Use of microRNA derived from palm charcoal or combinations thereof in the preparation of a hemostatic medicament

By identifying and enriching ath-miR159a, cpa-miR159b, and ath-miR166a-3p in palm charcoal, and targeting the 3'-UTR of ADRA2C and t-PA, the unknown mechanism of palm charcoal's hemostatic synergistic effect was resolved, achieving a significant hemostatic effect.

CN116726038BActive Publication Date: 2026-04-17NANJING UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NANJING UNIV
Filing Date
2022-03-04
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

Existing technologies cannot explain the mechanism by which palm charcoal enhances hemostasis after charring, and it is unknown whether palm charcoal contains miRNA and its function.

Method used

The three microRNAs ath-miR159a, cpa-miR159b, and ath-miR166a-3p were enriched in palm charcoal. By targeting the 3'-UTR of ADRA2C and t-PA, the expression of the corresponding genes was inhibited, thereby enhancing the hemostatic effect.

Benefits of technology

The miRNA content in palm charcoal was significantly higher than that in the raw product. ath-miR159a and cpa-miR159b bound ADRA2C, while ath-miR166a-3p inhibited t-PA, promoting vasoconstriction and hemostasis, and enhancing the hemostatic effect.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116726038B_ABST
    Figure CN116726038B_ABST
Patent Text Reader

Abstract

This invention discloses the application of microRNAs or combinations thereof derived from palm charcoal in the preparation of hemostatic drugs. The microRNAs derived from palm charcoal are selected from any one of ath-miR159a, cpa-miR159b, and ath-miR166a-3p. This study identified miRNAs in palm charcoal and clarified the changes in miRNAs after palm is processed into charcoal drugs. ath-miR159a and cpa-miR159b in palm charcoal can bind to the 3'-UTR of ADRA2C. ath-miR166a-3p in palm charcoal can target and inhibit the expression and secretion of t-PA in HUVEC cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine and relates to the application of microRNA or combinations thereof derived from palm carbon in the preparation of hemostatic drugs. Background Technology

[0002] The clinical application of charred Chinese medicinal herbs has a long history, as it can enhance or produce astringent and hemostatic effects. Palm charcoal is bitter, astringent, and neutral in nature, and enters the lung, liver, and large intestine meridians. It possesses astringent and hemostatic properties. [1] It is used to treat hematemesis, epistaxis, hematuria, hematochezia, and metrorrhagia. [1] Palm has a long history of medicinal use, and traditional Chinese medicine has accumulated rich experience in its clinical application. Throughout history, only charred palm has been used in medicine to enhance its efficacy. After being charred, palm undergoes significant changes in its medicinal properties, functions, and physicochemical properties, which inevitably involve changes in its intrinsic material basis. While some studies have been conducted on the changes in components and efficacy of palm char before and after charring, the mechanism by which charred palm enhances hemostasis remains unclear. Therefore, exploring the effective components, sites of action, and mechanisms of action of charred palm for hemostasis is of great significance.

[0003] microRNAs (miRNAs) are non-coding RNAs approximately 22 nucleotides in length that bind inversely to the 3' untranslated regions (UTR) of target mRNAs, negatively regulating the post-transcriptional levels of the target genes. [2] Exogenous plant miRNAs can enter the circulatory system and various organs through the gastrointestinal tract and participate in cross-border regulation in humans and animals. [3] Studies have reported that miRNAs may be a potentially important natural active ingredient in traditional Chinese medicine. However, miRNAs are unstable. Do miRNAs still exist in carbonized medicinal materials? Does the miRNA content change between raw palm leaves and palm charcoal? Do miRNAs in palm charcoal have hemostatic effects? All of these questions have not yet been reported and cannot be predicted from published literature. Summary of the Invention

[0004] The purpose of this invention is to address the above-mentioned shortcomings of the prior art by providing the application of microRNA derived from palm charcoal or combinations thereof in the preparation of hemostatic drugs.

[0005] Another object of the present invention is to provide the application of reagents for detecting ath-miR159a, cpa-miR159b and ath-miR166a-3p in the quality control or efficacy evaluation of palm charcoal.

