Thermus thermophilus malate dehydrogenase recombinant gene, and preparation method and application thereof
By expressing the recombinant gene of thermophilic bacterium malate dehydrogenase in Escherichia coli, the problems of cumbersome extraction process and high cost in existing technologies have been solved, and the industrial production of high-yield, high-activity malate dehydrogenase has been realized.
Patent Information
- Application Number
- CN202210187426.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-02-28
- Publication Date
- 2026-07-10
- Estimated Expiration
- 2042-02-28
AI Technical Summary
In existing technologies, the extraction process of malate dehydrogenase is cumbersome, the raw material cost is high, and the enzyme activity is low. Market demand is increasing day by day, and there is a lack of efficient production methods.
The recombinant gene of malate dehydrogenase from Thermophilus was expressed in Escherichia coli. By optimizing the gene sequence and purification process, high yield and high activity of malate dehydrogenase were achieved in the supernatant.
High yield, short production cycle and high activity expression of malate dehydrogenase were achieved in the Escherichia coli system, reducing production costs and making it suitable for industrial production.
Smart Images

Figure CN116694653B_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of malate dehydrogenase preparation technology, and in particular to the recombinant gene of malate dehydrogenase from Thermophilus bacterium, its preparation method, and its application. Background Technology
[0002] Malate dehydrogenase (MDH) is present in all organisms and is one of the key enzymes in biological carbohydrate metabolism (Ahn JH, Seo H, Park W, Seok J, Lee JA, Kim WJ, Kim GB, KimK J, Lee SY. Enhanced succinic acid production by Mannheimia employing optimal malate dehydrogenase.[J]. Nature communications,2020,11(1):1970). It uses nicotinamide adenine dinucleotide (NAD+) and reduced nicotinamide adenine dinucleotide (NADH) as coenzymes to catalyze the reversible reaction of oxidative dehydrogenation of malate to oxaloacetic acid (OAA). MDH plays an important role in metabolic pathways such as the tricarboxylic acid cycle and the aspartate-malate shuttle (Sonia B, Louis K. Demonstration of physical interactions between consequentive enzymes of the citric acid cycle and of the aspartate-malate shuttle. A study involving fumarase, malate dehydrogenase, citrate synthase and aspartate aminotransferase. [J]. Eur. J. Biochem.. 1981, 117(3): 527-535). MDH belongs to a family of alkyl ketone acid dehydrogenases and is a polymerase, dimer or tetramer with a subunit molecular weight of 30-40 kDa (Shimozawa Y, Himiyama T, Nakamura T, Nishiya Y. Structural analysis and reaction mechanism of malate dehydrogenase from Geobacillus stearothermophilus. [J]. Journal of biochemistry, 2021, 170(1): mvab027).MDH is classified into three main categories based on its subcellular localization, coenzyme specificity, and function: The first category is NAD-mitochondrial malate dehydrogenase (mMDH), which mainly participates in the tricarboxylic acid cycle or glyoxylate cycle in eukaryotic mitochondria; the second category is NAD-cytosol malate dehydrogenase (cMDH), which mainly participates in the TCA cycle or glyoxylate cycle in prokaryotic cytoplasm and also participates in the eukaryotic cytoplasmic malate-aspartate shuttle pathway, responsible for transferring H+ from NADH in the cytoplasm to oxaloacetate, converting oxaloacetate to malate (Ferraris DM, Spallek R, Oehlmann W, Singh Ma, Rizzi M. Structures of citrate synthase and malate dehydrogenase of Mycobacterium). tuberculosis.[J].Proteins,2015,83(2):389-394), the third type is nicotinamide adenine dinucleotide phosphate (NADP) NADP-MDH, which is mainly found in Corynebacterium glutamicum and Aspergillus spp. (Tóshiko Ts, Nelly AR, AnaL G, María E F.Function,kinetic properties,crystallization,and regulation ofmicrobial malate dehydrogenase[J].Journal of Zhejiang University SCIENCE B,2016,17(4)). In eukaryotic microorganisms, MDH only exists in the form of homodimer, but except for some Gram-positive bacteria and archaea where MDH exists in the form of tetramer, MDH in most bacteria exists in the form of homodimer.MDH, as a diagnostic reagent enzyme, has been used in various quantifications and assays (Liu MY, Chen WW, Xu JM, Fan W, Yang JL, Zheng SJ. The role of VuMATE1 expression in aluminum-inducible citratesecretion in rice bean (Vigna umbellata) roots. [J]. Journal of experimental botany, 2013, 64(7): 1795-1804), such as in the enzyme immunoassay of various compounds, such as in the use of conjugates for drug abuse, repeated treatment of drugs and hormones (Chang YY, Hung CH, Hwang TS, Hsu C H. Cloning, overexpression, purification and crystallization of malate dehydrogenase from Thermus thermophilus [J]. Acta Crystallographica Section F, 2013, 69(11): 1249-1251.).
