A chaetomium strain and a compound with neuroprotective activity produced by fermentation thereof
The compound produced by fermentation of Chaetomium sp. solves the problem of poor efficacy of existing drugs in treating Parkinson's disease and Alzheimer's disease, and provides a compound with neuroprotective activity and no cytotoxicity, suitable for industrial production.
Patent Information
- Application Number
- CN202210214423.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-02-28
- Publication Date
- 2026-07-03
- Estimated Expiration
- 2042-02-28
AI Technical Summary
Existing drug treatments for Parkinson's disease and Alzheimer's disease are either ineffective or have toxic side effects, and there is a lack of compounds with excellent neuroprotective activity.
A novel Chaetomium sp. strain and compounds produced by its fermentation are provided. Compounds with neuroprotective activity are obtained by ethyl acetate extraction and purification by silica gel column chromatography and high performance liquid chromatography.
This compound exhibits significant neuroprotective activity and is non-cytotoxic. Its separation process is simple, making it suitable for large-scale industrial production and promising for broad applications.
Smart Images

Figure CN116694475B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of natural product technology, specifically relating to a strain of Chaetomium and a compound with neuroprotective activity produced by its fermentation. Background Technology
[0002] Parkinson's disease and Alzheimer's disease are the most common neurological disorders, prevalent among the elderly, and severely impact daily life. Alzheimer's disease (AD) is an insidious, progressive neurodegenerative disease. Its most characteristic pathological features are senile plaques (SPs) formed by the deposition of amyloid-β-peptide (Aβ) outside neurons in the cerebral cortex and hippocampus, and neurofibrillary tangles (NFTs) formed by the abnormal aggregation of tau protein within brain neurons. These pathological changes in brain tissue induce brain cell apoptosis, leading to cortical atrophy, reduced brain volume, widened sulci, and enlarged ventricles in AD patients. Currently, treatment for Alzheimer's disease is primarily drug therapy, with drugs such as tacrine and clobetacholine being the mainstays. However, existing AD medications suffer from poor efficacy or short-lived effects.
[0003] Parkinson's disease (PD) is also a major neurodegenerative disease, and the second most common neurodegenerative disease after Alzheimer's disease. Its most significant pathological change is the degeneration and death of dopamine (DA) neurons in the substantia nigra of the midbrain. Currently, treatment for Parkinson's disease primarily involves medication and physical therapy. Major medications include monoamine oxidase type B (MAO-B) inhibitors (which cannot be taken by patients with gastric ulcers), ketoconazole, benzotropine, scopolamine (these drugs can only be taken by patients with milder symptoms), and trihexyphenidyl (which has significant side effects). The high specificity and severe side effects of the medications used for PD patients pose significant challenges to the treatment of PD.
[0004] Currently, some studies have found that indole and its derivatives may play a role in reducing polyglutamine aggregation, i.e., they have potential neuroprotective effects. However, no indole compounds with excellent neuroprotective activity and potential for treating neurodegenerative diseases such as Alzheimer's disease and Parkinson's disease have been reported yet. Therefore, finding new compounds with good therapeutic effects and low toxicity is an inevitable trend in the development of neuroprotective drugs.
