siRNA drug delivery system, preparation method and application thereof

By using the siRNA drug delivery system and employing targeted antibody and endosomal fusion peptide technology, highly efficient targeted delivery and site-specific release of AML cells have been achieved, solving the problems of poor selectivity and significant side effects in existing AML treatments and improving treatment efficacy.

CN116870186BActive Publication Date: 2026-06-23TIANJIN MEDICAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
TIANJIN MEDICAL UNIV
Filing Date
2023-06-06
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Existing AML treatments such as chemotherapy, hematopoietic stem cell therapy, and CAR-T therapy have poor selectivity and significant side effects. Immune checkpoint therapy is not effective in AML treatment, and there is a lack of effective targeted therapies.

Method used

A siRNA drug delivery system is provided, which forms a linker by co-assembling a fusion protein with a siRNA drug. The system utilizes an antibody targeting cell surface antigens and an endosome fusion peptide to achieve targeted delivery and site-specific release of siRNA. The system includes a substrate peptide, an endosome fusion peptide, an antibody targeting cell surface antigens, a tag protein, and siRNA that specifically inhibits LILRB4 expression.

Benefits of technology

This study achieved highly efficient targeted delivery and release of siRNA drugs in AML cells, significantly improving therapeutic efficacy, enhancing the killing ability against tumor cells, and demonstrating good in vivo targeting and stability of nucleic acid drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116870186B_ABST
    Figure CN116870186B_ABST
Patent Text Reader

Abstract

The application relates to the field of biological medicine, and discloses an siRNA drug delivery system, a preparation method and application thereof. The siRNA drug delivery system contains a linker formed by co-assembly of a fusion protein and an siRNA drug, the fusion protein contains a substrate peptide, an endosome fusion peptide, an antibody for targeting a cell surface antigen, and a label protein connected with the siRNA drug. The preparation method of the siRNA drug delivery system comprises the following steps: mixing the fusion protein with the siRNA drug to perform reaction I, wherein the fusion protein contains a substrate peptide, an endosome fusion peptide, an antibody for targeting a cell surface antigen, and a label protein for being connected with the siRNA drug. The system can realize the targeted delivery and site-specific release of the siRNA, can realize the high-efficiency endocytosis of nucleic acid drugs, and finally improves the treatment effect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to an siRNA drug delivery system, its preparation method, and its application. Background Technology

[0002] Acute myeloid leukemia (AML) is a hematologic malignancy caused by the invasion of bone marrow, blood, and extramedullary tissues by abnormally proliferating, differentiating, and cloning hematopoietic stem cells. With the increasing aging of China's population, the incidence of AML is showing a significant upward trend.

[0003] While the incidence of AML is increasing, progress in its treatment has been relatively slow. Currently, the main clinical treatments for AML include chemotherapy, hematopoietic stem cell therapy, and CAR-T therapy. Although these three therapies have achieved some clinical efficacy, chemotherapy lacks selectivity between normal cells and cancer cells, leading to drug resistance and low efficacy. Stem cell transplantation has problems with numerous complications and high mortality rates. CAR-T therapy can cause cytokine release syndrome and neurotoxicity, and the expression of surface antigens in some cells and tissues can cause non-tumor toxicity associated with CAR-T targeting.

[0004] In recent years, with the development of high-throughput sequencing, more AML targets have been discovered. The development and research of small molecule inhibitors targeting specific targets have brought new hope to the treatment of AML, especially for elderly patients intolerant to chemotherapy. Furthermore, immunotherapy has become a new pillar of cancer treatment. Immune checkpoint therapies such as monoclonal antibodies (mAbs) targeting the CTLA-4 or PD-1 pathways have greatly changed the treatment of solid tumor oncology, but they have not yet shown clinical benefit in the treatment of AML. Therefore, finding new immuno-targeted therapies is an urgent and significant need in the clinical treatment of AML. Summary of the Invention

[0005] The purpose of this invention is to overcome the problems existing in the prior art and provide an siRNA drug delivery system, its preparation method and application. This drug delivery system can target and release siRNA at specific sites, achieving efficient cell entry of nucleic acid drugs and ultimately improving the therapeutic effect.

[0006] To achieve the above objectives, the first aspect of the present invention provides an siRNA drug delivery system comprising a linker formed by co-assembling a fusion protein and an siRNA drug, wherein the fusion protein comprises a substrate peptide, an endosome fusion peptide, an antibody targeting a cell surface antigen, and a tag protein linked to the siRNA drug.

[0007] Preferably, the siRNA drug is an siRNA that can specifically inhibit and silence the expression of leukocyte immunoglobulin receptor B4.