[0003] MDH, a key enzyme in the central metabolic pathway of organisms, has wide applications in clinical diagnosis and industrial testing, with market demand increasing daily and its value immense. Since the 1950s, researchers have isolated MDH from animal myocardium. Currently, commercially available MDH is mainly extracted from the myocardium, liver, and skeletal muscle of pigs, rabbits, and cattle. While the raw materials are low-cost and widely available, the extraction process is cumbersome, resulting in products with relatively low enzyme activity. Therefore, a thorough understanding of the biochemical characteristics, structure, function, and catalytic mechanism of microbial MDH, the construction of highly active MDH-expressing engineered bacteria, and the optimization of fermentation conditions for production strains are of significant research and application value. Summary of the Invention
[0004] The purpose of this application is to provide a method for preparing malate dehydrogenase in Escherichia coli, which results in high yield, short production cycle, and high activity of the expressed malate dehydrogenase.
[0005] To address the aforementioned technical problems, this application provides a recombinant gene for *Thermophilicus* malate dehydrogenase, the base sequence of which is:
[0006] CATATGAAAGCACCCGTTAGGGTCGCTGTAACAGGCGCGGCTGGCCAGATCGGTTATAGCCTGCTTTTTCGTATTGCCGCTGGCGAGATGCTGGGCAAGGACCAGCCGGTTATCCTGCAGCTGCTAGAGATCCCGCAAGCTATGAAAGCGCTGGAGGGTGTGGTGATGGAGCTGGAAGATTGCGCATTTCCGCTGCTTGCGGGCCTGGAGGCCACCGATGATCCGAAAGTCGCGTTCAAAGACGCCGATTACGCGTTGCTCGTGGGTGCTGCGCCTCGTAAGGCGGGGATGGAGCGCCGTGACCTGCTGCAGGTTAATGGTAAAATTTTCACCGAACAAGGTCGTGCGTTGGCGGAAGTTGCGAAGAAAGACGTGAAAGTTCTGGTGGTGGGTAACCCGGCTAACACCAACGCATTGATCGCCTACAAAAACGCCCCGGGTTTGAATCCGAGGAACTTCACGGCAATGACTCGCCTGGATCACAATCGTGCGAAGGCGCAACTGGCAAAGAAGACCGGTACCGGTGTCGATCGTATTCGCCGCATGACGGTTTGGGGCAATCATTCCAGCACCATGTTCCCGGATTTGTTTCACGCCGAGGTTGACGGCAGACCGGCACTGGAGCTGGTCGACATGGAGTGGTATGAAAAAGTTTTTATCCCGACCGTAGCTCAACGTGGTGCAGCCATCATCCAGGCGCGTGGTGCGTCTAGCGCAGCTTCGGCTGCGAACGCGGCAATTGAGCATATTCGCGATTGGGCCTTAGGAACTCCGGAAGGTGACTGGGTTAGCATGGCGGTCCCGAGCCAGGGTGAATATGGCATTCCGGAGGGCATTGTGTACTCCTTCCCAGTGACCGCTAAGGACGGTGCGTACCGTGTTGTTGAAGGCTTGGAAATCAACGAATTCGCGCGTAAGCGCATGGAAATTACGGCGCAAGAGCTGTTGGACGAAATGGAGCAGGTGAAAGCTCTCGGCCTGATCTAACTCGAG。
[0007] To address the aforementioned technical problems, this application also provides a method for preparing a recombinant gene for malate dehydrogenase from *Thermophilus*, employing the following technical solution:
[0008] Prepare the gene sequence of malate dehydrogenase from Thermophilus thermophilus;
[0009] The gene sequence of the thermophilic bacterium malate dehydrogenase was optimized based on the codon bias of Escherichia coli to obtain the recombinant gene of thermophilic bacterium malate dehydrogenase as described in claim 1.
[0010] To address the aforementioned technical problems, this application also provides a method for preparing malate dehydrogenase, employing the following technical solution:
[0011] A method for preparing malate dehydrogenase includes the following steps:
[0012] The gene sequence of *Thermophilus fasciatus* malate dehydrogenase was used, and the gene sequence of *Thermophilus fasciatus* malate dehydrogenase was optimized by codon preference of *Escherichia coli* to obtain the recombinant gene of *Thermophilus fasciatus* malate dehydrogenase as described in claim 1. A recombinant plasmid of *Thermophilus fasciatus* malate dehydrogenase was constructed based on the recombinant gene of *Thermophilus fasciatus* malate dehydrogenase.
