A gene mutant for reducing leaf water loss rate and application thereof
By constructing the NtMYB184 gene mutant in tobacco and using CRISPR/Cas9 technology to regulate flavonol synthesis, the problem of high water loss rate in tobacco leaves under drought stress was solved, and effective water retention in leaves was achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- YUNNAN ACAD OF TOBACCO AGRI SCI
- Filing Date
- 2023-01-16
- Publication Date
- 2026-05-12
AI Technical Summary
There is currently no research on reducing the rate of water loss in tobacco leaves by regulating MYB-type transcription factors to affect flavonol synthesis. In particular, under drought stress, insufficient stomatal opening regulation in tobacco leads to severe water loss.
By constructing the NtMYB184 gene mutant and using CRISPR/Cas9 technology to edit the tobacco genome, the expression of flavonols in guard cells was reduced, thereby regulating ROS levels and reducing stomatal aperture, thus reducing the rate of water loss from leaves.
The NtMYB184 gene mutant significantly reduced the rate of water loss from leaves, decreasing it by 16.7% compared to the control group, effectively addressing water loss under drought stress.
Smart Images

Figure CN116790617B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to an NtMYB184 gene mutant that reduces leaf water loss rate and its application. Background Technology
[0002] Stomata are pores formed by a pair of guard cells in the plant epidermis. They serve as channels for water excretion through transpiration and CO2 absorption through photosynthesis. In most terrestrial plants, stomata open during the day to increase photosynthetic efficiency and close at night to minimize water loss. Drought stress affects various physiological and biochemical processes in plants, such as photosynthesis, respiration, transport systems, and nutrient metabolism, hindering plant growth. Severe drought stress can lead to plant death. When faced with drought stress, plants produce ABA to reduce stomatal opening and decrease the rate of water loss from leaves.
[0003] Reactive oxygen species (ROS) levels in guard cells are a key regulatory target for stomatal movement, and various exogenous stimuli and plant hormones regulate stomatal movement by modulating ROS levels. ROS, as a crucial secondary signaling molecule, increases intracellular calcium levels. 2+ At a certain level, it activates the anion channels of the cell membrane to release anions and close the stomata.
[0004] Studies have shown that flavonols all possess antioxidant functions, regulating ROS levels in guard cells and thus affecting stomatal movement. Plant flavonol synthesis is regulated by MYB-type transcription factors, which have been cloned in Arabidopsis thaliana, grape, citrus, Epimedium, and crabapple. However, no related studies have been published on the model plant tobacco, and there are no reports of MYB influencing guard cell ROS levels and thus regulating leaf water loss rates through regulating flavonol synthesis. There is an urgent need in this field to develop products and methods to reduce leaf water loss rates. Summary of the Invention
[0005] Based on the aforementioned gaps and needs in the existing technology in this field, the present invention provides an NtMYB184 gene mutant that reduces leaf water loss rate and its application.
[0006] The technical solution of the present invention is as follows:
[0007] A mutant of the NtMYB184 gene that reduces the rate of leaf water loss has a mutated NtMYB184 gene sequence relative to the wild-type tobacco plant NtMYB184 gene with the nucleotide sequence shown in SEQ ID NO.1, as shown in SEQ ID NO.2.
[0008] Primers used to reduce leaf water loss rate and / or construct mutants with low leaf water loss rate are shown below, with their upstream and downstream sequences respectively:
[0009] Upstream primer NtMYB184-CP1-F: 5'-ATTGAGACCCACTTTCTCACAACA-3'
[0010] Downstream primer NtMYB184-CP1-R: 5'-AAACTGTTGTGAGAAAGTGGGTCT-3'
[0011] Gene editing vectors used to reduce leaf water loss rate and / or construct mutants with low leaf water loss rate are dsDNA products obtained by annealing with primers with upstream and downstream sequences as shown in NtMYB184-CP1-F and NtMYB184-CP1-R, respectively.
[0012] The gene editing vector used to reduce leaf water loss rate and / or construct mutants with low leaf water loss rate is the pHSE401 vector.
[0013] Transformers used to reduce leaf water loss rate and / or construct mutants with low leaf water loss rate are gene editing vectors transformed into host cells for reducing leaf water loss rate and / or constructing mutants with low leaf water loss rate; the gene editing vector for reducing leaf water loss rate and / or constructing mutants with low leaf water loss rate is a vector connected to a dsDNA product obtained by annealing with primers with upstream and downstream sequences as shown in NtMYB184-CP1-F and NtMYB184-CP1-R, respectively.
