) are as follows:

[0102] GAPDH upstream primer (sequence 7 in the sequence listing): TGACTTCAACAGCGACACCCA;

[0103] GAPDH downstream primer (sequence 8 in the sequence listing): CACCCTGTTGCTGTAGCCAAA.

[0104] All primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0105] △Ct=Ct lncRNA -Ct GAPDH ;

[0106] Relative expression level = 2 -△Ct .

[0107] II. Setting thresholds for screening tuberculosis patients using effective biomarkers

[0108] Thresholds were established based on clinical grouping and relative expression levels of biomarkers.

[0109] When lncRNA PRDM7-1:2 is used as a biomarker, the threshold is set to 0.001008514. Values ​​greater than or equal to the threshold are considered tuberculosis patients, while values ​​less than the threshold are considered healthy individuals.

[0110] When lncRNA CHI3L1-2:3 is used as a biomarker, the threshold is set to 0.000120130. Values ​​greater than or equal to the threshold are considered tuberculosis patients, and values ​​less than the threshold are considered healthy individuals.

[0111] Example 4: Validating the use of lncRNA as a screening biomarker for tuberculosis patients in a new sample population.

[0112] Subjects: A total of 102 subjects were included; 70 tuberculosis patients formed the tuberculosis patient group (TB group), and 32 healthy individuals formed the healthy individual group (HC group).

[0113] I. Detecting the relative expression level of each biomarker

[0114] Each subject was tested separately, using the same method as step one of Example 3.

[0115] The relative expression levels of the two lncRNAs obtained from the above steps in 32 healthy individuals and 70 tuberculosis patients are shown in the figure. Figure 1Due to the small relative expression levels, the relative expression values ​​were multiplied by 100,000 for easier visualization, resulting in the displayed relative expression levels. Table 4 shows the displayed relative expression levels of each target in the PBMCs of 32 healthy individuals. Table 5 shows the displayed relative expression levels of each target in the PBMCs of 70 tuberculosis patients.

[0116] Table 4

[0117]

[0118]

[0119] Table 5

[0120]

[0121]

[0122] The relative expression levels of the two targets in PBMCs of the TB group (mean of the group) and the relative expression levels of the two targets in PBMCs of the HC group (mean of the group) and their expression differences are shown in Table 6.

[0123] Table 6

[0124] Fc(TB / HC) P-value lncRNA PRDM7-1:2 3.816 <0.000 lncRNA CHI3L1-2:3 1.563 <0.001

[0125] II. Screening for tuberculosis patients using effective biomarkers

[0126] Using the relative expression levels of the two target substances obtained in step one, a judgment is made according to step two of Example 3.

[0127] Performance evaluation is conducted based on the judgment results and the actual grouping.

[0128] ROC curves of the two lncRNAs as diagnostic markers are shown in the figure. Figure 2 The performance evaluation data of the two lncRNAs as diagnostic biomarkers are shown in Table 7.

[0129] Table 7

[0130] AUC (95% CI) Sensitivity (95% CI) Specificity (95% CI) lncRNA PRDM7-1:2 0.928(0.876-0.980) 0.829(0.756-0.902) 0.969(0.935-1.000) lncRNA CHI3L1-2:3 0.715(0.608-0.822) 0.714(0.626-0.802) 0.781(0.701-0.861)

[0131] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A system for screening patients with tuberculosis, including a detection system and an interpretation system; The detection system is used to detect the relative expression levels of lncRNA PRDM7-1:2 or a characteristic fragment of lncRNA PRDM7-1:2 in the subject's PBMCs; The interpretation system is used to convert the relative expression levels of lncRNA PRDM7-1:2 or characteristic fragments of lncRNA PRDM7-1:2 in the PBMCs of subjects into interpretation results, which refer to tuberculosis patients or healthy individuals; The sequence of the lncRNA PRDM7-1:2 is shown in Sequence 1 of the sequence listing; The characteristic fragment of the lncRNA PRDM7-1:2 is shown at positions 2797-2858 in Sequence 1 of the sequence listing.

2. Systems used for the diagnosis or auxiliary diagnosis of tuberculosis, including detection systems and interpretation systems; The detection system is used to detect the relative expression levels of lncRNA PRDM7-1:2 or a characteristic fragment of lncRNA PRDM7-1:2 in the subject's PBMCs; The interpretation system is used to convert the relative expression levels of lncRNA PRDM7-1:2 or a characteristic fragment of lncRNA PRDM7-1:2 in the subject's PBMCs into interpretation results, which refer to whether tuberculosis has occurred or not. The sequence of the lncRNA PRDM7-1:2 is shown in Sequence 1 of the sequence listing; The characteristic fragment of the lncRNA PRDM7-1:2 is shown at positions 2797-2858 in Sequence 1 of the sequence listing.

3. Application of substances used to detect lncRNA PRDM7-1:2 or characteristic fragments of lncRNA PRDM7-1:2 in the preparation of kits for screening tuberculosis patients; The sequence of the lncRNA PRDM7-1:2 is shown in Sequence 1 of the sequence listing; The characteristic fragment of the lncRNA PRDM7-1:2 is shown at positions 2797-2858 in Sequence 1 of the sequence listing.

4. The application as described in claim 3, characterized in that: The substance used to detect the characteristic fragments of lncRNA PRDM7-1:2 or lncRNA PRDM7-1:2 includes primer pairs for detecting the characteristic fragments of lncRNA PRDM7-1:2 or lncRNA PRDM7-1:

2.

5. Application of lncRNA PRDM7-1:2 or a characteristic fragment of lncRNA PRDM7-1:2 as a biomarker in the development of kits for screening tuberculosis patients; The sequence of the lncRNA PRDM7-1:2 is shown in Sequence 1 of the sequence listing; The characteristic fragment of the lncRNA PRDM7-1:2 is shown at positions 2797-2858 in Sequence 1 of the sequence listing.

6. The use of substances for detecting lncRNA PRDM7-1:2 or characteristic fragments of lncRNA PRDM7-1:2 in the preparation of kits for the diagnosis or auxiliary diagnosis of tuberculosis; The sequence of the lncRNA PRDM7-1:2 is shown in Sequence 1 of the sequence listing; The characteristic fragment of the lncRNA PRDM7-1:2 is shown at positions 2797-2858 in Sequence 1 of the sequence listing.

7. The application as described in claim 6, characterized in that: The substance used to detect the characteristic fragments of lncRNA PRDM7-1:2 or lncRNA PRDM7-1:2 includes primer pairs for detecting the characteristic fragments of lncRNA PRDM7-1:2 or lncRNA PRDM7-1:

2.

8. The application of characteristic fragments of lncRNA PRDM7-1:2 or lncRNA PRDM7-1:2 in the development of kits for the diagnosis or auxiliary diagnosis of tuberculosis; The sequence of the lncRNA PRDM7-1:2 is shown in Sequence 1 of the sequence listing; The characteristic fragment of the lncRNA PRDM7-1:2 is shown at positions 2797-2858 in Sequence 1 of the sequence listing.