[0013] The recombinant plasmid of the thermophilic bacterium malate dehydrogenase was transformed into Escherichia coli and cultured to obtain a bacterial culture expressing malate dehydrogenase.
[0014] The bacterial culture expressing malate dehydrogenase was purified to obtain malate dehydrogenase.
[0015] Furthermore, the step of constructing a recombinant plasmid of *Thermophilus mesophilus* malate dehydrogenase based on the *Thermophilus mesophilus* malate dehydrogenase recombinant gene includes:
[0016] The recombinant gene of malate dehydrogenase from *Thermophilus fasciatus* was ligated into a vector to obtain the recombinant plasmid of malate dehydrogenase from *Thermophilus fasciatus*.
[0017] Furthermore, the step of transforming the thermophilic bacterium malate dehydrogenase recombinant plasmid into Escherichia coli and culturing it to obtain a bacterial culture expressing malate dehydrogenase includes:
[0018] Single colonies were selected from the *Escherichia coli*, and expression of malate dehydrogenase was obtained by inducing expression in the single colonies with isopropyl thiogalactoside.
[0019] Furthermore, the culture medium used to cultivate the single clonal colonies is kanamycin-resistant medium.
[0020] Furthermore, the step of purifying the bacterial culture expressing malate dehydrogenase to obtain malate dehydrogenase includes:
[0021] The bacterial culture expressing malate dehydrogenase was centrifuged, the bacterial cells were collected, a first buffer solution was added, and the cells were sonicated to obtain a bacterial lysate.
[0022] The bacterial cell lysate was subjected to at least two chromatography analyses to purify the malate dehydrogenase.
[0023] Furthermore, the step of purifying the malate dehydrogenase by performing at least two chromatography analyses on the bacterial cell lysate includes:
[0024] The bacterial cell lysate was subjected to affinity chromatography and ion exchange chromatography in sequence to purify the malate dehydrogenase.
[0025] Furthermore, the step of sequentially performing affinity chromatography and ion exchange chromatography on the bacterial cell lysate to purify the malate dehydrogenase includes:
[0026] The chromatography process uses a second buffer, a third buffer, and a fourth buffer. The first buffer, the second buffer, and the fourth buffer all contain Tris, NaCl, and Glycerol. The molar amounts of NaCl in the first buffer, the second buffer, and the fourth buffer are different. The third buffer contains Tris, NaCl, Glycerol, and imidazole.
[0027] Furthermore, the ion exchange chromatography is HisTrap™ QHP.
[0028] Compared with the prior art, the embodiments of this application have the following main advantages:
[0029] This application utilizes a recombinant fusion of genetically engineered thermophilic bacteria to express malate dehydrogenase, achieving high-density soluble expression of malate dehydrogenase in the supernatant of an *E. coli* system while maintaining enzyme activity. The expressed malate dehydrogenase has advantages such as high yield, short production cycle, high activity, and low cost, enabling the industrial-scale production of malate dehydrogenase. Attached Figure Description
[0030] To more clearly illustrate the solutions in this application, the accompanying drawings used in the description of the embodiments of this application will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0031] Figure 1This is a flowchart of an embodiment of the recombinant gene of thermophilic thermoctomy bacteria malate dehydrogenase, its preparation method and application according to this application;
[0032] Figure 2 This is a schematic diagram of the electrophoresis results of an embodiment of the recombinant gene of thermophilic thermoctomy bacteria malate dehydrogenase, its preparation method and application according to this application;
[0033] Figure 3 This is a schematic diagram of the electrophoresis results of another embodiment of the recombinant gene of thermophilic thermoctomy bacteria malate dehydrogenase, its preparation method and application according to this application;
[0034] Figure 4 This is a schematic diagram of the electrophoresis results of another embodiment of the recombinant gene of thermophilic thermoctomy bacteria malate dehydrogenase, its preparation method and application according to this application;
[0035] Figure 5 This is a schematic diagram of the malate dehydrogenase standard curve results of one embodiment of the recombinant gene of thermophilic thermophilic bacteria malate dehydrogenase, its preparation method and application according to this application; Detailed Implementation
[0036] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains; the terminology used herein in the specification of the application is for the purpose of describing particular embodiments only and is not intended to be limiting of the application; the terms "comprising" and "having," and any variations thereof, in the specification, claims, and foregoing drawings of this application, are intended to cover non-exclusive inclusion. The terms "first," "second," etc., in the specification, claims, or foregoing drawings of this application are used to distinguish different objects, not to describe a particular order.