[0008] Preferably, the siRNA drug contains a completely reverse complementary sense strand and an antisense strand, the nucleotide sequences of which are any pair as shown in SEQ ID NO.1 and SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10.

[0009] Preferably, the substrate peptide is a Fruin substrate peptide, the endosome fusion peptide is an HA2 peptide, and the antibody targeting the cell surface antigen is a single-chain antibody H22 targeting CD64.

[0010] Preferably, the amino acid sequence of the Fruin substrate peptide is shown in SEQ ID NO.11, the amino acid sequence of the HA2 peptide is shown in SEQ ID NO.12, and the amino acid sequence of the single-chain antibody H22 is shown in SEQ ID NO.13.

[0011] Preferably, the siRNA drug has a benzylguanine group attached to it, and the tag protein is covalently linked to the benzylguanine group.

[0012] Preferably, the tag protein is a SNAP-tag, and the amino acid sequence of the SNAP-tag is shown in SEQ ID NO.14.

[0013] Preferably, the benzylguanine group is linked to the siRNA drug via a disulfide bond in the form of a benzylguanine derivative.

[0014] A second aspect of the present invention provides a method for preparing an siRNA drug delivery system, comprising the following steps: mixing a fusion protein with an siRNA drug to perform reaction I, wherein the fusion protein contains a substrate peptide, an endosome fusion peptide, an antibody targeting a cell surface antigen, and a tag protein for linking to the siRNA drug.

[0015] Preferably, the molar ratio of the fusion protein to the siRNA drug is 1.5-2.5:1.

[0016] Preferably, the conditions for reaction I include at least: protection from light, a temperature of 5-40°C, and a time of 1-3 hours.

[0017] Preferably, the siRNA drug is an siRNA capable of specifically inhibiting and silencing the expression of leukocyte immunoglobulin receptors.

[0018] Preferably, the siRNA drug contains a completely reverse complementary sense strand and an antisense strand, the nucleotide sequences of which are any pair as shown in SEQ ID NO.1 and SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10.

[0019] Preferably, the substrate peptide is a Fruin substrate peptide, the endosome fusion peptide is an HA2 peptide, and the antibody targeting the cell surface antigen is a single-chain antibody H22 targeting CD64.

[0020] Preferably, the amino acid sequence of the Fruin substrate peptide is shown in SEQ ID NO.11, the amino acid sequence of the HA2 peptide is shown in SEQ ID NO.12, and the amino acid sequence of the single-chain antibody H22 is shown in SEQ ID NO.13.

[0021] Preferably, the siRNA drug has a benzylguanine group attached to it, and the tag protein is covalently linked to the benzylguanine group.

[0022] Preferably, the tag protein is a SNAP-tag, and the amino acid sequence of the SNAP-tag is shown in SEQ ID NO.14.

[0023] Preferably, the benzylguanine group is linked to the siRNA drug via a disulfide bond in the form of a benzylguanine derivative.

[0024] Preferably, the process of linking the benzylguanine group to the siRNA drug includes: reacting the benzylguanine derivative with succinimide 3-(2-pyridyldithio)-propionate in reaction II, purifying and drying to obtain product I, and then reacting the siRNA drug with product I after cysteine ​​modification in reaction III.

[0025] Preferably, the benzylguanine derivative is 6-aminomethylbenzylguanine, the molar ratio of the benzylguanine derivative to succinimide 3-(2-pyridyldithio)-propionate is 0.8-1:1, and the molar ratio of the siRNA drug to product I is 1:80-120.

[0026] A third aspect of the present invention provides the application of the above-described siRNA drug delivery system and / or the siRNA drug delivery system prepared by the above-described method in the preparation of antitumor drugs.

[0027] Preferably, the antitumor drug is a drug for treating acute myeloid leukemia.

[0028] The beneficial effects of the present invention through the above technical solution are as follows:

[0029] The siRNA drug delivery system provided by this invention can specifically bind to cell surface antigens under the mediation of antibodies, successfully delivering siRNA drugs to target sites on cells, significantly increasing cellular uptake of siRNA drugs. Simultaneously, it promotes the escape of siRNA drugs from endosomes through enzyme-responsive cleavage of substrate peptides and endosome fusion peptides, enabling siRNA drugs to successfully reach the cytoplasm, effectively silencing the expression of target receptors in tumor cells, achieving efficient cellular entry of nucleic acid drugs and ultimately improving therapeutic efficacy, thereby achieving anti-tumor effects. Furthermore, this siRNA drug delivery system exhibits good in vivo targeting.