[0005] *Chaetomium* is a large genus within the Ascomycota, with over 400 species, widely distributed in soil, air, and within plants. XU et al. reviewed the metabolic components and biological activities of *Chaetomium* fungi, indicating that the main types of metabolites are cytochalasin derivatives, azaphilones, pyranones, quinones, diketopiperazines, and bryochromic acid derivatives (Review on The Secondary Metabolites and Its Biological Activities from *Chaetomium Fungi*. *Natural Product Research and Development* 2018, 30(3), 515-525). Cytochalasin compounds are one of the main types of metabolites in *Chaetomium* fungi. To date, more than 60 cytochalasin compounds have been isolated from Chaetomium fungi, exhibiting antibacterial and antitumor physiological activities (McMullin, DR; Sumarah, MW; Miller, JD, Chaetoglobosins and azaphilones produced by Canadian strains of Chaetomium globosum isolated from the indoor environment. Mycotoxin Research 2013, 29(1), 47-54; Kawahara, T.; Itoh, M.; Izumikawa, M.; Sakata, N.; Tsuchida, T.; Shin-ya, K., New chaetoglobosinderivatives, MBJ-0038, MBJ-0039 and MBJ-0040, isolated from the fungus Chaetomium sp f24230. Journal of Antibiotics 2013, 66 (12), 727-730.). Another representative class of compounds in Chaetoceros fungi metabolites are azaphilones, which possess highly oxidizing properties. To date, over 70 azaphilone compounds have been reported isolated from the secondary metabolites of this genus, primarily exhibiting antibacterial and cytotoxic activities. Currently, no Chaetoceros fungi metabolites with neuroprotective activity have been reported. Summary of the Invention
[0006] The purpose of this invention is to provide a novel strain and a new compound obtained by fermentation of the strain that has good neuroprotective activity and low toxicity.
[0007] This invention provides a novel Chaetomium sp. strain, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.23896.
[0008] This invention provides compounds of Formula I, or pharmaceutically acceptable salts thereof, or solvates thereof:
[0009]
[0010] R1, R2, and R3 are each independently selected from hydrogen or hydroxyl groups.
[0011] Furthermore, R1 above is a hydroxyl group.
[0012] Furthermore, R2 mentioned above is a hydroxyl group.
[0013] Furthermore, R3 mentioned above is a hydroxyl group.
[0014] Furthermore, the structure of the above compound is as follows:
[0015]
[0016] The present invention also provides a method for preparing the above-mentioned compound, which includes the following steps:
[0017] S1. The Chaetomium strain is inoculated into a fermentation medium and cultured to obtain a fermentation product; preferably, the Chaetomium strain is Chaetomium sp., which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.23896.
[0018] S2. Add ethyl acetate to the fermentation product obtained in S1, mix and extract, then filter to obtain the extract;
[0019] S3. Concentrate the extract obtained in S2 under reduced pressure to obtain crude extract;
[0020] S4. The crude extract obtained in S3 was subjected to silica gel column chromatography. The eluent was composed of petroleum ether and acetone. The eluent was eluted in a gradient manner according to the volume ratio of petroleum ether to acetone of 10:1, 5:1, 3:1, 2:1 and 1:1. The eluent with a volume ratio of petroleum ether to acetone of 2:1 was collected and dried to obtain the crude product.
[0021] S5. The crude product obtained in S4 is purified by high performance liquid chromatography.
[0022] Furthermore, the fermentation medium described in step S1 above is composed of the following components in parts by weight: 85-95 parts rice and 0.1-0.5 parts peptone;
[0023] And / or, the culture described in step S1 is a static culture at a constant temperature of 28-30℃ for 20-30 days;
[0024] And / or, the extraction conditions in step S2 are 55-65℃ for 3-5 hours, and the number of extractions is 1-3 times;
[0025] And / or, the mobile phase for high performance liquid chromatography purification in step S5 is a mixed solution of methanol and water, wherein the volume percentage of methanol is 40% to 50%.
[0026] Preferably, the fermentation medium described in step S1 consists of the following components in parts by weight: 90 parts rice and 0.3 parts peptone;
[0027] And / or, the culture described in step S1 is a static culture at a constant temperature of 28°C for 25 days;
[0028] And / or, the extraction conditions in step S2 are 60°C for 4 hours, and the extraction is performed 3 times;
[0029] And / or, the mobile phase for high performance liquid chromatography purification in step S5 is a mixed solution of methanol and water, wherein the volume percentage of methanol is 44%.
[0030] The present invention also provides the use of the above-mentioned compounds, or pharmaceutically acceptable salts thereof, or solvates thereof, in the preparation of medicaments for the prevention and treatment of nervous system diseases; preferably, the medicaments are medicaments for the prevention and treatment of neurodegenerative diseases.
[0031] Furthermore, the aforementioned drugs are for the prevention and treatment of Parkinson's disease and Alzheimer's disease; more preferably, the drugs are neuroprotective drugs.