[0037] In this document, the term "embodiment" means that a particular feature, structure, or characteristic described in connection with an embodiment may be included in at least one embodiment of this application. The appearance of this phrase in various places throughout the specification does not necessarily refer to the same embodiment, nor is it a separate or alternative embodiment mutually exclusive with other embodiments. It will be explicitly and implicitly understood by those skilled in the art that the embodiments described herein can be combined with other embodiments.
[0038] The following embodiments are provided to facilitate a better understanding of this application, but do not limit the scope of this application. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments were purchased from conventional biochemical reagent stores.
[0039] To enable those skilled in the art to better understand the present application, the technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the accompanying drawings.
[0040] A recombinant gene for malate dehydrogenase from *Thermophilus*, wherein the base sequence of the recombinant gene is as follows:
[0041] CATATGAAAGCACCCGTTAGGGTCGCTGTAACAGGCGCGGCTGGCCAGATCGGTTATAGCCTGCTTTTTCGTATTGCCGCTGGCGAGATGCTGGGCAAGGACCAGCCGGTTATCCTGCAGCTGCTAGAGATCCCGCAAGCTATGAAAGCGCTGGAGGGTGTGGTGATGGAGCTGGAAGATTGCGCATTTCCGCTGCTTGCGGGCCTGGAGGCCACCGATGATCCGAAAGTCGCGTTCAAAGACGCCGATTACGCGTTGCTCGTGGGTGCTGCGCCTCGTAAGGCGGGGATGGAGCGCCGTGACCTGCTGCAGGTTAATGGTAAAATTTTCACCGAACAAGGTCGTGCGTTGGCGGAAGTTGCGAAGAAAGACGTGAAAGTTCTGGTGGTGGGTAACCCGGCTAACACCAACGCATTGATCGCCTACAAAAACGCCCCGGGTTTGAATCCGAGGAACTTCACGGCAATGACTCGCCTGGATCACAATCGTGCGAAGGCGCAACTGGCAAAGAAGACCGGTACCGGTGTCGATCGTATTCGCCGCATGACGGTTTGGGGCAATCATTCCAGCACCATGTTCCCGGATTTGTTTCACGCCGAGGTTGACGGCAGACCGGCACTGGAGCTGGTCGACATGGAGTGGTATGAAAAAGTTTTTATCCCGACCGTAGCTCAACGTGGTGCAGCCATCATCCAGGCGCGTGGTGCGTCTAGCGCAGCTTCGGCTGCGAACGCGGCAATTGAGCATATTCGCGATTGGGCCTTAGGAACTCCGGAAGGTGACTGGGTTAGCATGGCGGTCCCGAGCCAGGGTGAATATGGCATTCCGGAGGGCATTGTGTACTCCTTCCCAGTGACCGCTAAGGACGGTGCGTACCGTGTTGTTGAAGGCTTGGAAATCAACGAATTCGCGCGTAAGCGCATGGAAATTACGGCGCAAGAGCTGTTGGACGAAATGGAGCAGGTGAAAGCTCTCGGCCTGATCTAACTCGAG。
[0042] I. This application also provides a method for preparing a recombinant gene of *Thermophilus mesophilus* malate dehydrogenase, comprising: preparing the gene sequence of *Thermophilus mesophilus* malate dehydrogenase; optimizing the gene sequence of *Thermophilus mesophilus* malate dehydrogenase according to the synonymous codon preference of *Escherichia coli*, to obtain the above-mentioned recombinant gene of *Thermophilus mesophilus* malate dehydrogenase.
[0043] II. Continue to refer to Figure 1 The diagram illustrates a flowchart of an embodiment of a method for preparing malate dehydrogenase according to this application. The method for preparing malate dehydrogenase includes the following steps:
[0044] The gene sequence of *Thermophilus melanogaster* malate dehydrogenase was used, and the gene sequence of *Thermophilus melanogaster* malate dehydrogenase was optimized by codon preference of *Escherichia coli* to obtain the above-mentioned recombinant gene of *Thermophilus melanogaster* malate dehydrogenase. Based on the recombinant gene of *Thermophilus melanogaster* malate dehydrogenase, a recombinant plasmid of *Thermophilus melanogaster* malate dehydrogenase was constructed.
[0045] The recombinant plasmid of the thermophilic bacterium malate dehydrogenase was transformed into Escherichia coli and cultured. Single clones were selected for amplification culture and induced expression to obtain bacterial culture expressing malate dehydrogenase.
[0046] The bacterial culture expressing malate dehydrogenase was purified to obtain malate dehydrogenase.