[0006] The objective of this invention can be achieved through the following technical solutions:

[0007] The application of microRNA derived from palm charcoal or combinations thereof in the preparation of hemostatic drugs, wherein the microRNA derived from palm charcoal is selected from any one of ath-miR159a, cpa-miR159b, and ath-miR166a-3p. The ath-miR159a sequence is: UUUGGAUUGAAGGGAGCUCUA (SEQ ID NO.1), the cpa-miR159b sequence is: CUUGGAUUGAAGGGAGCUCC (SEQ ID NO.2), and the ath-miR166a-3p sequence is: UCGGACCAGGCUUCAUUCCCC (SEQ ID NO.3).

[0008] Application of the combination of ath-miR159a, cpa-miR159b and ath-miR166a-3p as a target in the quality control or efficacy evaluation of palm charcoal.

[0009] Application of reagents for detecting ath-miR159a, cpa-miR159b and ath-miR166a-3p in quality control or efficacy evaluation of palm charcoal.

[0010] A kit for quality control or efficacy assessment of palm charcoal, characterized by containing primers for detecting ath-miR159a, cpa-miR159b and ath-miR166a-3p.

[0011] Beneficial effects:

[0012] Palm charcoal is a hemostatic agent produced by high-temperature charring at 300℃. Previously, it was widely believed that RNA would be destroyed during this process. However, our data shows that after charring at 300℃, palm charcoal not only remains rich in ath-miR159a, cpa-miR159b, and ath-miR166a-3p, but also contains significantly higher levels of these compounds than raw palm leaves. This study, through bioinformatics analysis and in vitro research, found that both ath-miR159a and cpa-miR159b can bind to the 3'-UTR of ADRA2C, while ath-miR166a-3p can bind to the 3'-UTR of t-PA and inhibit t-PA expression. When small blood vessels are damaged, the damaged vessel wall immediately constricts, reducing the vessel diameter and blood flow velocity, thereby decreasing blood outflow from the damaged site. Vasomotor vasoconstriction is the result of the combined effects of neural reflexes, local myogenic vasoconstriction, and humoral factors released from platelets and damaged tissues. Among these, adrenaline and noradrenaline act on local blood vessels, playing a crucial role in regulating local tissue blood flow. ADRA2C is mainly distributed in adrenal chromaffin cells and the presynaptic membrane of noradrenergic neurons. It promotes K+ kinase activity by inhibiting the adenylate cyclase (AC)-cyclic adenosine monophosphate (cAMP)-protein kinase A (PKA) signaling pathway. + Influx and inhibition of Ca 2+ internal flow

[14] It inhibits the secretion of adrenaline. t-PA is mainly produced by vascular endothelial cells and damaged tissues. t-PA activates plasminogen to generate active plasmin, thereby promoting the dissolution and liquefaction of thrombi.

[15] Therefore, we hypothesize that ath-miR159a and cpa-miR159b in palm charcoal may participate in the hemostatic effect of palm charcoal by targeting ADRA2C expression, promoting adrenaline secretion, reducing capillary permeability, enhancing capillary resistance to damage, and promoting contraction of damaged capillary ends. Simultaneously, we hypothesize that ath-miR166a-3p in palm charcoal can target and inhibit t-PA expression, inhibit fibrinolytic system activation, reduce thrombus dissolution, and thus further achieve hemostasis. Therefore, any one or a combination of ath-miR159a, cpa-miR159b, and ath-miR166a-3p can be used in the preparation of hemostatic drugs. Attached Figure Description

[0013] Figure 1 Small RNA sequencing results of raw and charred palm products.

[0014] (A) Agilent 2100 Bioanalyzer detection graph. (B) Heatmap of small RNA sequencing results from raw palm and palm charcoal. (C) Statistical graph of cpa-miR159b, ath-miR159a, and ath-miR166a-3p in small RNA sequencing of raw palm and palm charcoal.

[0015] Figure 2 Statistical graphs of the levels of ath-miR159a, cpa-miR159b, and ath-miR166a-3p per gram of raw palm oil and its charred form, detected by RT-qPCR. (A) Statistical graph of ath-miR159a in raw palm oil and charred palm oil. (B) Statistical graph of cpa-miR159b in raw palm oil and charred palm oil. (C) Statistical graph of ath-miR166a-3p in raw palm oil and charred palm oil. Mean ± SD, n = 4–6.