[0014] The transformant used to reduce leaf water loss rate and / or construct mutants with low leaf water loss rate, wherein the vector is a pHSE401 vector; and / or, the host cell is selected from: Escherichia coli, and / or Agrobacterium.
[0015] A kit for reducing leaf water loss rate and / or constructing mutants with low leaf water loss rate includes: the primers for reducing leaf water loss rate and / or constructing mutants with low leaf water loss rate.
[0016] The kit for reducing leaf water loss rate and / or constructing mutants with low leaf water loss rate further includes: the gene editing vector for reducing leaf water loss rate and / or constructing mutants with low leaf water loss rate, and / or the transformant for reducing leaf water loss rate and / or constructing mutants with low leaf water loss rate.
[0017] A method for reducing leaf water loss rate and / or constructing mutants with low leaf water loss rate involves gene editing of tobacco plants using primers with upstream and downstream sequences as shown in NtMYB184-CP1-F and NtMYB184-CP1-R, respectively.
[0018] The method for reducing leaf water loss rate and / or constructing mutants with low leaf water loss rate, wherein the gene editing refers to: transferring a gene editing vector into a tobacco plant containing a dsDNA product obtained by annealing primers with upstream and downstream sequences as shown in NtMYB184-CP1-F and NtMYB184-CP1-R, respectively.
[0019] And / or, the gene editing vector refers to a gene editing vector obtained by ligating the dsDNA product into a vector;
[0020] And / or, transforming the gene-editing vector into host cells to obtain a transformant;
[0021] And / or, convert the transformant into tobacco plants;
[0022] And / or, the carrier is a pHSE401 carrier;
[0023] And / or, the host cell is selected from: Escherichia coli, and / or Agrobacterium;
[0024] And / or, each microliter of the annealing reaction system comprises: 0.4 μL of upstream primer, 0.4 μL of downstream primer, 0.1 μL of annealing buffer, and the remainder being water;
[0025] And / or, the annealing buffer is 10×Annealing buffer;
[0026] And / or, the annealing reaction procedure includes: 95°C, 5 min; 90°C, 1 min; 80°C, 1 min; 70°C, 1 min; 60°C, 1 min; 50°C, 1 min; 40°C, 1 min; 30°C, 1 min; 20°C, 1 min; 10°C, 1 min.
[0027] The method for reducing leaf water loss rate and / or constructing mutants with low leaf water loss rate, and / or the application of mutant materials constructed by the method for reducing leaf water loss rate and / or constructing mutants with low leaf water loss rate in tobacco breeding and / or tobacco agriculture.
[0028] The beneficial effects of this invention are as follows: 1) This invention has identified an NtMYB184 gene mutant that reduces the rate of leaf water loss, which can be applied to reduce the rate of leaf water loss. 2) The water loss rate of the NtMYB184 gene mutant (myb184) is 5.72%, while the water loss rate of the control WT is 6.87%, indicating that the leaf water loss rate of the NtMYB184 gene mutant (myb184) is lower than that of the control WT. The mutant of this invention reduces the water loss rate by 16.7% compared to the control.
[0029] The present invention will be further explained below with reference to the accompanying drawings and specific embodiments. Attached Figure Description
[0030] Figure 1 This is a sequencing peak diagram of the NtMYB184 gene mutant.
[0031] Figure 2 The expression level of flavonoid pathway genes in epidermal cells of NtMYB184 gene mutants.
[0032] Figure 3 Detection of stomatal flavonol content in NtMYB184 gene mutant.
[0033] Figure 4 Detection of ROS content in stomata of NtMYB184 gene mutant.
[0034] Figure 5 Detection of water loss rate in leaves of NtMYB184 gene mutant. Detailed Implementation
[0035] Experimental Example 1: Construction of NtMYB184 gene mutant materials
[0036] 1. Constructing CRISPR / Cas9 vectors
[0037] A. Design and obtain primers for target site mutation:
[0038] Upstream primer NtMYB184-CP1-F: 5'-ATTGAGACCCACTTTCTCACAACA-3'
[0039] Downstream primer NtMYB184-CP1-R: 5'-AAACTGTTGTGAGAAAGTGGGTCT-3'.
[0040] B. Preparation of dsDNA. The primers designed and synthesized in step A were annealed to form complementary DNA oligos. The specific steps are as follows: The reaction system is 50 μL, including 0.4 μL / μL P1, 0.4 μL / μL P2, 0.1 μL / μL 10×Annealing buffer, and 5 μL of sterile double-distilled water. The annealing program is as follows: 95℃, 5 min; 90℃, 1 min; 80℃, 1 min; 70℃, 1 min; 60℃, 1 min; 50℃, 1 min; 40℃, 1 min; 30℃, 1 min; 20℃, 1 min; 10℃, 1 min.