[0047] Specifically, 1) the step of constructing a recombinant plasmid of *Thermophilus mesophilus* malate dehydrogenase based on the *Thermophilus mesophilus* malate dehydrogenase recombinant gene includes:
[0048] The gene sequence of *Thermophilus melanogaster* malate dehydrogenase provided by NCBI was obtained. Using this sequence as a reference and in accordance with the experimental design requirements of this application, the gene sequence of *Thermophilus melanogaster* malate dehydrogenase was optimized using codon preference of *E. coli* to obtain the recombinant gene of *Thermophilus melanogaster* malate dehydrogenase. The recombinant gene of *Thermophilus melanogaster* malate dehydrogenase was ligated into a vector, pET-28a, and the recombinant plasmid of *Thermophilus melanogaster* malate dehydrogenase was synthesized by Nanjing GenScript Biotech Co., Ltd.
[0049] 2) The step of transforming the recombinant plasmid of *Thermophilus thermophilus* malate dehydrogenase into *Escherichia coli* and culturing it to obtain a bacterial suspension expressing malate dehydrogenase includes:
[0050] Single colonies were selected from the *Escherichia coli* for amplification culture and induced expression to obtain a bacterial culture expressing malate dehydrogenase.
[0051] Specifically, under ice bath conditions, 1 μL of the recombinant plasmid of the thermophilic bacterium malate dehydrogenase was added to 30 μL of competent Escherichia coli BL21(DE3), and after being placed in an ice bath for 30 min, it was placed in a water bath at 42°C for 45 s, and then immediately placed on ice for 2 min.
[0052] Add 400 μL of antibiotic-free SOC medium and incubate at 37°C and 230 rpm for 45 min with shaking to obtain bacterial culture;
[0053] Take 100 μL of the bacterial culture and spread it evenly on an LB agar plate containing 100 μg / mL kanamycin resistance. Incubate overnight at 37°C to obtain transformed Escherichia coli.
[0054] Target gene expression process: Single colonies were picked from transformed *E. coli* and aseptically inoculated into TB medium containing 100 μg / mL kanamycin resistance. The culture was incubated at 37°C with shaking at 220 rpm until OD500 was achieved. 600 Induced with IPTG (isopropyl thiogalactoside) at a concentration between 0.6 and 0.8, the culture was incubated at 37°C with shaking for 3 hours, or at 18°C with shaking overnight, to obtain a bacterial culture expressing malate dehydrogenase.
[0055] The obtained bacterial culture expressing malate dehydrogenase was sampled, sonicated, and then analyzed by SDS-PAGE. The results are as follows: Figure 2 As shown, Figure 2 The results showed that a large amount of soluble protein was expressed in TB medium at 18℃ and 37℃.
[0056] 3) The step of purifying the bacterial culture expressing malate dehydrogenase to obtain malate dehydrogenase includes: centrifuging the bacterial culture expressing malate dehydrogenase, collecting the bacterial cells, adding a first buffer solution, and sonicating to obtain bacterial cell lysate;
[0057] The bacterial cell lysate was subjected to at least two chromatography analyses to purify the malate dehydrogenase.
[0058] Furthermore, the bacterial cell lysate was subjected to affinity chromatography and ion exchange chromatography sequentially to purify the malate dehydrogenase. During the chromatography process, a second, third, and fourth buffer were used. The first, second, and fourth buffers each contained Tris, NaCl, and Glycerol, with different molar amounts of NaCl in each buffer. The third buffer contained Tris, NaCl, Glycerol, and imidazole.
[0059] The specific steps are as follows:
[0060] 3.1 Ni column purification:
[0061] Bacterial cells were collected from the bacterial culture of *Escherichia coli* expressing *Thermophilicus* malate dehydrogenase;
[0062] Take 3g of bacterial cells, sonicate them, add 15ml of Lysis Buffer, and resuspend on ice.
[0063] Cell disruption using an ultrasonic disruptor: 10# probe, 10% power, 5.5 seconds of sonication followed by 9.9 seconds of pause, for 30 minutes. Centrifuge at 20,000 rpm, 4°C for 30 minutes. Collect the supernatant, pass it through a membrane at 0.22 sm, and perform affinity chromatography on the supernatant using 1 ml of Ni-NTA at a flow rate of 0.5 ml / min. After loading the sample, wash the UV filter with 15 ml of Lysis Buffer until the UV absorption reaches baseline to obtain the initially purified protein.
[0064] The elution process includes:
[0065] Step 1: 0% B (Buffer B), 8CV, 2ml / min;
[0066] Step 2: 0-60% B (Buffer B), 20CV, 2ml / min;
[0067] Step 3: 100% B (Buffer B), 10CV, 2ml / min.
[0068] After collecting the sample, take 20 μL of elution buffer. The electrophoresis results are as follows: Figure 3 As shown in the diagram, A4-C1 represent the elution buffers in different collection wells. From the purification diagram and electrophoresis results, it can be seen that only a small amount of the target protein breaks through during the permeation, while most of the impurities are expelled. The sample purity is good, and the target protein is eluted at around 95 mM.
