Compositions for imaging and treatment of liver cancer
By developing a nucleic acid aptamer probe that specifically recognizes PPP1CA, the problem of low early diagnosis rate of liver cancer has been solved, and efficient fluorescence imaging of liver cancer cells and tissues has been achieved, thus improving the accuracy of early diagnosis.
Patent Information
- Application Number
- CN202310616082.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-05-29
- Publication Date
- 2026-05-08
- Estimated Expiration
- 2043-05-29
AI Technical Summary
In current technologies, the early diagnosis rate of liver cancer is low. Traditional imaging techniques have insufficient sensitivity and specificity for detecting small liver cancers. Biomarkers such as AFP also have unsatisfactory sensitivity and specificity. There is a lack of molecular imaging probes that specifically recognize PPP1CA, which often leads to liver cancer patients being diagnosed at an advanced stage.
Nucleic acid aptamer probes that specifically recognize PPP1CA were developed. The nucleic acid aptamers APT03 and APT13, labeled with fluorescent dyes, bind to the PPP1CA protein, and high-efficiency targeting detection of liver cancer is achieved using laser confocal fluorescence imaging.
It achieves highly specific and high-affinity fluorescence imaging of liver cancer cells and tissues, enabling early identification of PPP1CA-positive liver cancer areas, overcoming the shortcomings of traditional methods and improving the early diagnosis rate of liver cancer.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of tumor detection, and more specifically to compositions for imaging and treatment of liver cancer. Background Technology
[0002] Malignant tumors are serious diseases threatening human life, ranking first in mortality among all diseases. Hepatocellular carcinoma (HCC) is the third leading cause of cancer death worldwide. Reports indicate that liver resection (LR), radiofrequency ablation (RFA), and liver transplantation (LT) are currently effective treatments for early and mid-stage HCC. However, late-stage HCC has a high recurrence rate, poor prognosis, and a survival rate of only 23.8%, with end-stage survival even below 2%. Furthermore, early-stage liver cancer often presents insidiously with subtle symptoms and signs, and many patients lack awareness of screening, resulting in a low early diagnosis rate. Patients often seek medical attention at an advanced stage, missing the opportunity for effective treatment.
[0003] As of now, according to documents such as the "Guidelines for the Diagnosis and Treatment of Primary Liver Cancer (2019)," the "Guidelines for Stratified Screening and Monitoring of Primary Liver Cancer (2020 Edition)," and the "Multidisciplinary Expert Consensus on the Diagnosis and Treatment of Precancerous Lesions of Hepatocellular Carcinoma (2020 Edition)," computed tomography (CT), ultrasound, and magnetic resonance imaging (MRI) remain the most commonly used tools for liver cancer detection. Although technological advancements have greatly improved the diagnostic performance of HCC, there are limitations in the diagnosis of early-stage liver cancer. For liver cancer with a diameter <2cm, the sensitivity of ultrasound detection is only 39%. Furthermore, the detection cost is high, and widespread screening is not currently possible. Moreover, sensitivity and specificity are highly dependent on instrument performance and physician experience. In addition, most cases are diagnosed only when liver cancer has progressed to an advanced stage, resulting in a median survival of less than one year for liver cancer patients. Given the current lack of better treatment strategies, effective screening of high-risk groups and early diagnosis of HCC are effective ways to improve survival rates and reduce mortality. For the early detection and diagnosis of small liver cancers, biomarkers offer the greatest advantage. Alpha-fetoprotein (AFP) is by far the most commonly used biomarker for liver cancer screening, early diagnosis, treatment evaluation, and prognosis in clinical practice. However, due to its low sensitivity and specificity, the clinical diagnostic accuracy of AFP is not satisfactory; approximately 30% to 40% of HCC patients are clinically negative for serum AFP. Besides AFP, many other biomarkers are used internationally in conjunction with AFP to increase accuracy, such as DCP, AFP-L3, OPN, GPC3, GP73, Dickkopf-1, PIVKA-II, and Lipocalin-2. However, these biomarkers do not offer advantages over AFP in terms of specificity and sensitivity.