[0032] The present invention also provides a drug preparation which is a formulation prepared by adding pharmaceutically acceptable excipients or auxiliary ingredients to the above-mentioned compound, or a pharmaceutically acceptable salt thereof, or a solvate thereof as the active ingredient.
[0033] The beneficial effects of the present invention are as follows: (1) The new Chaetomium strain of the present invention can ferment to produce a new compound, which is stable, non-cytotoxic, and has significant neuroprotective activity.
[0034] (2) The compound of the present invention is produced by solid-state fermentation of fungi. It can be obtained by extracting the fermentation product with ethyl acetate and then separating and purifying it by silica gel column chromatography and high performance liquid chromatography. The separation steps are simple, convenient to implement, easy to industrialize and produce on a large scale, and have broad application prospects.
[0035] Preservation of biological materials:
[0036] The strain Chaetomium sp. used in this invention was deposited on December 17, 2021, at the China General Microbiological Culture Collection Center (CGMCC, address: Institute of Microbiology, Chinese Academy of Sciences, Beijing, China), with the collection number CGMCC NO.23896.
[0037] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.
[0038] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description
[0039] Figure 1 The compounds of this invention having the structure of Formula I 1 H NMR spectrum.
[0040] Figure 2 The compounds of this invention having the structure of Formula I 13 C NMR spectrum.
[0041] Figure 3 This is a high-resolution liquid chromatography-mass spectra of the metabolites of the *Chaetoceros* strain of this invention.
[0042] Figure 4 This is a high-resolution liquid chromatography-mass spectrometry (LC-MS) analysis result of the metabolic products of the *Chaetoceros* strain of this invention.
[0043] Figure 5 This is the result of the compound of the present invention resisting and protecting against 6-OHDA-induced neurotoxicity.
[0044] Figure 6 The results show the effects of the compounds of this invention on nerve cell morphology.
[0045] Figure 7 The results show the effects of the compounds of this invention on the level of reactive oxygen species in cells.
[0046] Figure 8 The results show the effects of the compounds of this invention on the relative expression levels of SOD1 mRNA and Bc12 mRNA.
[0047] Figure 9 The results are the cytotoxicity test results of the compounds of this invention. Detailed Implementation
[0048] The raw materials and equipment used in this invention are all known products, obtained by purchasing commercially available products.
[0049] The strain Chaetomium sp. used in this invention is a Chaetomium species deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.23896.
[0050] Example 1: Preparation of the compound of the present invention
[0051] I. Fermentation of Microbial Strains
[0052] 1. Inoculate the strain Chaetomium sp. onto the slant of PDA medium and culture at 28°C in the dark for 7 days to obtain slant seed.
[0053] 2. Transfer the slant seeds obtained in step 1 to liquid seed culture medium and culture at 28℃ and 150 rpm in the dark for 4 days to obtain seed culture solution.
[0054] Seed culture medium: The solvent is potato juice (preparation of potato juice: 200g potato, add about 1L of water, boil for 30 minutes, filter, and make up to 1L of filtrate). The solutes and their contents are as follows: glucose 20g / L, yeast extract 3g / L, KH2PO4 2g / L.
[0055] 3. Inoculate approximately 10 mL of seed culture solution into an Erlenmeyer flask containing fermentation medium and incubate at a constant temperature of 28°C for 25 days.
[0056] Preparation method of fermentation medium: Take 90g of rice, soak it in water for 24h, filter out the water with gauze, put it into a 500mL Erlenmeyer flask, add 0.3g of peptone, mix well, and sterilize (121℃, 30min).
[0057] II. Extraction, Separation and Purification of the Compounds of this Invention
[0058] 1. Add 300 mL of ethyl acetate to the fermented Erlenmeyer flask, incubate in a water bath at 60 °C for 4 hours, and filter to obtain the extract. Extract three times, combine the filtrates, and concentrate under vacuum to obtain the extract.