[0016] Figure 3 Bioinformatics analysis of the target sites and signaling pathways of ath-miR159a, cpa-miR159b, and ath-miR166a-3p. (A) Enrichment of the target sites of ath-miR159a, cpa-miR159b, and ath-miR166a-3p. (B) Signaling pathways acted upon by the targets of ath-miR159a, cpa-miR159b, and ath-miR166a-3p.

[0017] Figure 4 Schematic diagrams predicting the binding sites of ath-miR159a, cpa-miR159b, and ath-miR166a-3p to target genes. (A) Schematic diagram of the binding site of ath-miR159a to the ADRA2C 3'-UTR region. (B) Schematic diagram of the binding site of cpa-miR159b to the ADRA2C 3'-UTR region. (C) Schematic diagram of the binding site of ath-miR166a-3p to the t-PA 3'-UTR region. Binding site (red rectangle); binding free energy (ΔG) and seed sequence of miRNA (red).

[0018] Figure 5 The binding of ath-miR159a, cpa-miR159b, and ath-miR166a-3p to the target genes ADRA2C and t-PA 3'-UTR was detected using a luciferase reporter gene assay. Mean ± SD, n = 3. ** P < 0.01, *** P < 0.001 compared to ncRNA.

[0019] Figure 6The mRNA expression of ADRA2C and t-PA was detected in vitro by ath-miR159a, cpa-miR159b, and ath-miR166a-3p. (A) Statistical graph of ath-miR159a after transfection of HEK293T cells with ath-miR159a. (B) Statistical graph of cpa-miR159b after transfection of HEK293T cells with cpa-miR159b. (C) Statistical graph of ath-miR166a-3p after transfection of HUVEC cells with ath-miR166a-3p. (D) Statistical graph of ADRA2C mRNA expression after transfection of HEK293T cells with ath-miR159a. (E) Statistical graph of ADRA2C mRNA expression after transfection of HEK293T cells with cpa-miR159b. (F) Statistical graph of t-PA mRNA expression in HUVEC cells after transfection with ath-miR166a-3p. Mean ± SD, n = 3. * P < 0.05 *** P < 0.001 compared to ncRNA.

[0020] Figure 7 Western blot analysis of the effect of ath-miR166a-3p on t-PA protein expression in HUVEC cells. Mean ± SD, n = 3. ** P < 0.01 compared to ncRNA.

[0021] Figure 8 Effects of ath-miR166a-3p on t-PA secretion in HUVEC cells.

[0022] Mean±SD, n=3. ** P < 0.01 compared to ncRNA.

[0023] Figure 9 Effect of ath-miR166a-3p on the activity of t-PA-activated plasminogen secreted by HUVEC cells. Mean ± SD, n = 3. *** P < 0.001 compared to ncRNA. Detailed Implementation

[0024] I. Materials and Methods

[0025] 1. Experimental Materials

[0026] 1.1 Cell lines

[0027] Human renal epithelial cells (HEK293T) and human umbilical vein endothelial cells (HUVEC) were purchased from the Shanghai Institute of Cell Biology, Shanghai Institutes for Biological Sciences.

[0028] 1.2 Main experimental reagents (see Table 1)

[0029] Table 1. Experimental Reagent Information

[0030]

[0031]

[0032] 1.3 Main experimental instruments (see Table 2)

[0033] Table 2 Main Instrument Information

[0034] Instrument Name company 5424R Tabletop Refrigerated Centrifuge Eppendorf PTC-1148 PCR instrument Bio-Rad DYY-6C Constant Current and Voltage Electrophoresis System Puyang Scientific Instruments Research Institute Western blot imaging instrument Tianneng CLARIOstar Multi-wavelength Microplate Reader BMG LABTECH

[0035] 2. Experimental Methods

[0036] 2.1 Cell line culture

[0037] (1) HEK293T cell culture

[0038] HEK293T cells were cultured in DMEM medium containing 10% fetal bovine serum (100 U / mL each of penicillin and streptomycin), and then placed in a cell culture incubator at 37°C and 5% CO2 concentration.

[0039] (2) HUVEC cell culture

[0040] HUVEC cells were cultured in 1640 medium containing 10% fetal bovine serum (100 U / mL each of penicillin and streptomycin), and then placed in a cell culture incubator at 37°C and 5% CO2 concentration.