[0004] PPP1CA is the catalytic subunit of protein phosphatase 1alpha. Since its discovery by Professor Li Liangcheng's team in 2015, the RNA and protein expression levels of PPP1CA in exosomes secreted by primary hepatocytes from early-stage liver cancer patients have been found to be significantly higher than those in normal and adjacent normal tissues (Authorization No.: ZL201710308690.0). Notably, PPP1CA also exhibits high expression rates in AFP-negative hepatocellular carcinoma, making it an early warning biomarker. Overcoming the lack of sensitivity for early screening by AFP could, to some extent, compensate for the shortcomings of AFP. PPP1CA is a novel liver cancer biomarker with great potential; however, currently, there are no molecular imaging probes specifically recognizing PPP1CA for clinical application.
[0005] In recent years, molecular imaging has become a rapidly emerging field, attracting widespread attention in biomedical research and clinical diagnostics. Unlike traditional imaging techniques based on morphological information, molecular imaging typically utilizes specific molecular probes to image specific cells, tissues, or living organisms. The design and fabrication of these molecular imaging probes enable the non-invasive, real-time, and in-situ study of molecular-level abnormalities, thus offering the potential for specific in vivo or in vitro diagnostics of diseases such as cancer. Therefore, the development of molecular detection probes with specificity and affinity for recognizing PPP1CA is essential. Summary of the Invention
[0006] Nucleic acid aptamers are relatively new and promising single-stranded oligonucleotides.
[0007] (ssDNA / RNA) aptamers possess unique binding properties to various targets, including cancer biomarkers, cells, tissues, and living organisms. These aptamers not only exhibit excellent affinity and specificity for target recognition, are economical and reproducible, non-toxic, non-immunogenic, and flexible in modification, but also demonstrate rapid target recognition, rapid tumor (cell / tissue) penetration, and good target response in both in vivo and in vitro applications due to their small size. Their emergence provides a new research platform for biochemistry and biomedicine and shows promising application prospects in the field of fluorescence imaging. Therefore, the purpose of this invention is to provide a molecular imaging probe that specifically recognizes PPP1CA.
[0008] To solve the above-mentioned technical problems, the technical solution of the present invention is as follows:
[0009] In a first aspect, a composition for visual imaging of liver cancer regions is provided, comprising a nucleic acid aptamer containing sequences selected from APT03 or APT013, wherein the nucleic acid aptamer is labeled with a fluorescent dye.
[0010] In some embodiments, the nucleic acid aptamer sequence is APT03 or APT013 and a sequence with 90% or more homology, preferably a sequence with 92% or 93%, 95%, 96%, 97%, 98%, 98.5%, 99% or more homology.
[0011] In some embodiments, the fluorescent dye is selected from 6-FAM or cyanine fluorescent dye, preferably Cyc3 or 6-FAM.
[0012] In some embodiments, the composition for visual imaging of hepatocellular carcinoma regions includes an initials DNA library, a mock sequence, and aptamers (APT13 and APT03) targeting the PPP1CA protein, the aptamers being labeled with a fluorescent dye; the initials DNA library, the mock sequence, and the aptamers APT13 and APT03 have the following DNA sequences:
[0013] SEQ ID NO: 1:
[0014] ATTGGCACTCCACGCATAGG-N40-CCTATGCGTGCTACCGT
[0015] GAA
[0016] Mock SEQ ID NO: 1:
[0017] ATTGGCACTCCACGCATAGGTTCACGTTGCCATCACGGTAA
[0018] GATTGCCCTTTGTCTTTGTCCTATGCGTGCTACCGTGAA
[0019] APT03:
[0020] ATTGGCACTCCACGCATAGGTTCACGGTGCCATCACGGTAAGA GTGCCAGTTGTCTTTGTTTCACGGTAGCACGCATAGG,
[0021] APT13:
[0022] ATTGGCACTCCACGCATAGGCACACGGGGGGGTGGGTTGGGTT CTGTGCTGTGATCATCATTCACGGTAGCACGCATAGG.
[0023] In some embodiments, the present invention provides the use of the composition of the first aspect in the identification of tumor tissue, wherein the tumor tissue is liver cancer tissue.
[0024] In some embodiments, the present invention provides the use of the composition described in the first aspect in the detection of liver cancer cells.