[0069] 3.2 Anion exchange column purification
[0070] The initially purified protein was purified by ion column purification using 1 ml HisTrap™ QHP (QHP is the medium used in the anion exchange chromatography of this application) and AKTA Pure (AKTA Pure is a flexible and intuitive protein purification system that can be used to rapidly purify target products such as proteins, peptides, and nucleic acids at the microgram to gram level). A total of 18 ml of affinity product (conductivity 8.55 mS / cm) was added at a flow rate of 0.5 ml / min to obtain the purified malate dehydrogenase. Before loading the sample, the column was equilibrated with a second buffer (Buffer A). After the column was equilibrated, purification was performed. After loading the sample, the UV absorbance was washed with 20 ml of the second buffer (Buffer A) until the conductivity reached the baseline.
[0071] The elution process includes:
[0072] Step 1: 60% C (Buffer C), 20CV, 1ml / min;
[0073] Step 2: 100% C (Buffer C), 10CV, 1ml / min.
[0074] Electrophoresis results after sample collection Figure 4 As shown in the figure, A5-B10 represent the elution buffers in different collection wells. The electrophoresis results show that a small amount of sample passed through the column, while the target protein was mostly attached to the column, with only a small amount of sample passing through.
[0075] The first buffer (Lysis Buffer) consists of 50 mM Tris, 300 mM NaCl, and 5% Glycerol, pH 8.0. The second buffer (Buffer A) consists of 50 mM Tris, 50 mM NaCl, and 5% Glycerol, pH 8.0. The third buffer (Buffer B) consists of 50 mM Tris, 50 mM NaCl, 500 mM imidazole, and 5% Glycerol, pH 8.0. The fourth buffer (Buffer C) consists of 50 mM Tris, 1 M NaCl, and 5% Glycerol, pH 8.0. See Table 1 for details.
[0076] Table 1
[0077] reagents Lysis Buffer BufferA BufferB Buffer C Tris 50mM 50mM 50mM 50mM NaCl 300mM 50mM 50mM 1M Glycerol 5% 5% 5% 10% Imidazole - - 500mM - pH 8.0 8.0 8.0 8.0
[0078] II. Assay of malate dehydrogenase activity
[0079] 1) Solution preparation
[0080] ①Reagent 2: Dissolve in 360μL of double-distilled water.
[0081] ②Reagent 3: Dissolve in 327 μL of double-distilled water.
[0082] ③ Preparation of working solution: Mix reagent 1, reagent 2, and reagent 3 in a volume ratio of 190:2.5:2.5 and use immediately after preparation.
[0083] All the reagents mentioned above were provided by Solarbio, a kit for detecting NAD-malate dehydrogenase (NAD-MDH) activity.
[0084] 2) Experimental Procedure
[0085] ① Preparation of positive enzyme: The stock solution of positive enzyme has a concentration of 20 U / μL. First, dilute it to 1 U / μL, and then dilute it to a positive enzyme concentration gradient as shown in the table below. The diluent is PBS pH 7.4 buffer.
[0086] ② Preheat the microplate reader for 30 minutes and preheat reagent one to 37℃ for 15 minutes.
[0087] ③ Microplate reader program settings: Add 100 μL of reaction solution and detect absorbance value A1 at 340 nm. Then add 1 μL of enzyme solution of each concentration, react for 1 minute, and detect absorbance value A2 at 340 nm.
[0088] ④ Calculate the OD difference A2-A1 before and after the reaction.
[0089] Results of the standard curve of malate dehydrogenase Figure 5 As shown.
[0090] The absorbance of the malate dehydrogenase of this application was measured using the method described above, and the results are shown in the table below:
[0091]
[0092] The stock solution concentration was 0.181 mg / mL, and the activity was 0.101 U / μL, therefore the specific activity was 559.09 U / mg.
[0093] This application utilizes a recombinant fusion of genetically engineered thermophilic bacteria to express malate dehydrogenase, achieving high-density soluble expression of malate dehydrogenase in the supernatant of an *E. coli* system while maintaining enzyme activity. The expressed malate dehydrogenase has advantages such as high yield, short production cycle, high activity, and low cost, enabling the industrial-scale production of malate dehydrogenase.
[0094] It should be understood that although the steps in the flowcharts of the accompanying figures are shown sequentially as indicated by the arrows, these steps are not necessarily executed in the order indicated by the arrows. Unless explicitly stated herein, there is no strict order restriction on the execution of these steps, and they can be executed in other orders. Moreover, at least some steps in the flowcharts of the accompanying figures may include multiple sub-steps or multiple stages. These sub-steps or stages are not necessarily completed at the same time, but can be executed at different times, and their execution order is not necessarily sequential, but can be performed alternately or in turn with other steps or at least some of the sub-steps or stages of other steps.