[0041] 2.2 Processing of Palm Charcoal

[0042] Before calcination, remove impurities from the palm leaves and wash them thoroughly, then dry them at 80℃. Place 20g of raw palm leaves in a pot, not exceeding one-third of the evaporating dish's capacity. During calcination, cover the pot with a small evaporating dish and apply a weight. Seal the joint with damp paper first, then seal it with yellow clay. Attach a strip of white paper to the pot; when the paper turns a deep yellow, turn off the heat (heat at 300℃ for 30 minutes). Remove the herbs from the pot after they have cooled completely.

[0043] 2.3 Small RNA Sequencing of Raw Palm Products and Charred Pharmaceuticals

[0044] Fresh palm fiber and palm charcoal were crushed and ground, then filtered through a 40-mesh filter. Small RNA was extracted from 2g of fresh palm fiber and palm charcoal powder using a universal plant microRNA extraction kit, following the manufacturer's instructions. RNA concentration was then detected using a nanodrop 2000. The extracted small RNA was sent to BGI Genomics for smallRNA sequencing, and the data analysis was performed by BGI.

[0045] 2.4 RNA extraction and RT-qPCR detection

[0046] (1) The raw palm product and palm charcoal were crushed and ground, and then filtered through a 40-mesh filter. The raw palm product and palm charcoal powder were collected. 1g of raw palm product and palm charcoal powder were added to 100mL of water and boiled for 30min to obtain 5ml of raw palm product and palm charcoal broth. Small RNA was extracted from the raw palm product, palm charcoal powder, and broth using a universal plant microRNA extraction kit. The experimental procedure was performed according to the instructions. The RNA concentration was then detected using a nanodrop 2000. Plant miRNA was quantitatively detected using the probe method from ABI. The miRNA reverse transcription reaction system was as follows: DEPC treated water 3.5μL, 5×AMV Buffer 2μL, 10mM dNTP 1μL, RT proke 1μL, AMV enzyme 0.5μL, RNA 2μL. The reverse transcription program was as follows: 16℃ 30min, 42℃ 30min, 85℃ 5min, 4℃∞. miRNA quantification was performed using a probe-based method. The reaction system and procedure were as follows: ddH₂O 14.77 μL, 10×PCR buffer 2 μL, MgCl₂ 1.2 μL, dNTP mixture 0.4 μL, TMproke 0.33 μL, Taq enzyme 0.3 μL, and cDNA 1 μL. The PCR reaction conditions were: pre-denaturation at 95℃ for 5 min, followed by 40 cycles of denaturation at 95℃ for 15 sec and annealing at 60℃ for 60 sec. Absolute quantification of miRNA expression levels was performed using miRNA standards.

[0047] (2) Add 1 mL of Trizol to the cells, vortex for 20 seconds, and let stand at room temperature for 10 min; add 200 μL of chloroform, vortex for 20 seconds, and let stand at room temperature for 10 min; centrifuge at 16000 g × 20 min at 4 °C; transfer the supernatant to a new enzyme-free EP tube, add 800 μL of isopropanol, invert and mix, and let stand at room temperature for 10 min; centrifuge at 16000 g × 20 min at 4 °C and discard the supernatant; then add 1 mL of ethanol prepared with 75% DEPC water, vortex and mix, centrifuge at 16000 g × 20 min at 4 °C and discard the supernatant; air dry at room temperature; dissolve in DEPC water and detect RNA concentration using nanodrop 2000. The miRNA reverse transcription reaction system was as follows: DEPC-treated Water 3.25 μL, 5×AMV Buffer 2 μL, 10 mM dNTP 1 μL, RT primer 1 μL, AMV enzyme 0.5 μL, RRI 0.25 μL, RNA 2 μL. The reverse transcription program was as follows: 16℃ for 30 min, 42℃ for 30 min, 85℃ for 5 min, 4℃ to infinity. The mRNA reverse transcription reaction system was as follows: DEPC-treated Water 3.25 μL, 5×AMV Buffer 2 μL, 10 mM dNTP 1 μL, Oligo dT 1 μL, AMV enzyme 0.5 μL, RRI 0.25 μL, RNA 2 μL. mRNA quantification was performed using the SYBR Green assay. The reaction system and procedure were as follows: ddH₂O 11.5 μL, Taq polymerase 0.3 μL, 10×PCR buffer 2 μL, SYBR Green 1 μL, MgCl₂ 1.2 μL, dNTP mixture 1 μL, forward primer 1 μL, reverse primer 1 μL, cDNA 1 μL. The PCR conditions were: pre-denaturation at 95℃ for 5 min, followed by 40 cycles of denaturation at 95℃ for 15 sec, annealing at 60℃ for 60 sec, and extension at 72℃ for 30 sec, and a final extension at 72℃ for 10 min. ADRA2C and t-PA mRNA expression levels were measured using GAPDH as an internal control. The mRNA primer sequences were synthesized by GenScript and are as follows:

[0048] Table 3 Primer sequences

[0049]

[0050] 2.5 Protein extraction and Western Blot detection

[0051] Cells were collected and lysed with RIPA lysis buffer on ice for 30 min; centrifuged at 16000g for 20 min at 4℃, and the supernatant was collected into a new EP tube; then, protein concentration was determined using the BCA method. 5× Loading Buffer was added, and the sample was heated in a 99℃ metal bath for 10 min and stored at -80℃. SDS-PAGE gels were prepared according to the instructions of the PAGE gel rapid preparation kit (12.5%), 50 μg of sample was loaded, electrophoresis was performed at 80V for 30 min, followed by electrophoresis at 120V for 1.5 h, transfer at 300mA for 1.5 h, and blocking with 5% skim milk for 1 h. Primary antibody dilutions were as follows: anti-t-PA antibody (1:2000), anti-GAPDH antibody (1:1000), and incubated overnight. The next day, the membrane was washed with TBST for 10 min × 4 times, incubated with mouse secondary antibody (1:1000) for 30 min, and washed with TBST for 10 min × 4 times. The samples were exposed on an exposure unit using the Omni-ECL™ enhanced chemiluminescence detection kit, and the gray values ​​of the bands were analyzed using ImageJ software.

[0052] 2.6 Luciferase Reporter Gene Assay

[0053] To verify the interactions between ath-miR159a and cpa-miR159b and ADRA2C mRNA, and the interactions between ath-miR166a-3p and t-PA mRNA, a luciferase reporter gene assay was used to verify the 3'-UTR binding of ath-miR159a and cpa-miR159b to ADRA2C mRNA, and the 3'-UTR binding of ath-miR166a-3p to t-PA mRNA. First, a wild-type (WT) luciferase reporter plasmid was constructed by inserting the 3'-UTR sequence fragment of the mRNA containing the miRNA binding site into the pGL3-Basic vector (GenScript). Simultaneously, a mutation in the binding site sequence was also inserted into the pGL3-Basic vector to construct a mutant (MUT) luciferase reporter plasmid. A β-galactosidase reporter plasmid (β-gal) was used as a control to correct for operational errors and was transfected into cells simultaneously with the luciferase reporter plasmid. HEK293T cells and HUVEC cells were seeded in 24-well plates. When the cell density reached approximately 70%, 0.2 μg of WT / MUT luciferase reporter plasmid and 0.1 μg of β-galactosidase reporter plasmid were simultaneously transfected into the cells. The β-gal plasmid was used as a control to correct for operational errors. After 24 hours, luciferase reporter gene assays were performed using the Promega Luciferase assay system kit, following the instructions.

[0054] 2.7 Detection of t-PA levels in HUVEC cell culture medium by ELISA

[0055] HUVEC cell culture medium was collected and tested using a t-PA ELISA kit (DTPA00, R&D Systems) in accordance with the instructions.

[0056] 2.8 Synthetic luminescent substrate method for detecting plasmin activity

[0057] Add 40 μL of 1 μg / μL plasminogen (P7999-10UN, Sigma) to 20 μL of HUVEC cell culture medium, then add 2 mg / mL substrate (S-2251, Chromogenix) to a final concentration of 0.5 mM. Immediately afterward, measure the absorbance using a microplate reader at 405 nm.

[0058] 2.9 Data Statistical Analysis

[0059] Results are expressed as Mean ± SD. Data were analyzed using the student t-test for inter-group differences. GraphPadPrism 7 software was used to process the data and obtain images. P < 0.05 was considered statistically significant.