[0025] A method for using the composition described in the first aspect for visualization imaging in hepatocellular carcinoma regions includes incubating HepG2 cells expressing PPP1CA with FAM-labeled APT13 aptamers, APT03 aptamers, a library, and a mock sequence, along with a primary antibody against PPP1CA protein, using IgG protein as an isotype control. Localization is then achieved by reacting the primary antibody with a fluorescently labeled secondary antibody. After incubating cell slides with the fluorescently labeled composition, PPP1CA protein is fluorescently localized at the cellular level on the same cell slide and the same frozen tissue section.
[0026] In some embodiments, the tissue is a biological sample from a patient, namely HCC (hepatocellular carcinoma) tissue and adjacent liver tissue. The tumor tissue is liver cancer tissue or liver cancer cells.
[0027] This invention also relates to a method for providing information for tumor diagnosis, capable of providing diagnostic information for liver cancer or liver cancer metastasis, characterized in that it includes:
[0028] (1) Measuring the degree of binding of the aptamer to the cells and tissue biological samples; and / or
[0029] (2) Measuring the degree of colocalization of the aptamer with the protein in the cells and tissue samples; and / or
[0030] (3) Compare the binding degree of the target aptamer to the screening library and the Mock sequence in the liver cancer cells and tissue biological samples; and / or
[0031] (4) Compare the degree of co-localization of the target aptamer with the screening library and the Mock sequence with the protein antibody in the liver cancer cells and tissue biological samples; and / or
[0032] (5) Compare the binding degree of the aptamer in the liver cancer tissue biological sample with the binding degree of the aptamer in its adjacent normal tissue sample, and / or
[0033] (6) Compare the degree of co-localization of the aptamer with the protein antibody in the biological samples of liver cancer tissue and adjacent liver tissue.
[0034] The beneficial effects of this invention are:
[0035] (1) The present invention uses a biomolecular imaging method of aptamers, that is, by using fluorescent dye-labeled targeting aptamers and binding them to the liver cancer cell line (HepG2) expressing serine / threonine protein phosphatase α catalytic subunit receptor (PPP1CA) and liver cancer tissue, high-targeting efficiency tumor detection is achieved by using laser confocal fluorescence imaging.
[0036] (2) In this study, we developed PPP1CA-specific aptamers APT03 and APT13 for specific fluorescence imaging in hepatocellular carcinoma cells, tumor liver tissue sections, or in vivo tissues. During the process, we chose to incubate the aptamers first, and then permeate the cells or tissues to ensure that the interaction between cells and tissues and aptamers under normal physiological conditions is simulated to the greatest extent.
[0037] (3) Laser confocal fluorescence imaging showed that after incubation with APT03 / APT13 aptamers, they rapidly accumulated in PPP1CA-positive hepatocellular carcinoma tissues or cells, while they did not accumulate in PPP1CA-negative adjacent normal tissues. The imaging signal intensity was significantly different from that of the negative control Library, Mock, and their adjacent normal tissues, further demonstrating the targeting of APT03 and APT13 to hepatocellular carcinoma (cells and tissues). Whether at the cellular, tissue, or organ level, APT03 and APT13 exhibit high specificity and affinity for the PPP1CA receptor. Attached Figure Description
[0038] Figure 1 Secondary structure prediction for APT03 and APT13.
