Use of farudodstat in the preparation of a drug against hepatitis e virus
Farudodstat addresses the shortcomings of existing treatments by inhibiting hepatitis E virus RNA replication and protein expression, providing an effective treatment option for chronic hepatitis E and ribavirin-resistant HEV.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-07-25
- Publication Date
- 2026-06-26
Smart Images

Figure CN116870005B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of pharmaceutical technology, and more particularly to the application of Farudodstat in the preparation of drugs against hepatitis E virus. Background Technology
[0002] Hepatitis E is a viral hepatitis caused by the hepatitis E virus (HEV). HEV is universally contagious, and clinically it often presents as asymptomatic infection or acute hepatitis. Infection with HEV in immunocompromised individuals or organ transplant recipients can lead to persistent HEV infection, gradually progressing to chronic hepatitis E, cirrhosis, and liver cancer. Increasing evidence also indicates that it can cause extrahepatic damage, including neurological symptoms. It has been reported that HEV infection in pregnant women can develop fulminant hepatitis, with a mortality rate as high as 20%–30%. Currently, there is no universally accepted treatment for HEV infection; ribavirin and interferon-alpha are the first-line drugs for treating hepatitis E. Although ribavirin has been successfully used for chronic HEV infection, it has teratogenic effects and is contraindicated in the treatment of pregnant patients. Furthermore, ribavirin-resistant HEV mutant strains have emerged clinically; interferon-alpha treatment can lead to transplant rejection in organ transplant recipients. Currently, there are no direct antiviral drugs for HEV, so finding safer and more effective new anti-HEV drugs is of great significance for the treatment of chronic hepatitis E.
[0003] Farudodstat is an orally administered, highly potent dihydroorotate dehydrogenase (DHODH) inhibitor with an IC50 of 35 nM against human DHODH enzyme. Farudodstat inhibits protein synthesis by activating the AP-1 transcription factor. Farudodstat can induce apoptosis and is currently in a phase IIa clinical trial for patients with acute myeloid leukemia. However, there are currently no reports on the efficacy of Farudodstat against hepatitis E virus. Summary of the Invention
[0004] The purpose of this invention is to provide a new use of Farudodstat in the preparation of medicaments against hepatitis E virus.
[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0006] This invention provides the use of Farudodstat in the preparation of drugs against hepatitis E virus.
[0007] Preferably, the structure of the Farudodstat is shown in Formula I:
[0008]
[0009] Preferably, the hepatitis E disease is an acute or chronic viral hepatitis caused by a hepatitis E virus.
[0010] Preferably, the hepatitis E virus genus includes hepatitis E virus species A, B, C and D.
[0011] This invention also provides the application of Farudodstat in inhibiting intracellular hepatitis E virus RNA replication in vitro.
[0012] Preferably, the cells include hepatitis E virus replicon cell models, hepatitis E virus wild-type full-length model cells, and hepatitis E virus mutant full-length model cells.
[0013] Preferably, the hepatitis E virus includes hepatitis E virus of the A genus 3 of the hepatitis E virus family.
[0014] Preferably, the concentration of Farudodstat in the cell culture system is 0.02–50 μmol / L.
[0015] This invention also provides the application of Farudodstat in inhibiting hepatitis E virus RNA replication in organoids, including liver organoids.
[0016] Preferably, the concentration of Farudodstat in the cell culture system is 0.02–50 μmol / L.
[0017] By adopting the above technical solution, the present invention has the following beneficial effects: The present invention discloses the application of Farudodstat in the preparation of drugs against Hepatitis E Virus (HEV). The present invention experimentally demonstrates that Farudodstat can inhibit HEV RNA replication and HEV ORF2 protein expression, and also has antiviral effects against HEV mutant strains associated with clinical ribavirin treatment failure. Therefore, Farudodstat can provide a new drug and treatment strategy for patients with chronic hepatitis E, and can also provide a new treatment option for patients with clinical ribavirin-resistant HEV. Attached Figure Description
[0018] Figure 1 Graph showing the effect of different concentrations of Farudodstat on inhibiting HEV-p6Gluc replication in HEK 293T cells (left) and Huh7 cells (right);
[0019] Figure 2 A graph showing the effect of different concentrations of Farudodstat on cell safety (using CC50 as the detection index);
[0020] Figure 3 Graph showing the inhibitory effect of different concentrations of Farudodstat on HEV RNA replication;
[0021] Figure 4 The effect of different concentrations of Farudodstat on inhibiting HEV ORF2 protein expression (p6 is Huh7-HEV wild-type full-length model cells);
[0022] Figure 5 A diagram illustrating the role of Farudodstat in inhibiting HEV RNA replication in a human liver organoid model;
[0023] Figure 6 Graph showing the effect of different concentrations of Farudodstat on inhibiting HEV-p6Gluc replication in liver organoids from different donors. Detailed Implementation
[0024] This invention provides the application of Farudodstat in the preparation of drugs against hepatitis E virus; the hepatitis E disease is an acute or chronic viral hepatitis caused by hepatitis E virus.