[0030] Furthermore, using CD64, which is highly expressed in the M4 / M5 subtype of mononuclear AML cells, as a cell surface antigen, and the humanized single-chain antibody H22 as the antibody contained in the fusion protein, this siRNA drug delivery system can specifically bind to the CD64 antigen on AML cells, enabling its delivery to AML cells for targeted therapy. The siRNA drug has high specificity against LILRB4, and by modifying specific sites of the siRNA drug, not only can the stability of siRNA be improved, but also the single-chain antibody, multifunctional peptide, and SNAP tag can be successfully expressed using fusion expression technology. Utilizing the efficient coupling between the benzylguanine group and the tag protein SNAP tag, they are assembled into a novel antibody-siRNA conjugate system. This system can successfully release siRNA under the action of GSH, and at the same time, the system has good nuclease stability and serum stability. Attached Figure Description

[0031] Figure 1 This is an agarose gel electrophoresis image of the recombinant bacterial culture identified by PCR in Example 1;

[0032] Figure 2 This is a double enzyme digestion identification diagram of the recombinant plasmid pET28a-H22(scFV)-Furin-HA2-SNAP in Example 1;

[0033] Figure 3 This is the physical map of the recombinant plasmid pET28a-H22(scFV)-Furin-HA2-SNAP in Example 1;

[0034] Figure 4 This is a characterization diagram of the fusion protein in Test Example 1. In this diagram, A is an SDS-PAGE electrophoresis image of H22(scFv)-Furin-HA2-SNAP, B is a Western Blot characterization of the His tag, and C is an SDS-PAGE analysis of the SNAP tag.

[0035] Figure 5 This is a diagram verifying the targeting of the fusion protein in Test Example 1. In it, A is the expression of CD64 on the surface of different cells examined by flow cytometry, B is the protein targeting verified by flow cytometry, and C is the protein uptake observed by laser confocal microscopy (scale bar: 20 μm).

[0036] Figure 6 This is a fluorescence intensity diagram of LILRB4 and CD64 expression on the surface of THP-1 cells in Example 2;

[0037] Figure 7 The silencing effect of different LILRB4 siRNA sequences on the mRNA level in THP-1 cells;

[0038] Figure 8 The image shows the characterization of BG-SS-siRNA in test example 2. In this image, A is the PAGE gel result and B is the MALDI-TOP mass spectrum of BG-SS-siRNA.

[0039] Figure 9 The figures show the characterization and release performance of the APSBS system in Test Example 3. In this figure, A is the agarose gel electrophoresis characterization of the APSBS system construction, B is the MALDI-TOP mass spectrum of the APSBS system, and C is the agarose gel electrophoresis examination of the siRNA release performance in the APSBS system.

[0040] Figure 10 These are stability characterization diagrams of the APSBS system in Test Example 3. In this diagram, A is an agarose gel electrophoresis diagram of the APSBS system after incubation with RNase for different times, and B is an agarose gel electrophoresis diagram of the APSBS system after incubation with FBS for different times.

[0041] Figure 11 This is a flow cytometry graph showing the specific binding ability of the APSBS system to leukemia cells in Test Example 4;

[0042] Figure 12 This is an uptake diagram of the APSBS system in THP-1 cells in test example 4. Cy5 (red) is used to label siRNA, and blue is used to label cell nuclei. Scale bar: 20 μm.

[0043] Figure 13This is a diagram analyzing the cellular uptake mechanism of the fusion protein in Test Example 4. In this diagram, A shows the cellular uptake of the fusion protein in THP-1 cells treated with different endocytosis inhibitors and at 4°C. B shows the fluorescence intensity of the fusion protein in cells as measured by Image J. Scale bar: 20 μm; *P<0.05, **P<0.01, ***P<0.001, n=3.

[0044] Figure 14 This is a graph showing the colocalization of siRNA and lysosomes at different time points in Test Example 4. A is a confocal microscope image of the APSBS system taken up by cells; B is the colocalization coefficient of the APSBS system group; Cy5 (red) labels siRNA; Lysotracker (green) labels lysosomes; blue represents the cell nucleus; scale bar: 20 μm; *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, n=3;

[0045] Figure 15 This is a graph showing the safety results of the CCK-8 assay system for NHDF and THP-1 cells in Test Example 4;

[0046] Figure 16 This is the test of the LILRB4 gene silencing effect of the APSBS system in THP-1 cells in test example 4. In this example, A is the expression level of LILRB4 mRNA detected by qRT-PCR, and B is the expression level of LILRB4 protein detected by Western Blot.