[0059] 2. After the total extract and silica gel are mixed evenly in a 1:1 ratio, the sample is loaded onto the silica gel column using a dry method and subjected to silica gel column chromatography (the packing material used for silica gel column chromatography is 200-300 mesh). The eluent with a volume ratio of petroleum ether / acetone (volume ratio of petroleum ether to acetone is 10:1, 5:1, 3:1, 2:1, 1:1, and pure acetone) is collected and the eluent with a volume ratio of petroleum ether to acetone of 2:1 is obtained by rotary evaporation to obtain dry matter A.
[0060] 3. Dry matter A was further purified by reverse-phase column chromatography (ODS C-18 column with silica gel; mobile phase: methanol:water 40:60 (v / v)) to obtain dry matter A-4-2. Dry matter A-4-2 was then prepared as a white powder by high-performance liquid chromatography (10 mL / min, 33% acetonitrile-water, v / v). The characterization data are as follows:
[0061] HR-ESI-MS: m / z 401.1460 [M+Na] + ;
[0062] 1 H-NMR (600MHz, MeOD-d4): δ7.74(1H,d,J=7.6Hz,H-4′),7.41(1H,d,J=8.3Hz,H-7′),7.25(1H,d,J=7.9Hz,H-4),7.20(1H,dd,J=6.8,1.4Hz, H-7),7.10(1H,t,J=7.1Hz,H-6),7.03(2H,overlap,H-5,6′),6.90(1H,t,J=7.5Hz, H-5′),5.13(1H,d,J=6.9Hz,H-8),4.35(3H,overlap,H-9,8′,9′),4.03(1H,dd,J =11.5,3.6Hz,H-10a),3.89(1H,dd,J=11.5,3.6Hz,H-10b),3.76(1H,dd,J=11.8,2.1Hz,H-10′b),3.70(1H,dd,J=11.8,2.1Hz,H-10′b); see Figure 1 .
[0063] 13 C-NMR (150MHz, MeOD-d4): δ138.7(C-7a), 138.2(C-7′a), 136.3(C-2), 128.0(C-3′a),127.4(C-3a),125.7(C-2′),122.7(C-7),122.0(C-6′),121.0(C-4′), 120.2(C-4′),120.1(C-4′),120.0(C-5),113.4(C-3′),112.7(C-7′),112.0(C-7), 110.0(C-3), 78.1(C-9′), 76.1(C-9), 75.7(C-8), 65.7(C-10), 64.6(C-10′); see Figure 2.
[0064] The molecular formula is C 22 H 22 N2O4 has the following structure:
[0065]
[0066] The following experimental examples demonstrate the beneficial effects of the compounds of this invention.
[0067] All data were analyzed using SPSS 19 software. Data are expressed as mean ± standard deviation (X ± S).
[0068] Example 2: Identification of the Chaetomium sp. strain of the present invention
[0069] The black Chaetomium sp. strain of this invention was isolated from soil in Ya'an, Sichuan Province. It was identified by the Institute of Microbiology, Chinese Academy of Sciences, and cultured on PDA slant medium at 4°C. It was then stored in a refrigerator and deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.23896.
[0070] Based on the DNA sequence of the internal transcribed spacer (ITS), the fungal strain was identified as *Chaetomium* sp. by NCBI BLAST analysis. This sequence showed 97.00% homology to the previously reported ITS sequence of *Chaetomium* sp. F5 (Gene Bank No: MK646014). The following sequence was used in the BLAST search.