[0025] Preferably, the drug further includes one or more pharmaceutically acceptable carriers, such as diluents, excipients, fillers, binders, wetting agents, disintegrants, absorption enhancers, surfactants, adsorbents, and lubricants. The dosage form of the drug includes injections, tablets, powders, granules, capsules, oral liquids, ointments, and creams. There are no special restrictions on the preparation method of the drug; it can be prepared according to conventional methods in the pharmaceutical field. The drug is introduced into the body, such as through injection, spray, nasal drops, eye drops, osmosis, absorption, or physical or chemically mediated methods, into muscle, intradermal, subcutaneous, venous, or mucosal tissues; or it may be introduced into the body after being mixed with or encapsulated by other substances.
[0026] This invention also provides the application of Farudodstat in in vitro inhibition of intracellular hepatitis E virus replication. The cells include hepatitis E virus replicon model cells, hepatitis E virus wild-type model cells, and hepatitis E virus mutant full-length model cells. The hepatitis E virus includes hepatitis E virus type A genotype 3 (HEV). The concentration of Farudodstat in the cell culture system is preferably 0.02–50 μmol / L, more preferably 10–40 μmol / L, and even more preferably 25 μmol / L.
[0027] This invention also provides the application of Farudodstat in inhibiting hepatitis E virus RNA replication in organoids, including liver organoids. The concentration of Farudodstat in the cell culture system is preferably 0.02–50 μmol / L, more preferably 10–40 μmol / L, and even more preferably 25 μmol / L.
[0028] The Farudodstat used in this invention is manufactured by Cayman Biotechnology Co., Ltd., product number 333516;
[0029] The BTX cell electroporator used in this invention is the ECM630 product from BTX Corporation, USA.
[0030] The WST-1 cell proliferation and cytotoxicity assay kit used in this invention is a product with catalog number C0036 manufactured by KeyGen Biotech Inc.
[0031] The Gaussian luciferase assay kit used in this invention is a product with catalog number RG062M manufactured by Beyotime Biotech Co., Ltd.
[0032] The First-Strand cDNA Synthesis Kit and SYBR Green qPCRMaster Mix (2X) used in this invention are products manufactured by APExBIO Biotechnology Co., Ltd., with catalog numbers K1072 and K1070 respectively.
[0033] The FITC-labeled goat anti-rabbit IgG secondary antibody used in this invention is the secondary antibody manufactured by Jackson Biotechnology Co., Ltd., with catalog number 111-585-003 and trade name AlexaFlour 594-comjugated AffinipureGoatAnti-RabbitIgG(H+L).
[0034] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0035] Unless otherwise specified, the experimental methods used in the examples are conventional methods; the materials and reagents used in the examples are commercially available unless otherwise specified.
[0036] Example 1: Construction of a cell model
[0037] (1) Types of plasmids
[0038] a. Wild-type HEV plasmid: Wild-type HEV plasmid containing the full-length HEV genome (Kernow-C1 p6 gt3, HEV genome sequence number GenBank: JQ679013.1);
[0039] b. HEV-p6Gluc replicon plasmid;
[0040] c. Three mutant HEV plasmids: Compared to wild-type HEV plasmids, plasmids containing the full-length HEV genome carrying RdRp mutations (Y1320H single mutation, G1634R single mutation, Y1320H and G1634R double mutation) (the three mutations are associated with ribavirin resistance).
[0041] HEV-p6Gluc in b is a replicon plasmid, which is a partial deletion of the ORF2 region in the whole HEV genome and its replacement by the GLUC gene;
[0042] The HEV wild-type plasmid in a and the three mutant HEV plasmids in c are plasmids containing the full-length HEV genome.