[0039] Figure 2 Analysis of cell smear immunofluorescence co-localization. A: HepG2 cells expressing PPP1CA were incubated with 250 nM FAM-labeled APT13 aptamer, APT03 aptamer, Library, and Mock sequences. Fluorescence imaging was used to determine the ability of the aptamers to specifically target the PPP1CA receptor. B: Single-stain antibody group, with IgG as an isotype control, to determine the antibody specificity of PPP1CA. C: Single-stain aptamer group to determine APT03 / APT13 specificity. Red: Primary antibody against PPP1CA and secondary antibody against Cy3-modified IgG; Green: 6-FAM-modified aptamer; Blue: Cell nucleus. Representative images are shown. Scale bar, 20 μm. Figure 3Analysis of immunofluorescence co-localization of frozen sections. A: The expression level of PPP1CA in liver tumor tissues was significantly higher than that in adjacent normal tissues. Tissues were incubated with 250nMFAM-labeled APT13 aptamers, APT03 aptamers, libraries, and mock sequences. Fluorescence imaging was used to further determine the tissue-level and aptamer-specific targeting ability of the PPP1CA receptor. B: Single-stain antibody group, with IgG as an isotype control, to determine the antibody specificity of PPP1CA. C: Single-stain aptamer group, to determine APT03 / APT13 specificity. Red: Primary anti-PPP1CA antibody and Cy3-modified IgG secondary antibody; Green: 6-FAM-modified aptamer; Blue: Cell nucleus. Representative images are shown. Scale bar, 20 μm. Detailed Implementation
[0040] The screening method for nucleic acid aptamers, based on the Magnetic Beads-SELEX technology, screens nucleic acid aptamers that specifically recognize PPP1CA. The screening steps are as follows:
[0041] (1) Construction of the initial ssDNA library: An initial ssDNA library of 80 nt was designed, consisting of 10¹⁴–10¹⁵ random sequences. The sequences at both ends of the initial library were fixed as primer binding sites, each with 20 bases, and the middle random region contained 40 random sequences;
[0042] (2) Coupling of protein and magnetic microspheres: The selected magnetic microspheres (MBs) have a particle size of 2.8 μm and are coated with a layer of carboxyl groups (-COOH). The amino-rich protein (-NH2) is fixed on the surface of the carboxyl MBs by dehydration condensation to obtain protein magnetic beads (MBs@Protein).
[0043] (3) Refolding of ssDNA library: The library was diluted with DPBS buffer, heated in a metal bath at 95°C for 10 min, and then placed at room temperature for 30 min to equilibrate.
[0044] (4) Incubation: The renaturated ssDNA library is incubated with the functionalized protein magnetic beads from step (2). The ssDNA library, which is specific to the protein target, folds itself into a secondary or tertiary structure, and then binds to the protein immobilized on the magnetic beads under optimal conditions to form a nucleic acid aptamer-target complex.
[0045] (5) Separation: Separate the target-bound and unbound ssDNA by magnetic rack separation; (6) Elution: bind the protein immobilized on the magnetic beads to form a nucleic acid aptamer-target complex, resuspend it in 100 μL DPBS, heat it in a metal bath at 95 °C for 10 minutes, repeat the process once, and collect the eluted sample.
[0046] (7) Monitoring: The enrichment of specific nucleic acid aptamers and the richness of the library were analyzed by the amplification curve and melting curve of real-time quantitative PCR (Q-PCR);
[0047] (8) Amplification: The sequence that binds to AFP is amplified by PCR using primers of unequal length;
[0048] (9) Preparation of secondary ssDNA library: dsDNA amplified by PCR with primers of unequal length is separated into ssDNA by 8M urea-polyacrylamide gel electrophoresis (Urea-PAGE) and used as a library for the next round of screening.
[0049] (10) Cyclic screening: The secondary ssDNA library prepared in step (8) is bound to the target, and steps (2)-(9) are repeated to obtain the secondary library for the second round of SELEX screening; the cycle is repeated N times (1≤N≤20) to obtain the secondary library for the N rounds of SELEX screening; specific nucleic acid aptamers can be obtained after several rounds of cyclic screening.
[0050] (11) Preliminary verification of library affinity: Flow cytometry was used to preliminarily investigate the binding affinity of candidate nucleic acid aptamer libraries to PPP1CA;
[0051] (12) Library sequencing: The enriched nucleic acid aptamer library was identified by second-generation high-throughput sequencing method;
[0052] (13) Analysis and characterization of candidate aptamer sequences: ssDNA nucleic acid aptamers with affinity and specific recognition of PPP1CA were screened by sequence structure simulation analysis (UNPACK) and surface plasmon resonance (SPR).
[0053] Example 1
[0054] Cell smear immunofluorescence co-localization
[0055] Cell resuscitation
[0056] In a 50 mL centrifuge tube, take 5 mL of well-mixed ABW, add 45 mL of MEM medium, invert and mix well to prepare the culture medium for HepG2 cell line.
[0057] Take a centrifuge tube and add an appropriate amount of PBS. Add preheated cell culture medium (preheated in a water bath) to a cell culture dish. Remove the cell cryopreservation tube and place it in a pre-prepared 37°C beaker. After thawing, pour the cryopreservation solution into the PBS. Place the centrifuge tube in a centrifuge and centrifuge. Remove the supernatant from the centrifuge tube, then gently tap the tube and add 1 mL of culture medium to resuspend it, being careful to minimize air bubbles. Add the resuspending solution to the preheated culture medium, mix well using the cross-hatching method, and observe the cell distribution under a microscope. Culture the cells in an incubator at 37°C, 5% CO2, and 95% humidity.