[0047] Figure 17 This is a graph evaluating the antitumor effect of the APSBS system in test example 4. A shows the comparison of the transendothelial migration ability of the APSBS system and the control group, and B shows the killing effect of T cells on THP-1 cells. *P<0.05, n=3. Detailed Implementation

[0048] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0049] The first aspect of the present invention provides an siRNA drug delivery system comprising a linker formed by co-assembling a fusion protein and an siRNA drug, wherein the fusion protein comprises a substrate peptide, an endosome fusion peptide, an antibody targeting a cell surface antigen, and a tag protein linked to the siRNA drug.

[0050] In this invention, the substrate peptide and the antibody targeting cell surface antigen in the fusion protein can be designed or selected according to the type of tumor cells targeted by the drug delivery system. Under antibody mediation, the siRNA drug delivery system can specifically target and bind to cell surface antigens, successfully delivering the siRNA drug to the cells and significantly increasing cellular uptake of the siRNA drug. Simultaneously, through enzyme-responsive cleavage of the substrate peptide and endosome fusion peptide, it promotes the escape of the siRNA drug from the endosomes, enabling the siRNA drug to successfully reach the cytoplasm, effectively silencing the expression of the target receptor in tumor cells, achieving efficient cellular entry of nucleic acid drugs and ultimately improving therapeutic efficacy, thereby exerting an anti-tumor effect. Furthermore, this siRNA drug delivery system exhibits good in vivo targeting.

[0051] According to the present invention, the siRNA drug can be any type of siRNA capable of anti-tumor use. When the siRNA drug delivery system is used to treat acute myeloid leukemia (AML), preferably, the siRNA drug is an siRNA capable of specifically inhibiting and silencing the expression of leukocyte immunoglobulin receptors; more preferably, it is an siRNA capable of specifically inhibiting and silencing the expression of leukocyte immunoglobulin receptor B4 (LILRB4). LILRB4 is highly expressed in primary AML cells, inhibiting T cell activity and promoting tumor invasion. Using an siRNA drug with a high specific silencing effect on the target molecule LILRB4, the siRNA drug delivered by the siRNA drug delivery system can effectively promote the killing of tumor cells by T cells after exerting its silencing effect, thereby achieving the purpose of immunotherapy.

[0052] According to the present invention, preferably, the siRNA drug contains a completely reverse complementary sense strand and an antisense strand, the nucleotide sequence of the sense strand of the siRNA drug is shown in SEQ ID NO.1, and the nucleotide sequence of the antisense strand of the siRNA is shown in SEQ ID NO.2;

[0053] LILRB4-1 Chain of Justice: 5'-GUGAAACACUCCAGACCUA-3' (SEQ ID NO.1);

[0054] LILRB4-1 antisense strand: 5'-UAGGUCUGGAGUGUUUCACCU-3' (SEQ ID NO.2);

[0055] Alternatively, the nucleotide sequence of the sense strand of the siRNA drug is shown in SEQ ID NO.3, and the nucleotide sequence of the antisense strand of the siRNA is shown in SEQ ID NO.4;

[0056] LILRB4-2 Chain of Justice: 5'-GGAGAUACCGCUGUUACUA-3' (SEQ ID NO.3);

[0057] LILRB4-2 antisense strand: 5'-UAGUAACAGCGGUAUCUCCCU-3' (SEQ ID NO.4);

[0058] Alternatively, the nucleotide sequence of the sense strand of the siRNA drug is shown in SEQ ID NO.5, and the nucleotide sequence of the antisense strand of the siRNA is shown in SEQ ID NO.6;

[0059] LILRB4-3 Justice Chain: 5'-GAGGACAGACAGAUGGACA-3' (SEQ ID NO.5);

[0060] LILRB4-3 antisense strand: 5'-UGUCCAUCUGUCUGUCCUCUU-3' (SEQ ID NO.6);

[0061] Alternatively, the nucleotide sequence of the sense strand of the siRNA drug is shown in SEQ ID NO.7, and the nucleotide sequence of the antisense strand of the siRNA is shown in SEQ ID NO.8;

[0062] LILRB4-4 Chain of Justice: 5'-GGGAGUACCGUCUGGAUAA-3' (SEQ ID NO.7);

[0063] LILRB4-4 antisense strand: 5'-UUAUCCAGACGGUACUCCCGA-3' (SEQ ID NO.8);

[0064] Alternatively, the nucleotide sequence of the sense strand of the siRNA drug is shown in SEQ ID NO.9, and the nucleotide sequence of the antisense strand of the siRNA is shown in SEQ ID NO.10;

[0065] LILRB4-5 Chain of Justice: 5'-GAGUCCUCUUGUGACCUCAAAACC-3' (SEQ ID NO.9);

[0066] LILRB4-5 antisense strand: 5'-UGAGGUCACAAGAGGACUCGG-3' (SEQ ID NO.10).