[0043] The wild-type HEV plasmid in a was obtained from HEV-A genotype 3 (hepatitis E virus of the A genotype 3). The plasmids in a and b were published in the literature Wenshi Wang et al., Gastroenterology, VOLUME 151, ISSUE 6, P1251-1253; Wenshi Wang et al., Science Signaling, 2017, 25; 10(476); Wenshi Wang et al., Hepatology. 2018, 67(6): 2096-2112.
[0044] (2) Constructing a cell model
[0045] The above plasmids were digested with restriction endonuclease Mlu I. The digestion system is shown in Table 1. The samples were placed in a water bath at 37°C and digested for 1 h.
[0046] Table 1 Enzyme digestion reaction system
[0047] Components volume Mlu I 2μL 10×Buffer 5μL plasmid template 5μg Total volume 50μL
[0048] Note 10X H Buffer: 500mM Tris-HCl, pH7.5, 100mM MgCl2, 10mM Dithiothreitol, 1,000mM NaCl (Takara Cat No.1071A)
[0049] After enzyme digestion, the linearized plasmid was purified and recovered. The specific operation was as follows: 5 times the volume of Buffer PB was added to the enzyme digestion product and mixed. The mixture was added to the adsorption column and allowed to stand for 2 min. After centrifugation at 12000 r / min for 1 min, 500 μL of Buffer PW was added to the adsorption column for washing. After centrifugation at 12000 r / min for 1 min, the adsorption column was idled for 1 min. 30 μL of Buffer EB was added to the middle of the adsorption column and allowed to stand for 2 min. After centrifugation at 12000 r / min for 1 min, the linearized plasmid was recovered.
[0050] Using the T7 in vitro transcription kit (mMESSAGE mMACHINE T7 Transcription Kit; Thermo; AM1344) with the linear plasmid in (2) as a template, viral RNA was transcribed. The transcription system is shown in Table 2. The RNA was incubated in a 37°C water bath for 2 h, and then 0.5 μL of TURBO DNase was added to remove residual DNA. After incubating in a 37°C water bath for 15 min, 30 μL of LiCl was added, and the RNA was precipitated at -20°C for 2 h. The RNA was then centrifuged at 12000 r / min for 20 min at 4°C. The supernatant was gently discarded, and the RNA was washed once with 1 mL of 70% ethanol. The RNA was then centrifuged at 12000 r / min for 10 min at 4°C. The ethanol was discarded, and 30 μL of DEPC was added to resuspend the RNA.
[0051] Table 2 In vitro transcription reaction system
[0052]
[0053]
[0054] The transcribed RNA was electroporated into HEK 293T and Huh7 cells at 270V and 975μF, respectively (3×10⁶ cells were pre-treated before electroporation). 6HEK 293T and Huh7 were plated in 60 mm culture dishes and cultured in DMEM medium containing 10% FBS in an incubator at 37°C and 5% CO2 for 24 h. The medium was then discarded and the plates were washed twice with 1 mL PBS. Digest cells with 1 mL of trypsin for 1 min. Once the cells shrink and become round, gently discard the trypsin. Add 3 mL of serum-containing culture medium, transfer the cells to a 15 mL centrifuge tube, centrifuge at 1000 rpm for 5 min at room temperature, discard the culture medium, resuspend the cells in 3 mL of PBS, wash once, centrifuge at 1000 rpm for 5 min, discard the PBS, resuspend the cells in 400 μL of Opti-MEM, then transfer the cells to 1.5 mL of nuclease-free EP, add 3 μg of RNA, mix, and then add to a 4 mm electroporation cuvette (BTX) for electroporation experiments. Construct HEK 293T-HEV-p6Gluc replicon model cells, Huh7-HEV-p6Gluc replicon model cells, Huh7-HEV wild-type full-length model cells, and mutant full-length model cells, respectively.
[0055] HEV-p6Gluc is a replicon cell, formed by replacing a portion of the ORF2 region in the HEV plasmid genome with the GLUC gene. The HEV replicon system is based on a modified HEV genome, replacing part of the ORF2 gene with a Gaussian luciferase (Gluc) reporter gene. During viral replication, the Gluc gene also replicates, resulting in the release of Gluc into the supernatant. Measuring the amount of Gluc in the supernatant allows for the assessment of HEV replication efficiency. This replicon system offers significant advantages for high-throughput screening of drugs that inhibit HEV replication, including speed and ease of operation. By measuring whether the expression level of Gluc in the supernatant is reduced, it is possible to quickly determine whether a drug can inhibit HEV replication.