[0058] Cell exchange
[0059] Preheat the culture medium, remove the culture dish from the incubator, gently shake it, aspirate the original culture medium, rinse with PBS, add the preheated culture medium, add penicillin / streptomycin antibiotic (100×) diluted to 1×, shake well, and place in the cell culture incubator.
[0060] Cell passage
[0061] Observe the cell density under a microscope to determine if passage is possible. If so, aspirate the old culture medium, wash twice with PBS to eliminate the influence of serum on trypsin, add 0.25% trypsin for digestion, carefully controlling the digestion time. Observe the cell condition under a microscope. If the cells are round and bright, stop digestion with twice the amount of culture medium, blow the medium onto a plate to form a cell suspension, transfer to a centrifuge tube, and centrifuge at 1000 rpm for 3 minutes. After centrifugation, remove the centrifuge tube, discard the supernatant, and gently tap to disperse the precipitate. Resuspend the cells in culture medium and add them to a culture dish pre-filled with culture medium, shaking well. Add antibiotics and observe the distribution under a microscope.
[0062] Cell cryopreservation
[0063] Digest and count the cells, and adjust the cell density. Prepare a cell cryopreservation solution, resuspend the cells, and aliquot the cell suspension into cryovials (1.0 mL / tube). Transfer the cells to a freezer at -80°C. For long-term storage, transfer the cells to a liquid nitrogen tank.
[0064] Preparation and detection process for confocal fluorescence microscopy
[0065] (1) Preparation of 75% alcohol: Add 75 mL of anhydrous ethanol and 25 mL of ddH2O to a centrifuge tube and mix by inverting.
[0066] (2) Treatment of coverslips: Soak in prepared alcohol for at least 20 minutes, and wash with PBS 3 times, each time for at least 5 minutes.
[0067] (3) Cell spreading: Place the prepared coverslip in the center of the 6-well plate, dilute the cells, and add the cells from the center of the coverslip into the wells, ensuring that the cell suspension in each well is 2.5 mL and the cell count is approximately 5.26 × 10⁵ cells per well. Incubate the 6-well plate in an incubator at 37°C, 5% CO₂, and 95% humidity.
[0068] (4) Before removing the 6-well plate, prepare the blocking solution of FAM-labeled aptamers, add the cleaved salmon sperm DNA stock solution to the diluted aptamer solution, and ensure that the concentration of cleaved salmon sperm DNA is 100 μg / mL. Dry bath, equilibrate at room temperature for 1 h.
[0069] (5) Remove the overnight cultured cell slides from the incubator, discard the old culture medium, and wash three times with PBS for 5 min each time. Fix with 4% paraformaldehyde at 4℃ for 30 min, wash three times with PBS, incubate with aptamers, and wash three times with PBS. Permeate on ice for 10 min, and wash three times with PBS. Block with 5% BSA at room temperature for 1 h, incubate with primary antibody at 4℃ overnight, and wash three times with PBS. Incubate with secondary antibody at room temperature, and wash. Add DAPI to the slide and mount with nail polish. (6) Observe using a confocal fluorescence microscope and take pictures to record the results. See below. Figure 2 As shown.
[0070] (7) Results Analysis: To verify the co-localization of APT13, APT03, and PPP1CA antibody, immunofluorescence staining with PPP1CA antibody was performed. Simultaneously, to rule out the potential influence of the presence of PPP1CA antibody on the specificity of APT13 and APT03, controls were established by staining the antibody group and the aptamer group. Laser confocal fluorescence microscopy showed that APT13, APT03, and PPP1CA antibody co-localized with PPP1CA protein in HepG2 cells. Figure 2 A) Compared with the 6-FAM modified Library and the Mock negative control group, the fluorescence signals of the 6-FAM modified APT13 and APT03 aptamers were significantly different from those of the Library and Mock, while the Library and Mock did not show obvious binding to HepG2 cells, and no specific staining was found. Figure 2 A). The control group consisted of the single-stained antibody group and the single-stained aptamer group ( Figure 2(B) and (C) verified that the PPP1CA antibody and the APT13 / APT03 aptamer, even in their absence, did not affect the specificity of PPP1CA protein recognition in HepG2 cells. This also indicates that when APT13 / APT03 co-localizes with the PPP1CA antibody, APT13 and APT03 bind to the PPP1CA protein, not the PPP1CA antibody. These results demonstrate that the APT13 and APT03 aptamers possess a strong internalization ability in HepG2 cells and can specifically target the PPP1CA protein within liver cancer cells.