[0071] SEQ ID NO.1:
[0072] TTTGATATGCTTAAGTTCAGCGGGTCTTCCTACCTGATCCGAGGTCA ACCTTGGGTAAAAAAGGGGTTTAACGGCCGGAACCCGCAGCACGCCCTGAGCGATGTGTATGCTACTACGCTCGGTGTGACTAGCGAGCCCGCCACTGGTTTTCAGGGCCTGCGGCAGCCGCAGGTCCCCAACACAAGCCTGGGG CTTGATGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAA TTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTTATTAAGTATAGAGACTCAGAG AGGCCATACAGTTGTCAAGAGTTAGGTAACCTCCGGCGGGCGCCCCGC GAGGGGGCCTGGGAGCGCTGGGCGCCGCCCGCCGAAGCAACGATAATGGTAACGTTCACAATGGTTTGGGAGTTTTGCAACTCTGTAATGATCCCT CCGCTGGTTCACCAACGGAGACCTTGTTACA
[0073] Further liquid chromatography-mass spectrometry (LC-MS) analysis was performed on the strain's metabolites. The detection gradient conditions were: acetonitrile-water system, 0-10 min: 20-30% gradient, 10-15 min: 30-35% gradient, 15-20 min: 35-40% gradient, 20-35 min: 40-45% gradient, flow rate 0.8 mL / min; detection wavelength 210 nm. The high-resolution LC-MS results are as follows: Figure 3 As shown, the results of high-resolution liquid chromatography-mass spectrometry analysis are as follows: Figure 4 As shown. Analysis of the high-resolution liquid chromatography-mass spectrometry results revealed the molecular ion peak of the compound isolated in Example 1.
[0074] The above results demonstrate that the black chamomile of the present invention is a new chamomile strain, and that the metabolites of this strain contain the compound of Example 1.
[0075] Experimental Example 1: Neuroprotective Activity and Cytotoxicity Experiments of the Compounds of the Present Invention
[0076] I. Neuroprotective activity
[0077] 6-Hydroxydopamine (6-OHDA) can induce degeneration of dopaminergic neurons (DA neurons) and noradrenergic neurons, and cause neurotoxicity by triggering oxidative stress-related cytotoxicity and microglia-dependent inflammation of DA neurons (Luo Y, Jiang Y, He Y, et al. Vina-Ginsenoside R4 from Panax ginseng Leaves Alleviates 6-OHDA-Induced Neurotoxicity in PC12 Cells Via the PI3K / Akt / GSK-3βSignaling Pathway[J]. Journal of Agricultural and Food Chemistry, 2020, 68(51).), which can be used to construct Parkinson's disease models. In this invention, the neuroprotective activity of the compound prepared in Example 1 (hereinafter referred to as CTX) was detected by applying it to the cell viability of 6-OHDA-induced PC12 cells.
[0078] 1. Preparation of drug solutions
[0079] (1) Prepare a 100 μM solution of CTX with DMSO and store it at -4℃;
[0080] (2) 6-hydroxydopamine (6-OHDA) was purchased from Sigma-Aldrich and prepared into a 250 μM / mL solution with redistilled water and stored at -20 °C.
[0081] (3) DMEM culture medium, purchased from Thermo Fisher Scientific Ltd.
[0082] 2. Cell line: Rat pheochromocytoma PC12 cells, purchased from the American Type Culture Collection (ATCC).
[0083] 3. Test methods:
[0084] (1) Cell viability
[0085] Resuscitated cells were cultured in DMEM medium containing 10% PBS and 1% penicillin and streptomycin. Highly differentiated PC12 cells were cultured at a density of 3*102. 5Cells were seeded at 100 μL / well in 96-well plates and incubated for 16–24 h. When cells reached 70%–80% adherence, they were pretreated with CTX at final concentrations of 6.25 μM / mL, 12.5 μM / mL, 25 μM / mL, 50 μM / mL, and 100 μM / mL for 30 min. Cells were then treated with 6-OHDA at a final concentration of 250 μM for 24 hours. Cell viability was measured using the MTT assay. The control group consisted of cell culture medium without CTX and 6-OHDA.
[0086] The calculation formula is as follows:
[0087] (2) Observation of cell morphology
[0088] Wrap the glass slides used for cell culture in aluminum foil and sterilize at 121°C for 30 minutes. After cooling to room temperature, place them in a clean bench for later use. Place the sterilized glass slides in 6-well plates beforehand, then collect cells in the logarithmic growth phase at a rate of 3 × 10⁻⁶ cells / well. 5 Cells / mL were seeded in 6-well plates. After 16-24 hours, sample pretreatment and 6-OHDA treatment were performed. After 24 hours of drug treatment, the glass slides were removed, and an appropriate amount of gel mount was added to the slides. The slides were then placed upside down on the glass slides to complete the slide preparation. Finally, the changes in cell morphology and number were observed using an IX 71 inverted microscope in bright field. The control group did not receive CTX and 6-OHDA. The model group was induced with only 6-OHDA (250 μM). The CTX-50 group was induced with 6-OHDA (250 μM) and cultured with CTX 50 μM / mL. The CTX-100 group was induced with 6-OHDA (250 μM) and cultured with CTX 100 μM / mL.