[0056] HEV wild-type / mutant types are viruses that carry the full-length HEV genome and have normal replication, assembly, and release capabilities.
[0057] Example 2: In vitro experiment on Farudodstat inhibiting HEV replicon replication
[0058] (1) Culture of HEV replicon model cells
[0059] HEK 293T and Huh7 cells containing HEV replicons (HEK 293T-HEV-p6Gluc replicon model cells and Huh7-HEV-p6Gluc replicon model cells) were cultured separately in 60 mm culture dishes in DMEM high-glucose medium (Bio-Channel) + 10% FBS (Bio-Channel) at 37°C in a 5% CO2 incubator. After the cells reached confluence (approximately 3 × 10⁻⁶ cells / year), they were cultured. 6(One) Plate-laying and chemical treatment.
[0060] (2) Experimental grouping and treatment
[0061] Two HEV replicon model cells were seeded into 96-well plates, 2 × 10⁶ cells per well. 4 Cells were cultured in 10% FBS (Bio-Channel) + DMEM high-glucose medium. After 24 hours of cell adhesion, the cells were divided into groups and treated with drugs. Each group had 3 replicates. The groups are as follows:
[0062] a. Experimental group: treated with Farudodstat (final concentration in culture medium was 0.2, 1, 5, 10, 50 μM) for 72 hours.
[0063] b. Blank control group: treated with the same volume of 1% DMSO as the experimental group a.
[0064] (3) Experimental methods
[0065] After treating the two groups for 72 hours, the supernatant was collected and Gaussian luciferase activity was detected using a Gaussian luciferase assay kit to analyze Farudodstat's inhibition of HEV replicon replication.
[0066] (4) Results
[0067] Experimental results are as follows Figure 1 As shown. By Figure 1 It can be seen that, compared with the blank control group (1% DMSO), the activity of Gaussian luciferase decreased after Farudodstat treatment within the effective concentration range, indicating that Farudodstat has an inhibitory effect on HEV replicon replication. Mean±SEM; ****P<0.0001.
[0068] Example 3: In vitro experiments on the cell safety of Farudodstat
[0069] (1) Culture of Huh7-HEV-p6Gluc replicon model cells
[0070] The revived Huh7-HEV-p6Gluc replicon model cells were cultured using the following steps: First, the frozen cells were removed from the -80℃ freezer and quickly placed in a 37℃ water bath to thaw. After thawing, 2×10⁶ cells were cultured. 4Cells were transferred to 3 mL of complete culture medium (10% FBS + DMEM), centrifuged at 1000 rpm for 5 min, and the medium was discarded. 10 mL of 10% FBS (Bio-Channel) in DMEM high-glucose medium (Bio-Channel) was added, and the cells were incubated at 37°C in a 5% CO2 incubator. After the cells reached confluence, they were passaged. For cell passage, the medium in the culture dish was first discarded, and the cells were washed twice with sterile PBS. 1 mL of trypsin (Bio-Channel) was added for digestion. After the cells shrank and became rounded, the trypsin was discarded. Cells were then passaged at a 1:4 cell ratio (25% of the cells were transferred to a new culture dish for further culture) with complete culture medium.
[0071] (2) Experimental grouping and treatment
[0072] The Huh7-HEV replicon model cells cultured in step (1) were used at a density of 2 × 10⁶ cells per well. 4 Cells were seeded into 96-well plates. After 24 hours of cell adhesion, the cells were treated with different concentrations of Farudodstat in three replicates per group, as follows:
[0073] a. Experimental group: Different amounts of Farudodstat were added to the experimental group to make the final concentration of Farudodstat in the culture medium 0.2, 1, 5, 10, 50 and 200 μM respectively, and the treatment lasted for 72 hours.
[0074] b. Blank control group: treated with the same volume of 1% DMSO as the experimental group a.
[0075] (3) Experimental methods
[0076] After treating the two groups for 72 hours, the cell proliferation activity was detected using the WST-1 cell proliferation and cytotoxicity assay kit (KeyGen). The half-maximal cytotoxicity concentration (CC50) was calculated using GraphpadPrism 9 to analyze the safety of Farudodstat on Huh7 cells.