[0071] Example 2
[0072] Frozen section immunofluorescence co-localization
[0073] (1) Sample collection: Liver tumor tissue and adjacent tissue from the same patient were collected and placed into EP tubes respectively.
[0074] (2) Fixation: The tissue was fixed overnight by immersing it in 4% paraformaldehyde at 4°C.
[0075] (3) Dehydration: Dehydrate overnight with 30% sucrose solution.
[0076] (4) Embedding: Embed the tissue into the embedding box using OCT embedding agent, and slowly place the embedding box into the foam box containing liquid nitrogen. When the bottom of the box comes into contact with the liquid nitrogen, it will begin to vaporize and boil. At this time, keep the small box in place and do not immerse it in the liquid nitrogen. The tissue will quickly freeze into a block in about 10-20 seconds.
[0077] (5) After the tissue blocks are frozen, they can be placed in a cryostat microtome for freezing and sectioning. After sectioning, the remaining tissue blocks are quickly sealed in a self-sealing bag and immediately placed in a -80°C freezer for storage.
[0078] (6) Before using the slices, let them air dry at room temperature for 10-20 minutes.
[0079] (7) Fix sections with 4% paraformaldehyde at 4°C for 30 min, and wash three times with PBS. Draw circles around the tissue with a histochemical pen, incubate aptamers, and wash three times with PBS. Permeate on ice for 10 min, and wash three times with PBS. Block with 5% BSA at room temperature for 1 h, incubate with primary antibody overnight at 4°C, and wash three times with PBS. Incubate with secondary antibody at room temperature, and wash. Add DAPI to a glass slide and mount with nail polish.
[0080] (8) Observe using a confocal fluorescence microscope and take photos to record the results. See below. Figure 3 As shown.
[0081] (9) Results Analysis: To verify whether aptamers APT13 and APT03 can recognize the PPP1CA receptor in human hepatocellular carcinoma tissue, immunofluorescence imaging of frozen sections of human hepatocellular carcinoma tissue and adjacent liver tissue was performed using 6-FAM-labeled APT13 and APT03. Further tissue-level verification of the targeting ability of APT13 and APT03 aptamers was conducted. In liver tumor tissue sections, compared with the 6-FAM-modified Library and the Mock negative control group, the fluorescence signals of APT13 and APT03 aptamers were significantly stronger, and they also showed co-localization with the PPP1CA antibody. However, in adjacent liver tissue, the fluorescence signals of PPP1CA antibody and APT13 and APT03 aptamers were almost undetectable. Figure 3 A). Simultaneously, to demonstrate that APT13 and APT03 binding is due to the PPP1CA protein rather than the PPP1CA antibody, we performed a control group consisting of a single-stained antibody group and a single-stained aptamer group. Laser confocal fluorescence imaging showed that the single-stained antibody group and the single-stained aptamer group ( Figure 3 (B) and (C) verified that the PPP1CA antibody and the APT13 / APT03 aptamer, even in their absence, did not affect the specificity of PPP1CA protein recognition in hepatocellular carcinoma tissue. This also indicates that when APT13 / APT03 co-localizes with the PPP1CA antibody, APT13 and APT03 bind to the PPP1CA protein, not the PPP1CA antibody. These results demonstrate that the APT13 and APT03 aptamers can specifically recognize and bind to the target protein PPP1CA on hepatocellular carcinoma tissue, and that the aptamer's targeting ability depends on PPP1CA expression, showing no specific recognition of adjacent normal tissues that do not express PPP1CA.
[0082] Example 3
[0083] Experimental materials of this invention
[0084] Cell lines and culture conditions
[0085] Human liver cancer cells: HepG2, donated by Professor Song Hua's laboratory, School of Pharmacy, Xiamen University. Culture conditions: MEM medium, 10% fetal bovine serum, 37℃, 5% CO2, 95% humidity.