[0095] Obviously, the embodiments described above are only some embodiments of this application, not all embodiments. The accompanying drawings show preferred embodiments of this application, but do not limit the patent scope of this application. This application can be implemented in many different forms; rather, the purpose of providing these embodiments is to provide a more thorough and comprehensive understanding of the disclosure of this application. Although this application has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing specific embodiments, or make equivalent substitutions for some of the technical features. Any equivalent structures made using the content of this application's specification and drawings, directly or indirectly applied to other related technical fields, are similarly within the scope of patent protection of this application. sequence list <110> Guangzhou Da An Gene Co., Ltd. <120> Base sequence and usage of recombinant plasmid containing malate dehydrogenase from Thermophilus <160> 1 <210> 1 <211> 993 <212> DNA <213> artificial synthesis <400> 1 catatgaaag cacccgttag ggtcgctgta acaggcgcgg ctggccagat cggttatagc 60 ctgctttttc gtattgccgc tggcgagatg ctgggcaagg accagccggt tatcctgcag 120 ctgctagaga tcccgcaagc tatgaaagcg ctggagggtg tggtgatgga gctggaagat 180 tgcgcatttc cgctgcttgc gggcctggag gccaccgatg atccgaaagt cgcgttcaaa 240 gacgccgatt acgcgttgct cgtgggtgct gcgcctcgta aggcggggat ggagcgccgt 300 gacctgctgc aggttaatgg taaaattttc accgaacaag gtcgtgcgtt ggcggaagtt 360 gcgaaaag acgtgaaagt tctggtggtg ggtaacccgg ctaacaccaa cgcattgatc 420 gcctacaaaa acgccccggg tttgaatccg aggaacttca cggcaatgac tcgcctggat 480 cacaatcgtg cgaaggcgca actggcaaag aagaccggta ccggtgtcga tcgtattcgc 540 cgcatgacgg tttggggcaa tcattccagc accatgttcc cggatttgtt tcacgccgag 600 gttgacggca gaccggcact ggagctggtc gacatggagt ggtatgaaaa agtttttatc 660 ccgaccgtag ctcaacgtgg tgcagccatc atccaggcgc gtggtgcgtc tagcgcagct 720 tcggctgga acgcggcaat tgagcatatt cgcgattggg ccttaggaac tccggaaggt 780 gactgggtta gcatggcggt cccgagccag ggtgaatatg gcattccgga gggcattgtg 840 tactccttcc cagtgaccgc taggacggt gcgtaccgtg ttgttgaagg cttggaaatc 900 aacgaattcg cgcgtaagcg catggaaatt acggcgcaag agctgttgga cgaaatggag 960 caggtgaaag ctctcggcct gatctaactc gag 993
Claims
1. A recombinant gene for malate dehydrogenase from thermophilic bacteria, characterized in that, The base sequence of the recombinant gene for malate dehydrogenase from *Thermophilus* is as follows: CATATGAAAGCACCCGTTAGGGTCGCTGTAACAGGCGCGGCTGGCCAGATCGGTTATAGCCTGCTTTTTCGTATTGCCGCTGGCGAGATGCTGGGCAAGGACCAGCCGGTTATCCTGCAGCTGCTAGAGATCCCGCAAGCTATGAAAGCGCTGGAGGGTGTGGTGATGGAGCTGGAAGATTGCGCATTTCCGCTGCTTGCGGGCCTGGAGGCCACCGATGATCCGAAAGTCGCGTTCAAAGACGCCGATTACGCGTTGCTCGTGGGTGCTGCGCCTCGTAAGGCGGGGATGGAGCGCCGTGACCTGCTGCAGGTTAATGGTAAAATTTTCACCGAACAAGGTCGTGCGTTGGCGGAAGTTGCGAAGAAAGACGTGAAAGTTCTGGTGGTGGGTAACCCGGCTAACACCAACGCATTGATCGCCTACAAAAACGCCCCGGGTTTGAATCCGAGGAACTTCACGGCAATGACTCGCCTGGATCACAATCGTGCGAAGGCGCAACTGGCAAAGAAGACCGGTACCGGTGTCGATCGTATTCGCCGCATGACGGTTTGGGGCAATCATTCCAGCACCATGTTCCCGGATTTGTTTCACGCCGAGGTTGACGGCAGACCGGCACTGGAGCTGGTCGACATGGAGTGGTATGAAAAAGTTTTTATCCCGACCGTAGCTCAACGTGGTGCAGCCATCATCCAGGCGCGTGGTGCGTCTAGCGCAGCTTCGGCTGCGAACGCGGCAATTGAGCATATTCGCGATTGGGCCTTAGGAACTCCGGAAGGTGACTGGGTTAGCATGGCGGTCCCGAGCCAGGGTGAATATGGCATTCCGGAGGGCATTGTGTACTCCTTCCCAGTGACCGCTAAGGACGGTGCGTACCGTGTTGTTGAAGGCTTGGAAATCAACGAATTCGCGCGTAAGCGCATGGAAATTACGGCGCAAGAGCTGTTGGACGAAATGGAGCAGGTGAAAGCTCTCGGCCTGATCTAACTCGAG。 2. A method for preparing the recombinant gene of *Thermophilic thermophilus* malate dehydrogenase as described in claim 1, characterized in that, Includes the following steps: Prepare the gene sequence of malate dehydrogenase from Thermophilus thermophilus; The gene sequence of the thermophilic bacterium malate dehydrogenase was optimized based on the codon bias of Escherichia coli to obtain the recombinant gene of thermophilic bacterium malate dehydrogenase as described in claim 1.