[0041] C. Digest the pHSE401 vector and ligate it with the dsDNA prepared in step B. Digest the pHSE401 vector with Bsa I enzyme in a 50 μL digestion system, including: 5 μL plasmid, 5 μL 10× buffer, 2 μL Bsa I, and 38 μL sterile double-distilled water. Digest at 37℃ for 1 h. Electrophoresis analysis of the digestion products revealed two bands at 1200 bp and 11520 bp. The 11520 bp digestion product was recovered for later use. The recovered large-fragment digestion product was ligated with the dsDNA prepared in step D using T4 DNA ligase in a 20 μL ligation system: 3 μL recovered vector digestion product, 10 μL annealed dsDNA product, 2 μL T4 DNA buffer, 1 μL T4 DNA ligase, and 4 μL sterile double-distilled water. Ligation was performed overnight at 16℃.
[0042] D. Sequencing verification. The ligation product from step C was transformed into E. coli, positive clones were screened (pHSE401 vector resistance was kan) and colony PCR was performed. The correctly constructed clone (pHSE401-NtMYB184) was selected and stored for later use.
[0043] 2. Agrobacterium-mediated transformation
[0044] Remove Agrobacterium competent cells (C58C1) from a -80℃ freezer, thaw them on ice, and add 4 μL of the vector pHSE401-NtMYB184; flash freeze in liquid nitrogen for 1 minute, transfer to a 37℃ water bath for 5 minutes, then incubate on ice for 2 minutes, add 1 mL of LB liquid medium to the mixture, and incubate at 28℃ and 220 rpm for 3–4 hours; spread the culture on LB solid medium containing 100 mg / L kanamycin and 25 mg / L rifampicin, and incubate upside down at 28℃ for 2–3 days, where Agrobacterium clones containing the target vector can be observed.
[0045] 3. Tobacco Conversion
[0046] Select Agrobacterium clones containing the target vector, streak them on LB agar plates containing kanamycin and rifampin, and incubate at 28°C for 2–3 days; scrape off the streaks and inoculate them into LB agar plates containing kanamycin and rifampin, and incubate at 28°C with shaking at 220 rpm. Infect the bacteria when the bacterial concentration reaches OD = 0.5–0.8.
[0047] Place tobacco leaves in a 500mL wide-mouth bottle, add an appropriate amount of 75% ethanol, and rinse for 1 min; discard the ethanol, add 0.1% HgCl2 solution, and shake on a shaker at room temperature for 15-30 minutes; discard the solution and rinse 6 times with sterile water;
[0048] Remove the leaves and wash away surface liquid with sterile absorbent paper. Cut the sterile leaves into 1cm × 1cm pieces with scissors. Place the cut tobacco leaf pieces into a sterile LB liquid culture medium suspension containing the target carrier and let stand for 15–20 minutes. Remove the tobacco leaves, absorb excess bacterial solution with sterile filter paper, and incubate in the dark at 25°C for two days in MS medium containing 6-BA (0.02 mg / L) and NAA (2 mg / L). Transfer the tobacco leaves to differentiation medium, with the cut surfaces in contact with the substrate. The culture medium for differentiation was MS medium containing 6-BA (0.5 mg / L), NAA (0.1 mg / L), hygromycin (20 mg / L), and cephalosporin (500 mg / L). Subculture was performed every 2-3 weeks. Callus tissue gradually formed at the cut site, and finally, shoots differentiated. The shoots that grew to 3-5 cm were cut off and transferred to MS medium to induce rooting. After rooting, the gene-edited plants were removed from the rooting medium, the medium was washed off with tap water, and then transplanted into sterile nutrient soil.
[0049] Experiment 2: Sequencing screening of cinnabar smoke mutant materials.
[0050] 1. Design detection primers for the NtMYB184 gene mutant flanking the target site:
[0051] S38NEW1 / 2-F:AGTGACATGCATGAAAGCTC;
[0052] S38NEW1 / 2-R:TAAAATGAAGTAGAGGTACTCT.
[0053] 2. After T0 generation transformed tobacco seedlings have grown for about one week, leaves from 20 seedlings were collected and DNA was extracted using the DNeasy Plant MiniKit (QIAGEN). The DNA was then amplified using primers S38NEW1 / 2-F and S38NEW1 / 2-R designed in step (1). The amplified product was purified and sequenced using primer S38NEW1 / 2-F. Analysis of the sequencing results yielded an edited material with a deletion mutation at the target site. Figure 1 ).