[0077] 4) Results
[0078] Experimental results are as follows Figure 2 As shown, by Figure 2 It is known that Farudodstat has a CC50 of 294 μM for Huh7 cells. As shown in Example 2, Farudodstat can inhibit HEV replication at a concentration of 0.2 μM. The concentration that inhibits HEV replication is much lower than the CC50 concentration, indicating that Farudodstat does not produce cytotoxicity to cells in the process of inhibiting HEV replication.
[0079] Example 4: In vitro experiment of Farudodstat inhibiting HEV RNA replication in Huh7-HEV wild-type full-length model cells.
[0080] (1) Culture of Huh7-HEV wild-type full-length model cells
[0081] Huh7 cells that had been electroporated with wild-type HEV RNA were revived and cultured. First, the frozen cells were removed from a -80°C freezer and quickly thawed in a 37°C water bath. After thawing, the cells were transferred to 3 mL of complete culture medium (10% FBS + DMEM), centrifuged at 1000 rpm for 5 min, and the medium was discarded. Then, 10% FBS (Bio-Channel) in DMEM high-glucose medium (Bio-Channel) was added, and the cells were incubated at 37°C in a 5% CO2 incubator. Once the cells reached confluence, they were passaged. For cell passage, the culture medium in the culture dish was discarded, and the cells were washed twice with sterile PBS. 1 mL of trypsin (Bio-Channel) was added for digestion. After the cells shrank and became rounded, the trypsin was discarded, and complete culture medium was added at a 1:4 ratio for passage.
[0082] (2) Experimental grouping and treatment
[0083] The Huh7-HEV wild-type full-length model cells cultured in step (1) were used at a density of 5 × 10⁶ cells per well. 4 Cells were seeded into 24-well plates. After 24 hours of cell adhesion, the cells were divided into groups with two replicates per group, as follows:
[0084] a. Experimental group: Farudodstat was added to the culture medium to make the final concentration 0.1 and 1 μM respectively, and the treatment lasted for 72 hours.
[0085] b. Blank control group: treated with 1% DMSO as in the experimental group a.
[0086] (3) Experimental methods
[0087] After treating the two groups for 72 hours, total RNA was extracted from the cells of the experimental and control groups in (2) after 72 hours of culture using the TRIzol method. The RNA was reverse transcribed into cDNA, and then qPCR was performed using the cDNA as a template (the RNA denaturation system was added according to Table 3, heated at 65℃ for 5 min, and then the reverse transcription system was added according to Table 4. After gentle mixing, reverse transcription was performed at 25℃ for 2 min; 45℃ for 50 min; and 70℃ for 15 min). The transcription levels of HEV RNA and GAPDH gene were then detected by qPCR (the qPCR reaction system was added according to Table 5, and the reaction procedure is shown in Table 6). The primer sequences are shown in Table 7. The effect of Farudodstat on HEV RNA replication level was analyzed.
[0088] Table 3 RNA denaturation system
[0089] Element volume Random Primers (50μM) 1μL 10mM dNTP Mixture 1μL RNA 1μg RNase-free Water Up to 10μL
[0090] Table 4 Reverse Transcription System
[0091] Element volume The above denatured reaction solution 10μL 5×First-Strand Buffer 4μL RNase Inhibitor 1μL Reverse Transcriptase 1μL RNase-free Water Up to 20μL
[0092] Table 5 qPCR reaction system
[0093]
[0094] Table 6 qPCR reaction procedure
[0095]
[0096] Table 7 Primer sequences
[0097] Primer name Primer sequence (5'-3') HEV-genome-F TTGCCTCCGAGTTAGTCATC SEQ ID NO.1 HEV-genome-R TGCAAAGCATTACCAGACCG SEQ ID NO.2 GAPDH-F GTCTCCTCTGACTTCAACAGCG SEQ ID NO.3 GAPDH-R ACCACCCTGTTGCTGTAGCCAA SEQ ID NO.4
[0098] (4) Results
[0099] Experimental results are as follows Figure 3 As shown, by Figure 3 It was found that after Farudodstat treatment, the RNA level of Huh7 cells containing wild-type HEV was lower than that of the blank control group (1% DMSO). When the Farudodstat concentration in the culture medium was 1 μM, it could reduce the HEV RNA level by about 50%. Mean±SEM; ****P<0.0001.