[0060] III. Experimental Results

[0061] 1. Small RNA sequencing analysis of raw palm products and palm charcoal

[0062] To determine whether raw and charred palm products contained miRNAs, this study first performed small RNA sequencing on two raw and two charred palm samples using the HiSeq platform. Small RNAs extracted from both raw and charred palm products were quality controlled using an Agilent 2100 bioanalyzer. Results showed that the small RNA samples from both raw and charred palm products were suitable for quality control. Figure 1 A) However, library construction for Palm Fiber 2 failed. Final sequencing results showed that 63, 63, and 67 plant miRNAs were detected in Palm Fiber 1, Palm Charcoal 1, and Palm Charcoal 2, respectively. (For example...) Figure 1 As shown in B and C, sequencing results revealed that the miRNA content in palm charcoal was significantly higher than that in raw palm. Specifically, the contents of cpa-miR159b, ath-miR159a, and ath-miR166a-3p were highest and showed the most significant changes in palm charcoal. These results suggest that both raw and charred palm contain miRNAs, and that the miRNA content increases after charcoal processing.

[0063] 2. RT-qPCR detection of the contents of ath-miR159a, cpa-miR159b and ath-miR166a-3p in raw palm products and palm charcoal.

[0064] To further verify the content of ath-miR159a, cpa-miR159b, and ath-miR166a-3p in the decoction and preparation of raw palm leaves and palm charcoal, this study used RT-qPCR to detect the levels of cpa-miR159b, ath-miR159a, and ath-miR166a-3p in both raw palm leaves and their decoction. Figure 2 The contents of cpa-miR159b, ath-miR159a, and ath-miR166a-3p in 1g of raw palm were 0.01249 fmol / g, 0.1277 fmol / g, and 0.02900 fmol / g, respectively; the contents of cpa-miR159b, ath-miR159a, and ath-miR166a-3p in palm charcoal soup (0.2g palm charcoal / ml) were 0.0023 fmol / ml, 0.0203 fmol / ml, and 0.0131 fmol / ml, respectively. Figure 2 ).

[0065] 3. Predicted target sites and signaling pathways of palmitic acid ath-miR159a, cpa-miR159b, and ath-miR166a-3p.

[0066] To clarify the target mechanisms of miR159a, cpa-miR159b, and ath-miR166a-3p, this study used RNAhybrid software to predict and analyze the targets of these three miRNAs. A total of 11,893 human targets and 11,821 mouse targets were identified. After reorganization and screening of these targets, with free energy < -20 and P < 0.05, 148 human targets meeting the criteria were selected. Gene enrichment and signaling pathway analysis of these targets are as follows: Figure 3 A and B.

[0067] 4. Bioinformatics prediction of the binding of ath-miR159a, cpa-miR159b, and ath-miR166a-3p to the target.

[0068] like Figure 4As shown, RNAhybrid software analysis revealed that the binding free energy of ath-miR159a to the 3'-UTR of norepinephrine receptor α2C (ADRA2C) mRNA is -32.1 kcal / mol; the binding free energy of cpa-miR159b to the 3'-UTR of ADRA2C mRNA is -32.1 kcal / mol; and the binding free energy of ath-miR166a-3p to the 3'-UTR of tissue plasminogen activator (t-PA) mRNA is -32.5 kcal / mol.

[0069] 5. Verify the binding of ath-miR159a, cpa-miR159b, and ath-miR166a-3p to the 3'-UTR of target genes ADRA2C and t-PA mRNA.

[0070] To verify the interaction between ath-miR159a, cpa-miR159b, and ath-miR166a-3p and target mRNAs (ADRA2C and t-PA), a luciferase reporter gene assay was used to verify the binding of ath-miR159a, cpa-miR159b, and ath-miR166a-3p to the 3'-UTR of the target mRNA. Figure 5 As shown, HEK239T cells were all transfected with the ADRA2C luciferase reporter plasmid. Compared with co-transfection with the control mimic, co-transfection with ath-miR159a or cpa-miR159b significantly reduced luciferase activity. HUVEC cells were all transfected with the t-PA luciferase reporter plasmid. Compared with co-transfection with the control mimic, co-transfection with ath-miR166a-3p significantly reduced luciferase activity. Furthermore, after transfection with a luciferase reporter plasmid containing an insertion binding site mutation, overexpression of ath-miR159a, cpa-miR159b, or ath-miR166a-3p had no effect on luciferase activity. Figure 5 The above experimental results confirm that ath-miR159a and cpa-miR159b can bind to the 3'-UTR of ADRA2C mRNA, and that ath-miR166a-3p can bind to the 3'-UTR of t-PA mRNA.