[0086] With permission from the Ethics Committee of Xiamen University and informed consent from the patients, liver cancer tissue samples were used in this study, provided by the Affiliated Zhongshan Hospital of Xiamen University.
[0087] Antibody
[0088] The antibody species, dilution levels, and sources are shown in Table 2.
[0089] Table 2. Antibodies used in the experiment and antibody companies.
[0090]
[0091] reagents
[0092] The names and sources of the reagents are shown in Table 3.
[0093] Table 3. Reagents Used and Reagent Companies
[0094]
[0095] Laboratory consumables
[0096] The experimental consumables of this invention and their sources are shown in Table 4.
[0097] Table 4 Experimental Consumables
[0098]
[0099]
[0100] Laboratory consumables
[0101] The present invention relates to experimental instruments and their sources, as shown in Table 5.
[0102] Table 5 Experimental Instruments and Instrument Companies
[0103]
[0104]
[0105] Preparation of main reagents
[0106] 11×PBS buffer
[0107] Na2HPO4·12H2O 3.628g
[0108] KH2PO4 0.24g
[0109] KCl 0.2g
[0110] Adjust the pH to 7.4 with 8.0g NaCl, bring the volume to 1L with ddH2O, autoclave for 15 minutes, filter through a 0.22μm membrane, and store at room temperature.
[0111] Sealing liquid
[0112] 5% BSA, dissolved in 1×PBS buffer.
[0113] 1.7.3 Cell cryopreservation solution
[0114] 60% MEM
[0115] 40% ABW
[0116] 5% DMSO
[0117] antibody diluent
[0118] The primary antibody PPP1CA and IgG were diluted with blocking solution at a ratio of 1:100 (1 μg / mL). The secondary antibody Cy3-labeled goat anti-rabbit IgG was diluted with blocking solution at a ratio of 1:500.
[0119] aptamer solution
[0120] APT03 and APT13, sequence details are shown in Table 1, secondary structures are shown in Table 1. Figure 1 As shown. The FAM-labeled aptamer powder was centrifuged at 12000 rpm for 10 min. The powder was dissolved in DPBS to prepare a 100 μM stock solution. Before use, the stock solution was heated at 100°C for 10 min, vortexed, centrifuged, and equilibrated at room temperature for 30-60 min to complete renaturation. The remaining stock solution was stored at -20°C. It should be protected from light during use.
[0121] Table 1. Sequence information of APT03 and APT13
[0122]
[0123] The sequence of the library is selected as shown in SEQ ID NO: 1:
[0124] ATTGGCACTCCACGCATAGG-N40-CCTATGCGTGCTACCGTGAA
[0125] The negative control mock sequence is shown in SEQ ID NO: 2:
[0126] ATTGGCACTCCACGCATAGGTTCACGTTGCCATCACGGTAAGATTGCCCTTTGTCTTTGTCCTATGCGTGCTACCGTGAA.
Claims
1. A visualization imaging composition comprising a nucleic acid aptamer, characterized in that, The nucleic acid aptamer includes APT13, wherein the nucleic acid aptamer is labeled with a fluorescent dye; the sequence of APT13 is ATTGGCACTCCACGCATAGGCACACGGGGGGTGGGTTGGGTTCTGTGCTGTGATCATCATTCACGGTAGCACGCATAGG.
2. The composition according to claim 1, characterized in that, The fluorescent dye is selected from 6-FAM or cyanine fluorescent dye.
3. The composition according to claim 2, characterized in that, The fluorescent dye is Cy3.
4. The composition according to any one of claims 1-3, characterized in that, It also includes the screening library sequence SEQ ID NO: 1 and the negative control Mock sequence SEQ ID NO:
2.
5. The use of the composition according to any one of claims 1-4 in the preparation of a tumor tissue identification reagent.
6. The application as described in claim 5, wherein the tumor tissue is liver cancer tissue or liver cancer cells.
Citation Information
Patent Citations
PPP1CA as a biomarker for the diagnosis and prognosis of liver cancer and its application
CN107271670B
Aptamer for targeting damaged pancreatic tissue, and construction and application of aptamer engineering modified exosome
CN116716304A
Nucleic acid aptamer for specifically recognizing alpha fetoprotein and screening method thereof
CN117106784A