[0054] Experiment Example 3: Detection of Flavonols and ROS Content in Guard Cells
[0055] Prepared tobacco lower epidermal strips were placed in small plastic culture dishes (20-40 mm in diameter) and incubated under light for 2 hours. Afterward, they were transferred to centrifuge tubes containing DPBA or H2DCFDA fluorescent probes and incubated in the dark for 15-20 minutes. After incubation, the lower epidermal strips were transferred to new centrifuge tubes containing epidermal buffer. The tubes were then inverted to wash away any remaining fluorescent probes, and this washing process was repeated 3-5 times. The cleaned epidermal strips were then placed under a laser scanning confocal microscope (Nikon A1) to observe the fluorescence intensity of guard cells. All images were obtained using Nikon NIS Elements software, maintaining the same detector gain and laser intensity during imaging. Three to five independent epidermal strips were randomly selected from each sample, each containing at least 30 guard cells. The fluorescence intensity was quantitatively analyzed using ImageJ software. The results showed that the DPBA fluorescence intensity in the NtMYB184 gene mutant (myb184) was lower than that in the control WT, indicating that the NtMYB184 gene mutation significantly reduced the flavonol levels in guard cells. Figure 3 The H2DCFDA fluorescence intensity in the NtMYB184 gene mutant (myb184) was higher than that in the control WT, indicating that the NtMYB184 gene mutation reduces the flavonol level in guard cells, leading to a significant increase in their ROS level. Figure 4 ).
[0056] Experiment Example 4: Detection of water loss rate in transgenic plants
[0057] After approximately 6 weeks, detached leaves from the plant were sealed at the petiole and placed in an environment with 65% relative humidity, 22°C, and continuous light. The leaves were weighed every half hour. Water loss rate = (Initial leaf weight - Leaf weight after treatment) / Initial leaf weight. Figure 5 As shown, the NtMYB184 gene mutants at each time point ( myb184 The water loss rate was lower than that of the control WT. After 300 minutes of incubation, the NtMYB184 gene mutant ( myb184 The water loss rate was 5.72%, while the control WT water loss rate was 6.87%, indicating that the NtMYB184 gene mutant ( myb184 The leaf water loss rate was lower than that of the control WT.
[0058] SEQ ID NO: 1
[0059] atgggaagagcaccttgttgtgagaaagtgggtctcaaaagaggcagatggactgcagaagaggatgaaa
[0060] ttctcactaaatatattcaaactaacggcgaaggctcttggagatcattacccaaaaatgctgggttact
[0061] tagatgtggaaagagttgccgactgagatggattaattacttgaggtctgatttgaggagaggtaacata
[0062] acttctgaagaggaagacataatcatcaagttacatgcaactttgggtaacagatggtctctaatagcgg
[0063] gacatttaccaggtagaacagacaatgagattaaaaactactggaactctcatctaagcagaaaagttga
[0064] aagcttaagaattccaagcgacgaaaagctgcctcaagctgtagttgatttggctaataaagggactttg
[0065] aaccctatcaaatgtagagttggcaaaacaagccgaccca
[0066] SEQ ID NO: 2
[0067] GGCGAAGGCTCTTGGAgaaagtgggtctcaaaagaggcagatggactgcagaagaggatgaaa
[0068] ttctcactaaatatattcaaactaacggcgaaggctcttggagatcattacccaaaaatgctgggttact
[0069] tagatgtggaaagagttgccgactgagatggattaattacttgaggtctgatttgaggagaggtaacata
[0070] acttctgaagaggaagacataatcatcaagttacatgcaactttgggtaacagatggtctctaatagcgg
[0071] gacatttaccaggtagaacagacaatgagattaaaaactactggaactctcatctaagcagaaaagttga
[0072] aagcttaagaattccaagcgacgaaaagctgcctcaagctgtagttgatttggctaataaagggactttg
[0073] Aaccctatcaaatgtagagttggcaaaacaagccgaccca
[0074] The above descriptions are merely some specific embodiments of the present invention, and well-known details or common knowledge in the solutions are not described in detail here. It should be noted that the above embodiments do not limit the present invention in any way. For those skilled in the art, any technical solutions obtained by equivalent substitution or equivalent transformation fall within the protection scope of the present invention. The scope of protection claimed in this application should be determined by the content of its claims, and the specific embodiments described in the specification can be used to interpret the content of the claims.
Claims
1. The application of an NtMYB184 gene mutant, characterized in that, The application involves mutating the tobacco NtMYB184 gene into an NtMYB184 mutant to reduce the water loss rate of tobacco leaves. The sequence of the NtMYB184 gene is shown in SEQ ID NO.1, and the sequence of the NtMYB184 mutant gene is shown in SEQ ID NO.2.