[0089] (3) Detection of reactive oxygen species in cells
[0090] Intracellular ROS detection was performed using DCFH-DA fluorescence staining. DCFH-DA itself does not fluoresce. Intracellular esterases can hydrolyze DCFH-DA, which can freely enter and exit the cell, into DCFH, which is difficult to pass through the cell. The latter is then oxidized by reactive oxygen free radicals in the cell to DCF, which is fluorescent. Therefore, the level of reactive oxygen in the cell can be detected by detecting the fluorescence intensity of DCF. After treatment, the culture medium was removed from the cells, and PBS or serum-free cell culture medium was added to wash away residual culture medium. The cells were then diluted with serum-free DMEM medium to a final concentration of 10 μM DCFH. 500 μL of fluorescent dye was added to each well and stained in the dark for 20 min. The cells were then washed three times with PBS to remove unbound DCFH-DA. Cells in 6-well plates were analyzed directly under flow cytometry. Cells on glass slides were prepared and analyzed under laser confocal microscopy at an excitation wavelength of 488 nm and an emission wavelength of 525 nm (the control group, model group, and experimental group were grouped the same as in (2)).
[0091] (4) Detection of SOD1 and Bcl-2 mRNA expression in PC12 cells by real-time quantitative reverse transcription polymerase chain reaction.
[0092] PC12 cells (6 × 10⁵ cells / dish) were seeded in 6 cm diameter culture dishes with 3 mL of culture medium. Cell treatment was similar to that described in the "CXT Cytotoxicity Assay". At the end of treatment, total RNA was extracted using Trizol reagent (Invitgen, Hong Kong, China) according to the manufacturer's instructions. RNA concentration and purity were determined by absorbance at 260 / 280 nm. Total RNA was reverse transcribed using a first-strand synthesis system kit to synthesize single-stranded cDNA. Subsequently, real-time PCR reactions were performed using a C1000™ thermal cycler (BIO-RAD, USA) and an IQ SYBR Green SuperMix kit (BIO-RAD, USA). The oligonucleotide primer sequences used for amplification were synthesized by Tech Dragon Limited (Hong Kong, China). Primer sequences are shown in Table 1 below.
[0093] Table 1 Primer sequences
[0094]
[0095] Real-time RT-PCR data were analyzed using CFX MANAGER software (Bio-Rad, USA) to calculate the threshold periodicity (Ct) values for different samples, expressed as relative mRNA levels. A standard curve was generated to show the linear relationship between Ct and the initial total RNA amount. Each real-time RT-PCR reaction was performed in triplicate, generating one standard curve for each reaction to assess cDNA expression levels. The relative expression level of the target gene was determined based on the internal reference gene GAPDH.
[0096] The formula is as follows:
[0097] ΔCq=Target Cq-GAPDH Cq
[0098] ΔΔCq=ΔCq-Average con(ΔCq)
[0099] Relative expression level of target gene = 2 - ΔΔCq
[0100] 4. Experimental Results
[0101] (1) As Figure 5 As shown, 6-OHDA has a significant inhibitory effect on PC12 cell activity, while the compound of this invention can improve cell activity.
[0102] (2) Figure 6 As shown, compared with the normal cell group (control group), the number of cells in the 6-OHDA-treated group was significantly reduced and the cell morphology also changed significantly. However, after pretreatment with the compound of the present invention, both the number and morphology were improved, further indicating that the compound can inhibit the 6-OHDA-induced PC12 mortality rate.
[0103] (3) Figure 7 As shown, the model group exhibited significant fluorescence, indicating a high level of reactive oxygen species (ROS) within the cells. CXT can significantly reduce the ROS level in cells, demonstrating that CXT has the ability to resist cell damage.
