A molecular marker related to the wax loading of apple fruit and its application

Abstract

The present invention belongs to the field of molecular biology technology, and specifically discloses a molecular marker related to the wax loading amount of apple peel and its application, wherein the molecular marker is characterized by the insertion / deletion length polymorphism of the nucleotide sequence shown in SEQ ID NO. 1. The molecular marker of the present invention is closely related to the wax content of apple peel, can be used for storage management of apple fruit, can avoid waste of resources and misjudgment of fruit, and accelerate genetic improvement.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a molecular marker related to the wax loading amount of apple peel and an application thereof. Background Art

[0002] In current apple breeding practices, most important agronomic traits of fruits are measured artificially through their phenotypes, which are greatly affected by subjectivity, resulting in long breeding cycles and low efficiency. Using functional molecular markers associated with target traits for marker-assisted selection can transform traditional phenotypic selection into direct genotypic selection, greatly improving breeding efficiency and accelerating genetic improvement. The premise for achieving molecular marker-assisted selection is to find molecular markers that are closely linked to important agronomic traits. Therefore, it is of great significance to develop molecular markers of important trait genes with Chinese characteristics and conduct assisted selection breeding research.

[0003] Apple (Scientific name: Malus domestica, English name: Apple), a plant of the genus Malus in the Rosaceae family, is usually a deciduous tree. As the apple fruit grows and develops, the wax components deposited on the surface of the peel will increase until the peak is reached during the fruit harvest. As a quantitative trait, the wax load varies in different apple resources. Some are rich in wax content, while others are less. Peel wax plays a vital role in fruits. It can prevent excessive water loss, mechanical damage and microbial infection, excessive cold damage to fruits, softening of fruits, and prolong the storage period of fruits. Therefore, breeding apple varieties with rich content of peel wax components can effectively prolong the storage period of fruits, slow down post-harvest water loss, prolong their shelf life, and improve their economic value.

[0004] In the breeding process, it is very important to select varieties with relatively rich wax content and better storage resistance. So far, the determination method of peel wax content is time-consuming and labor-intensive, with complicated procedures, and the wax content reflected by naked eye observation is easily affected by personal subjectivity. In the apple fruit breeding process, there is a lack of molecular markers that can directly detect the peel wax content. Therefore, finding DNA markers that are closely linked to the wax load of apple fruit peel can effectively assist in the selection of varieties with high wax content. Summary of the invention

[0005] One of the purposes of the present invention is to provide a molecular marker and primer related to the wax loading amount of apple peel.

[0006] The second object of the present invention is to provide an application of the above molecular markers. The molecular markers are closely related to the wax content of apple fruits and are used in apple fruit breeding research.

[0007] The third object of the present invention is to provide a method for identifying the wax loading trait of apple fruit peel.

[0008] In order to achieve the above object, the present invention provides the following technical solutions:

[0009] A molecular marker related to the wax loading amount of apple fruit peel, wherein the molecular marker is expressed as an insertion / deletion length polymorphism of the nucleotide sequence shown in SEQ ID NO.1.

[0010] The upstream primer sequence of the primer pair for amplifying the molecular marker is shown in SEQ ID NO.2, and the downstream primer sequence is shown in SEQ ID NO.3.

[0011] Specifically, individuals having the nucleotide sequence shown in SEQ ID NO.1 and being homozygous at the molecular marker site show a low wax load; individuals lacking the nucleotide sequence shown in SEQ ID NO.1 and being homozygous at the molecular marker site show a high wax load; individuals lacking the nucleotide sequence shown in SEQ ID NO.1 and being heterozygous at the molecular marker site show a medium wax load.

[0012] The present invention also discloses the application of the above molecular markers in apple molecular breeding. It is mainly used for identifying or assisting in identifying the wax loading trait of apple fruit peel. The wax loading trait of apple fruit peel can be quickly identified at the seedling stage, thereby improving the selection efficiency and accelerating the breeding process. Those skilled in the art can understand that, for example, by detecting whether the molecular marker of the present invention exists, varieties with high wax loading on apple fruit peel can be screened. The detection can be a PCR detection method, specifically, the primer pair of the above molecular marker of the present invention can be used, and the detection can also be performed by a sequencing method.