[0100] Example 5: In vitro experiment on the inhibition of HEV ORF2 protein expression by Farudodstat
[0101] (1) Culture of Huh7-HEV wild-type full-length model cells and ribavirin resistance-associated Huh7-HEV mutant full-length model cells
[0102] The Huh7-HEV wild-type full-length model cells and the Huh7-HEV mutant full-length model cells constructed in Example 1 were cultured in 60 mm culture dishes in DMEM high glucose medium (Bio-Channel) + 10% FBS (Bio-Channel) at 37°C in a 5% CO2 incubator. After the cells reached confluence, they were plated and treated with drugs.
[0103] (2) Experimental grouping and treatment
[0104] The cells cultured in step (1) were respectively stored at 3 × 10⁻⁶ cells per well. 4 Cells were seeded into 48-well plates. After 24 hours of cell adhesion, the cells were divided into groups and treated with the drug. Each group had two replicates. The groups were as follows:
[0105] a. Experimental group: Farudodstat was added to the culture medium to make the final concentrations 0.016, 0.08, 0.4, 2 and 10 μM respectively, and the culture was carried out for 72 hours.
[0106] b. Blank control group: treated with the same volume of 1% DMSO as the experimental group a.
[0107] (3) Experimental methods
[0108] Preparation of rabbit-derived anti-HEV ORF2 protein: Before immunization, 2 mL of blood was collected from the marginal ear vein of rabbits, and the serum was separated as a negative control. The purified HEV-AORF2 recombinant protein (1 mg) was diluted to 1 mL with physiological saline and emulsified with an equal volume of 1 mL Freund's complete adjuvant before immunization. A second immunization was performed 2 weeks later. A total of 5 immunizations were required. Before each immunization, blood was collected from the marginal ear vein to test the antibody titer produced after the previous immunization. One week after the final immunization, blood was collected from the marginal ear vein to test the titer. Afterwards, rabbits were anesthetized with 10 mL of 10% chloral hydrate, and all blood was collected from the heart. The serum was separated and used as the rabbit-derived anti-HEV ORF2 polyclonal antibody.
[0109] After treating the two groups in step (2) for 72 h, the cell culture supernatant was discarded, and the cells were fixed with 4% paraformaldehyde at room temperature for 30 min, washed once with PBS, and perforated with 0.3% Triton X-100 for 15 min. After blocking with 5% skim milk at room temperature for 1 h, the cells were incubated overnight at 4°C with rabbit anti-HEV ORF2 protein (dilution ratio 1:3000, Rabbit) as the primary antibody, and incubated at room temperature for 1 h with FITC-labeled goat anti-rabbit IgG (1:500, Jackson, 111-585-003) as the secondary antibody, followed by washing three times with PBS. The cell nuclei were stained with Hoechst fluorescent dye (dilution ratio 1:500, Invitrogen, 33342), and then photographed using an inverted fluorescence microscope (Olympus) to analyze the effect of red HEV ORF2 protein expression level. The positive rate of HEV ORF2 protein was analyzed by ImageJ, and its IC50 was calculated.
[0110] (4) Results
[0111] Experimental results are as follows Figure 4 As shown, by Figure 4 It can be seen that after Farudodstat treatment, the expression of HEV ORF2 protein was reduced in wild-type and three mutant HEV replication models compared with the blank control group (1% DMSO), and the IC50 is shown in Table 8.
[0112] Table 8. IC50 of Farudodstat against HEV wild-type and mutant types.
[0113]
[0114] Note: p6 is a full-length wild-type Huh7-HEV model cell.
[0115] Example 6: In vitro experiment on Farudodstat inhibiting HEV RNA replication in organoids
[0116] (1) Constructing an organoid HEV replication model
[0117] Methods for constructing organoid HEV replication models:
[0118] The liver organoid culture method was performed according to the organoid culture method published by the patent applicant (Wenshi Wang et al., Hepatology. 2018, 67(6):2096-2112; Wenshi Wang et al., Science Signaling. 2017, 25; 10(476)). The reference steps are as follows: Liver specimen (1-2cm) 3After washing with DMEM medium (containing 1% FCS and 0.1% penicillin-streptomycin), the cells were chopped and incubated with digestion solution (collagenase 2.5 mg / mL) (37°C, 30 min). The cells were then filtered through a 70 μM filter to obtain isolated cells. The isolated cells were counted and mixed with an appropriate amount of basement membrane extract (BME) solution, then seeded into 48-well suspension plates. After the BME solution solidified, 250 μL of isolation medium was added to each well. After one week, the isolation medium was replaced with expansion medium. Thereafter, the expansion medium was changed twice a week, and the cells were passaged every 7-10 days depending on the organoid density.