[0104] Parkinson's disease (PD) is a common neurodegenerative disease with an unclear etiology. However, substantial evidence suggests that its pathogenesis involves multiple factors, including aging, autoimmunity, toxic substances, oxidative stress, and environmental factors. Oxidative stress is the ultimate common pathway inducing dopaminergic neuron degeneration. Oxidative stress is an imbalance between the production and elimination of oxygen free radicals in an organism or cell, leading to excessive accumulation of reactive oxygen species (ROS) and reactive nitrogen species (RNS) and oxidative damage. Excessive ROS can cause protein denaturation, lipid peroxidation, and gene mutations, ultimately resulting in nerve cell damage and apoptosis.
[0105] The above experimental results show that the compound of the present invention can significantly resist 6-OHDA-induced neurological damage, IC50 50 The concentration was 6.25 μM. One-way ANOVA and t-tests were used to analyze the differences between the experimental group and the control group, and between different experimental groups. Data analysis showed that p < 0.05, indicating a significant difference.
[0106] (4) Figure 8As shown, compared with the normal group, the relative expression levels of SOD1 mRNA and Bc12 were decreased in the 6-OHDA treatment group, while the compounds of this invention upregulated the expression of SOD1 mRNA and Bc12 mRNA. Therefore, the compounds of this invention can inhibit ROS production, improve antioxidant enzyme activity, and ultimately reduce apoptosis, indicating that the neuroprotective effect of this invention is mediated by attenuating oxidative stress. Comparison between model group and blank group: *p<0.05; Comparison between experimental group and model group, blank group: # p<0.05.
[0107] II. Cytotoxicity Test
[0108] 1. Test method:
[0109] Highly differentiated PC12 cells were seeded at 100 μL / well in 96-well plates and incubated for 16–24 h. Once 70%–80% of the cells had adhered, different groups were treated with different drugs: the blank group received DMEM complete medium without cells, the control group received cell culture medium without the sample, and the experimental groups received cell culture medium containing the sample (at different concentrations). After 24 h of incubation, the cell culture medium was aspirated, and 100 μL of MTT stock solution at a final concentration of 0.5 mg / mL was added. After incubation for 4 h, an equal volume of MTT stop solution was added, and the mixture was incubated until the reaction was complete. The absorbance was then measured at 550 nm using a microplate reader.
[0110] 2. Cytotoxicity test results
[0111] like Figure 9 As shown, the compound of the present invention did not significantly inhibit cell proliferation, indicating that the compound has no obvious cytotoxic activity and is highly safe.
[0112] In summary, this invention provides a novel *Chaetoceros* strain and a new compound produced by the fermentation of this strain. This compound exhibits no cytotoxicity and possesses excellent and significant neuroprotective activity. As a natural product produced by solid-state fermentation of fungi, this compound can be extracted with ethyl acetate, followed by separation and purification using silica gel column chromatography and high-performance liquid chromatography. The separation process is simple, convenient, and suitable for large-scale industrial production, demonstrating broad application prospects. SEQUENCE LISTING <110> Chengdu Institute of Biology, Chinese Academy of Sciences <120> A strain of Chaetomium and a compound with neuroprotective activity produced by its fermentation. <130> GY004-2021P0114564CC <160> 7 <170> PatentIn version 3.5 <210> 1 <211> 563 <212> DNA <213> Chaetomium Blackcolor <400> 1 60. tttgatatgc ttagttcag cgggtcttcc tacctgatcc gaggtcaacc ttgggtaaaa aaggggttta acggccgga cccgcagcac gccctgagcg atgtgtatgc tactacgctc 120 ggtgtgacta gcgagcccgc cactggtttt cagggcctgc ggcagccgca ggtccccaac 180 acaagcctgg ggcttgatgg ttgaaatgac gctcgaacag gcatgcccgc cagaatactg