[0013] The present invention also discloses a method for identifying the wax loading trait of apple fruit peel, the method comprising:

[0014] (1) Extracting DNA from apple plant tissues;

[0015] (2) PCR amplification: using the primer pair described in claim 2, performing PCR amplification on the sample extracted in step (1);

[0016] (3) Sequencing the amplified product:

[0017] When the amplified fragment is 478bp, the apple to be tested has a low peel wax load. When the amplified fragment is 415bp, the apple to be tested has a high peel wax load. When the amplified fragments are 478bp and 415bp, the molecular marker sites of the apple to be tested are heterozygous, showing a medium wax load.

[0018] Furthermore, agarose gel electrophoresis was used to detect the length of the amplified fragment.

[0019] In addition, the kit containing the above-mentioned molecular marker primer pair can be used to identify the wax loading level of apple peel. In specific applications, the reagent containing the above-mentioned primer pair can be selected to make a kit.

[0020] Furthermore, the reagent for detecting the presence of the molecular marker is used in the localization of genes related to the wax loading amount of apple peel. The molecular marker of the present invention can be used to locate genes related to the wax loading amount of apple peel. The above applications can be carried out according to conventional methods.

[0021] The present invention also protects vectors containing the above-mentioned molecular markers. The recombinant vector may be an expression vector or a cloning vector into which the molecular marker of the present invention is inserted. After obtaining the above-mentioned recombinant vector, those skilled in the art can transform the recombinant vector into suitable cells according to different needs to obtain recombinant cells containing the recombinant vector. Therefore, the present invention also protects recombinant cells containing the recombinant vector.

[0022] Compared with the prior art, the molecular marker related to the wax content of apple fruit peel provided by the present invention has the following beneficial effects:

[0023] The molecular marker provided by the invention is closely related to the wax content of apple fruit peel. The length of the gene fragment obtained by PCR amplification can be used to judge whether the peel wax load is rich or not, and the speed of water loss and storage properties of the apple variety after harvest can be quickly and accurately judged, thereby accelerating genetic improvement. It can also be used for storage management of apple fruits, thereby avoiding waste of resources and misjudgment of fruits. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0025] Figure 1 The figures are the statistics of the wax load on the peel of apple fruit samples 1-17 on the day of ripening and picking in Example 1 of the present invention.

[0026] Figure 2 These are the electrophoresis results of the apple fruit samples 1-17 in Example 1 of the present invention. DETAILED DESCRIPTION

[0027] The present invention is described in detail below in conjunction with the accompanying drawings and specific examples, but should not be construed as limiting the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0028] Example 1

[0029] 1. Screening of molecular markers related to the wax loading of apple fruit peel

[0030] The inventors of the present invention used a hybrid population with a diverse wax load trait to perform BSA sequencing and located some candidate genes on apple chromosome 13. Combined with the transcriptome sequencing results of the research team's early developmental samples of 'Yueguan' and 'Yuehua', which have significant differences in wax content, a differentially expressed gene was screened, and the gene was located in the interval located by BSA sequencing. After amplifying the gene in 'Yueguan' and 'Yuehua', WAX SEQ insertion and deletion polymorphisms were found in their promoter regions.

[0031] 1. Collect mature apple samples and test the wax load on the peel for verification

[0032] Mature apples were collected as samples to be tested. There were 17 samples in total, which were marked with serial numbers 1, 2, 3, 4...17. We determined the wax content of apple peels in all samples and verified the molecular markers initially screened above.

[0033] The results show: Figure 1 The middle is the test result of the peel wax loading of samples 1_17. The wax loading of samples 1-4 and sample 13 is relatively low, and the wax loading of samples 5-8 and 10-11 is in the middle; samples 9, 12, 14_17 are rich in wax content.

[0034] Figure 2 The electrophoresis test results of samples 1-17 are as follows: Figure 2 The electrophoresis test results of different samples show that the amplified fragment of the sample with low wax content is 478bp; the amplified fragment of the sample with medium wax content is two bands of 478bp and 415bp; the amplified fragment of the sample with rich wax content is 415bp.