[0119] Organoids were collected in cold Advance DMEM / F12 medium. Then, the organoids were resuspended in Opti-MEM, centrifuged at 500g, 8°C for 5 min, and 200 μL of the Opti-MEM organoid suspension was thoroughly mixed with 6 μg of HEV replicon RNA or wild-type RNA and added to a 4 mm electroporation cuvette. Electroporation was performed according to the following procedure: 700V, 4 ms pulse length. The organoids were washed three times with Opti-MEM to remove residual RNA, embedded in a matrix gel, and cultured in EM medium at 37°C with 5% CO2.
[0120] (2) HEV replication models were prepared using organoids embedded in matrix gel at 3 × 10⁻⁶ wells. 4 Cells were seeded into 24-well plates and cultured in advanced DMEM / F12 medium (Invitrogen) for 24 hours. Then, the cells were divided into groups for drug treatment, as follows:
[0121] a. Experimental group: Farudodstat was added to the culture medium to make the final concentration of Farudodstat 25 μM.
[0122] b. Blank control group: treated with the same volume of 1% DMSO as the experimental group a.
[0123] (3) Experimental methods
[0124] After treating the two groups for 72 hours, organoid HEV RNA was extracted and quantified using the TRIzol method to analyze the effect of Farudodstat on HEV RNA replication levels in organoids.
[0125] (4) Results
[0126] Experimental results are as follows Figure 5 As shown. By Figure 5It can be seen that, after treatment with Farudodstat, the HEV RNA replication in the organoid HEV replication model was significantly reduced compared with the blank control group (1% DMSO).
[0127] Example 7: Effect of Farudodstat on inhibiting HEV-p6Gluc replication in liver organoids from different donors.
[0128] The livers used in this embodiment were from two donors at Erasmus Medical Center (EMC) and were approved by the EMC Ethics Committee (ethics number MEC-2014-060). An organoid replication model was constructed according to the method described in Example 6.
[0129] (1) The organoid HEV replication models were grouped and treated with drugs as follows:
[0130] a. Experimental group: Different concentrations (0.02 / 0.2 / 1 / 5 / 10 / 25μM) of Farudodstat were added to the culture medium for treatment.
[0131] b. Blank control group: treated with the same volume of 1% DMSO as the experimental group a.
[0132] (2) Experimental methods
[0133] After treating the two groups separately for 72 hours, the supernatant was collected, and the Gaussian luciferase activity was detected using a Gaussian luciferase assay kit to analyze the inhibition of HEV replicon replication by Farudodstat in different donor liver organoids.
[0134] (3) Results
[0135] Experimental results are as follows Figure 6 As shown. By Figure 6 It can be seen that after treatment with Farudodstat, the replication of the HEV replicative subsystem in liver organoid HEV-p6Gluc replication model cells was significantly reduced compared with the blank control group (1% DMSO). The replication capacity of the HEV replicative subsystem was lowest when the Farudodstat concentration was 25 μM.
[0136] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. The application of Farudodstat in the preparation of drugs against hepatitis E virus, characterized in that, The structure of Farudodstat is shown in Equation I: Equation I; Hepatitis E virus is a type A genotype 3 hepatitis E virus belonging to the hepatitis E virus family.
2. The application of Farudodstat in the preparation of drugs that inhibit intracellular hepatitis E virus RNA replication in vitro, characterized in that... Hepatitis E virus is a type A genotype 3 hepatitis E virus belonging to the hepatitis E virus family.
3. The application according to claim 2, characterized in that, The cells include hepatitis E virus replicon model cells, hepatitis E virus wild-type full-length model cells, and hepatitis E virus mutant full-length model cells.
4. The application according to claim 2 or 3, characterized in that, The concentration of Farudodstat in the cell culture system is 0.02~50 μmol / L.
5. The application of Farudodstat in the preparation of drugs that inhibit hepatitis E virus RNA replication in organoids, characterized in that, The organoids include liver organoids; The hepatitis E virus mentioned is hepatitis E virus of type A, gene type 3.
6. The application according to claim 5, characterized in that, The concentration of Farudodstat in the cell culture system is 0.02~50 μmol / L.
Citation Information
Patent Citations
Anti-inflammatory agents as virostatic compounds
CN102458389A
Methods of therapy comprising administering a therapeutically effective combination comprising a dhodh inhibitor and an IDH inhibitor
WO2022167402A1