gcgggcgcaa tgtgcgttca aagattcgat gattcactga attctgcaat tcacattact tatcgcattt cgctgcgttc ttcatcgatg ccagaaccaa gagatccgtt gttgaaagtt ttaacttatt aagtatagag actcagagag gccatacagt tgtcaagagt taggtaacct ccggcggggcg ccccgcgagg gggcctggga gcgctgggcg ccgcccgccg aagcaacgat 480 aatggtaacg ttcacaatgg tttggggagtt ttgcaactct gtaatgatcc ctccgctggt 540 tcaccaacgg agaccttgtt aca <210> 2 <211> 23 <212> DNA <213> F1 <400> 2 cactcacggc aaattcaacg gca 23 <210> 3 <211> 22 <212> DNA <213> R1 <400> 3 gactccacga catactcagc ac 22 <210> 4 <211> 23 <212> DNA <213> F2 <400> 4 ccatcaatat ggggacaata cac 23 <210> 5 <211> 20 <212> DNA <213> R2 <400> 5 acacgatctt caatggacac 20 <210> 6 <211> 21 <212> DNA <213> F3 <400> 6 ttctttgagt tcggtggggt c 21 <210> 7 <211> 21 <212> DNA <213> R3 <400> 7 tgcatatttg tttggggcag g 21
Claims
1. A Chaetomium sp. strain, characterized in that, It is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.23896.
2. The compound represented by Formula I, or a pharmaceutically acceptable salt thereof, or a solvate thereof: The structure of the compound is as follows: 。 3. The method for preparing the compound of claim 2, or a pharmaceutically acceptable salt thereof, or a solvate thereof, characterized in that: It includes the following steps: S1. Inoculate the Chaetomium strain into the fermentation medium and culture to obtain the fermentation product; S2. Add ethyl acetate to the fermentation product obtained in S1, mix and extract, then filter to obtain the extract; S3. Concentrate the extract obtained in S2 under reduced pressure to obtain crude extract; S4. The crude extract obtained in S3 was subjected to silica gel column chromatography. The eluent was composed of petroleum ether and acetone. The eluent was eluted in a gradient manner according to the volume ratio of petroleum ether to acetone of 10:1, 5:1, 3:1, 2:1 and 1:
1. The eluent with a volume ratio of petroleum ether to acetone of 2:1 was collected and dried to obtain the crude product. S5. The crude product obtained in S4 is purified by high performance liquid chromatography to obtain the final product. The Chaetomium strain is a Chaetomium sp. strain, deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.23896.
4. The preparation method according to claim 3, characterized in that: The fermentation medium described in step S1 consists of the following components in parts by weight: 85-95 parts rice and 0.1-0.5 parts peptone; And / or, the culture described in step S1 is a static culture at a constant temperature of 28-30℃ for 20-30 days; And / or, the extraction conditions in step S2 are 55-65℃ for 3-5 hours, and the number of extractions is 1-3 times; And / or, the mobile phase for high performance liquid chromatography purification in step S5 is a mixed solution of methanol and water, wherein the volume percentage of methanol is 40% to 50%.
5. The preparation method according to claim 4, characterized in that: The fermentation medium described in step S1 consists of the following components in parts by weight: 90 parts rice and 0.3 parts peptone; And / or, the culture described in step S1 is a static culture at a constant temperature of 28°C for 25 days; And / or, the extraction conditions in step S2 are 60℃ for 4 hours, and the extraction is repeated 3 times; And / or, the mobile phase for high performance liquid chromatography purification in step S5 is a mixed solution of methanol and water, wherein the volume percentage of methanol is 44%.
6. Use of the compound of claim 2, or a pharmaceutically acceptable salt thereof, or a solvate thereof, in the preparation of a medicament for the prevention and treatment of Parkinson's disease.
7. A drug, characterized in that: It is a formulation prepared by adding pharmaceutically acceptable excipients or auxiliary ingredients to the compound of claim 2, or a pharmaceutically acceptable salt thereof, or a solvate thereof as the active ingredient.
Citation Information
Patent Citations
Chaetomium cupreum strain and use thereof
CN101619291A
Preparation and application of chaetomium globosum and metabolite flavipin thereof
CN103087923A