[0035] 2. Validation of molecular markers related to the wax loading of apple fruit peel

[0036] The present invention provides a molecular marker related to the wax loading amount of apple fruit peel, wherein the molecular marker is expressed as an insertion / deletion length polymorphism of a nucleotide sequence shown by WAX SEQ;

[0037] WAX SEQ:

[0038]

[0039] The steps for detecting the wax loading-related traits of apple fruit peel using the above molecular markers are as follows:

[0040] (1) Extracting apple genomic DNA from the above 17 samples;

[0041] (2) Design forward primer F and reverse primer R;

[0042] The nucleotide sequence of the forward primer F is shown as F, and the nucleotide sequence of the reverse primer R is shown as R;

[0043] F: AATTTGCCCCGATGAAAGTAC (SEQ ID NO. 2);

[0044] R: AGGAGAGTTGTGTGGTGATTTT (SEQ ID NO. 3);

[0045] Using the above primer pairs, PCR amplification was performed on all apple genomic DNA samples to be tested and the length of the amplified fragment was detected. The amplification system was: DNA template 0.5 μL, forward primer F 0.5 μL, reverse primer R 0.5 μL, 2×ExTaq TM Mix 5μL, RNase free water 3.5μL;

[0046] The amplification program was as follows: 95.0°C, 3 min; 95.0°C, 30 s, 53.0°C, 30 s, 72.0°C, 30 s, 34 cycles; 72.0°C, 5 min; 4.0°C, pluse;

[0047] 3. Result judgment

[0048] The results are as follows Figure 2 As shown, when the amplified fragment is 478bp as shown in SEQ ID NO.4, the peel wax load is low; when the amplified fragment is 415bp as shown in SEQ ID NO.5, the peel wax load is high; when the amplified fragments are 478bp and 415bp, the molecular marker sites of the apple to be tested are heterozygous, which shows that the peel wax load is moderate.

[0049] 478 bp fragment:

[0050]

[0051]

[0052] 415 bp fragment:

[0053]

[0054] We found that the results of high or low wax content in apple peel are consistent with the results of the present invention through molecular marker judgment. The present invention provides a molecular marker related to the high and low wax content of apple fruit. The accumulation of wax in apple peel can be accurately judged by detecting the molecular marker, which can be used for storage management of apple fruit, thereby avoiding waste of resources and misjudgment of fruit.

[0055] It should be noted that, in order to avoid redundancy, the present invention describes preferred embodiments, but those skilled in the art may make additional changes and modifications to these embodiments once they know the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0056] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A molecular marker associated with the wax loading of apple fruit peel, characterized in that: The molecular marker is the nucleotide sequence shown in SEQ ID NO.

1.

2. The molecular marker associated with the wax loading of apple fruit peel according to claim 1, characterized in that: The upstream primer sequence of the primer pair for amplifying the molecular marker is shown as SEQ ID NO.2, and the downstream primer sequence is shown as SEQ ID NO.

3.

3. The molecular marker associated with the wax loading of apple fruit peel according to claim 1, characterized in that: Individuals having the nucleotide sequence shown in SEQ ID NO.1 and being homozygous at the molecular marker site show a low wax load; individuals lacking the nucleotide sequence shown in SEQ ID NO.1 and being homozygous at the molecular marker site show a high wax load; individuals lacking the nucleotide sequence shown in SEQ ID NO.1 and being heterozygous at the molecular marker site show a medium wax load.

4. Use of the molecular marker described in any one of claims 1 to 3 in apple molecular breeding.

5. The use according to claim 4, characterized in that: The molecular marker is used for identifying or assisting in identifying the wax loading trait of apple fruit peel.

6. A method for identifying the wax loading trait of apple fruit peel, characterized in that: The method comprises: (1) Extracting DNA from apple plant tissues; (2) PCR amplification: using the primer pair described in claim 2, PCR amplification is performed on the sample extracted in step (1); (3) sequencing the amplified product: When the amplified fragment is 478 bp, the apple to be tested has a low peel wax load. When the amplified fragment is 415 bp, the apple to be tested has a high peel wax load. When the amplified fragment is 478 bp and 415 bp, the molecular marker site of the apple to be tested is heterozygous, showing a medium wax load.

7. A kit for identifying the wax loading trait of apple fruit peel, characterized in that: The kit comprises the primer pair described in claim 2.

8. Use of a reagent for detecting the presence of the molecular marker according to claim 1 in the localization of genes related to the wax loading of apple peel, characterized in that: The upstream primer sequence of the primer pair for amplifying the molecular marker is shown in SEQ ID NO.2, and the downstream primer sequence is shown in SEQ ID NO.3.

Images