[0071] 6. ath-miR159a, cpa-miR159b, and ath-miR166a-3p had no significant effect on the expression of target genes ADRA2C and t-PA mRNA.

[0072] like Figure 6 As shown, HEK293T cells were transfected with ath-miR159a and cpa-miR159b mimics in vitro to detect ADRA2C mRNA expression; HUVEC cells were transfected with ath-miR166a-3p mimics in vitro to detect t-PA mRNA expression. RT-qPCR results showed that transfection of HEK293T cells with ath-miR159a and cpa-miR159b mimics significantly increased the expression of both ath-miR159a and cpa-miR159b mimics. Figure 6 AB), while ADRA2C mRNA expression did not change significantly ( Figure 6 DE). Transfection of HUVEC cells with ath-miR166a-3p mimic significantly increased the expression of ath-miR166a-3p mimic in HUVEC cells. Figure 6 C), while t-PA mRNA expression did not change significantly (Figure 6F).

[0073] 7. ath-miR166a-3p inhibits t-PA protein expression in HUVEC cells.

[0074] like Figure 7 As shown, HUVEC cells were transfected with ath-miR166a-3p mimic in vitro, and t-PA protein expression was detected by Western blot. 48 h after transfection, Western blot results showed that ath-miR166a-3p mimic significantly downregulated t-PA protein expression.

[0075] 8. ath-miR166a-3p inhibits t-PA secretion in HUVEC cells.

[0076] like Figure 8 As shown, HUVEC cells were transfected with ath-miR166a-3p mimic in vitro, and the secretion of t-PA in the HUVEC cell culture medium was detected by ELISA. The results showed that ath-miR166a-3p significantly reduced the secretion of t-PA in HUVEC cells.

[0077] 9. ath-miR166a-3p reduces the activation of plasminogen by t-PA secreted by HUVEC cells.

[0078] like Figure 9As shown, HUVEC cells were transfected with ath-miR166a-3p mimic in vitro, and the activation of plasminogen by t-PA secreted by HUVEC cells was measured using a synthetic luminescent substrate method. The results showed that ath-miR166a-3p mimic significantly reduced the activation of plasminogen by t-PA secreted by HUVEC cells.

[0079] in conclusion:

[0080] I. This invention identifies miRNAs in palm charcoal and clarifies the changes in miRNAs after palm is processed into charcoal medicine.

[0081] II. In palm charcoal, ath-miR159a and cpa-miR159b can bind to the 3'-UTR of ADRA2C.

[0082] 3. The ath-miR166a-3p in palm charcoal can target and inhibit the expression and secretion of t-PA in HUVEC cells. sequence list <110> Nanjing University <120> Application of microRNA or combinations thereof derived from palm charcoal in the preparation of hemostatic drugs <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty one <212> RNA <213> Human beings (Homo sapiens) <400> 1 uuuggauuga agggagcucu a 21 <210> 2 <211> 20 <212> RNA <213> Human beings (Homo sapiens) <400> 2 cuuggauuga agggagcucc 20 <210> 3 <211> twenty one <212> RNA <213> Human beings (Homo sapiens) <400> 3 ucggaccagg cuucauuccc c 21

Claims

1. Application of ath-miR166a-3p derived from palm charcoal in the preparation of hemostatic drugs.

2. Application of reagents for detecting ath-miR159a, cpa-miR159b and ath-miR166a-3p in the quality control of palm charcoal.

3. Application of reagents for detecting ath-miR166a-3p in the preparation of reagents for evaluating the hemostatic efficacy of palm charcoal.

4. A reagent kit for quality control of palm charcoal, characterized in that... It contains primers for detecting ath-miR159a, cpa-miR159b, and ath-miR166a-3p.

Citation Information

Patent Citations

  • Blood-borne miRNA as surrogate markers of drug efficacy for cardiac conditions

    CN103370424A

  • Plant microrna identification and application thereof

    WO2013189047A1