3. A method for preparing malate dehydrogenase, characterized in that, Includes the following steps: The gene sequence of *Thermophilus fasciatus* malate dehydrogenase was used, and the gene sequence of *Thermophilus fasciatus* malate dehydrogenase was optimized by codon preference of *Escherichia coli* to obtain the recombinant gene of *Thermophilus fasciatus* malate dehydrogenase as described in claim 1. A recombinant plasmid of *Thermophilus fasciatus* malate dehydrogenase was constructed based on the recombinant gene of *Thermophilus fasciatus* malate dehydrogenase. The recombinant plasmid of the thermophilic bacterium malate dehydrogenase was transformed into Escherichia coli and cultured to obtain a bacterial culture expressing malate dehydrogenase. The bacterial culture expressing malate dehydrogenase was purified to obtain malate dehydrogenase.
4. The method for preparing malate dehydrogenase according to claim 3, characterized in that, The steps of constructing a recombinant plasmid of *Thermophilic thermophilic bacteria* malate dehydrogenase based on the recombinant gene of *Thermophilic thermophilic bacteria* include: The recombinant gene of malate dehydrogenase from *Thermophilus fasciatus* was ligated into a vector to obtain the recombinant plasmid of malate dehydrogenase from *Thermophilus fasciatus*.
5. The method for preparing malate dehydrogenase according to claim 3, characterized in that, The step of transforming the thermophilic bacterium malate dehydrogenase recombinant plasmid into Escherichia coli and culturing it to obtain a bacterial culture expressing malate dehydrogenase includes: Single colonies were selected from the *Escherichia coli*, and expression of malate dehydrogenase was obtained by inducing expression in the single colonies with isopropyl thiogalactoside.
6. The method for preparing malate dehydrogenase according to claim 5, characterized in that, The culture medium used to cultivate the single clonal colonies was kanamycin-resistant medium.
7. The method for preparing malate dehydrogenase according to claim 3, characterized in that, The step of purifying the bacterial culture expressing malate dehydrogenase to obtain malate dehydrogenase includes: The bacterial culture expressing malate dehydrogenase was centrifuged, the bacterial cells were collected, a first buffer solution was added, and the cells were sonicated to obtain a bacterial lysate. The bacterial cell lysate was subjected to at least two chromatography analyses to purify the malate dehydrogenase.
8. The method for preparing malate dehydrogenase according to claim 7, characterized in that, The step of purifying the malate dehydrogenase by performing at least two chromatography analyses on the bacterial cell lysate includes: The bacterial cell lysate was subjected to affinity chromatography and ion exchange chromatography in sequence to purify the malate dehydrogenase.
9. The method for preparing malate dehydrogenase according to claim 8, characterized in that, The step of purifying the malate dehydrogenase by sequentially performing affinity chromatography and ion exchange chromatography on the bacterial cell lysate includes: The chromatography process uses a second buffer, a third buffer, and a fourth buffer. The first buffer, the second buffer, and the fourth buffer all contain Tris, NaCl, and Glycerol. The molar amounts of NaCl in the first buffer, the second buffer, and the fourth buffer are different. The third buffer contains Tris, NaCl, Glycerol, and imidazole.
10. The method for preparing malate dehydrogenase according to claim 8, characterized in that, The ion exchange chromatography used was HisTrap™ QHP.
Citation Information
Patent Citations
Immunogenic compositions comprising mycobacterium tuberculosis polypeptides and fusions thereof
CN104815324A
Preparation of heattresistant malic acid dehydrogenase
JP1980099188A