[0067] More preferably, the nucleotide sequences of the sense and antisense strands of the siRNA drug are SEQ ID NO. 5 and SEQ ID NO. 6, respectively. The inventors have found that, under this preferred embodiment, the siRNA drug exhibits the best inhibitory efficiency and the highest silencing efficiency against the LILRB4 gene.

[0068] According to the present invention, in order to further improve the inhibitory effect and stability of siRNA drugs on the target molecule LILRB4, effectively protect siRNA drugs from degradation, and provide a guarantee for their subsequent in vivo and in vitro efficacy, the sense and antisense strands of the siRNA drug are stabilized by modification, including: nucleotides at positions 5, 7, 8, and 9 of the sense strand are fluorinated nucleotides, and nucleotides at other positions of the sense strand are methoxylated nucleotides; nucleotides at positions 2, 6, 8, 9, 14, and 16 of the antisense strand are fluorinated nucleotides, and nucleotides at other positions of the antisense strand are methoxylated nucleotides; phosphate ester groups with modifying groups are present between the first and second nucleotides at the 5' end of the sense strand, between the second and third nucleotides at the 5' end of the antisense strand, and between the first and second nucleotides at the 5' end of the antisense strand, between the second and third nucleotides at the 3' end of the antisense strand, and between the first and second nucleotides at the 3' end of the antisense strand. The inventors discovered that, under this preferred embodiment, the siRNA drug has a stronger silencing effect on the target molecule LILRB4 of AML cells, and has high activity and high stability, and also enables the siRNA drug delivery system to have good nuclease stability.

[0069] The sequence information of the modified siRNA drug is shown in Table 1, where m represents methoxy modification, f represents fluorine modification, and s represents a phosphate ester group with a modifying group between two nucleotides.

[0070] Table 1

[0071]

[0072] During their research, the inventors discovered that compared to non-monocyte AML cell subpopulations, the M4 / M5 subtype of mononuclear AML cells exhibits higher invasiveness and aggressiveness, leading to diverse clinical manifestations and poor treatment outcomes, necessitating the search for new targeted therapies. Therefore, when using an siRNA drug delivery system to treat acute myeloid leukemia (AML), CD64 is preferably used as the cell surface antigen, and the antibody targeting the cell surface antigen is a single-chain antibody H22 targeting CD64. The inventors found that, in this preferred embodiment, the single-chain antibody H22 recognizes CD64, triggering endocytosis. Intracellular enzymatic cleavage of the substrate peptide and endosome fusion peptide-mediated endosome escape occur. Under the action of highly expressed glutathione in the cytoplasm, disulfide bonds break, releasing the siRNA drug, thereby activating T-cell immunotherapy and reducing tumor invasion.

[0073] According to the present invention, preferably, the amino acid sequence of the single-chain antibody H22 is as shown in SEQ ID NO.13.

[0074] According to the present invention, preferably, the substrate peptide is a Fruin substrate peptide, and more preferably, the amino acid sequence of the Fruin substrate peptide is shown in SEQ ID NO.11; the endosome fusion peptide is a HA2 peptide, and more preferably, the amino acid sequence of the HA2 peptide is shown in SEQ ID NO.12.

[0075] According to the present invention, the fusion protein and the siRNA drug can be linked by a variety of groups capable of forming covalent bonds to form an siRNA drug delivery system. Preferably, the fusion protein and the siRNA drug are linked by disulfide bonds. When the siRNA drug delivery system is used to treat acute myeloid leukemia (AML), preferably, the siRNA drug is attached with a benzylguanine (BG) group, and the tag protein is covalently (by disulfide bond) linked to the benzylguanine group.

[0076] According to the present invention, the tag protein can be a SNAP-tag or a CLIP-tag, preferably a SNAP-tag, the amino acid sequence of which is shown in SEQ ID NO.14. The inventors have discovered that, in this preferred embodiment, the SNAP-tag can bind with the BG group with high specificity, achieving efficient conjugation of the antibody and siRNA drug, forming a novel antibody-siRNA conjugated drug system.

[0077] According to the present invention, preferably, the benzylguanine group is linked to the siRNA drug via a disulfide bond in the form of a benzylguanine derivative, for example, the linkage structure is BG-SS-siRNA. The inventors have found that, under this preferred embodiment, BG can be conjugated to the siRNA drug, which is beneficial for the highly specific reaction of BG with the SNAP-tag, forming a stable siRNA drug delivery system.

[0078] According to the present invention, the fusion protein is formed into a recombinant plasmid using a vector plasmid, and then transformed into competent cells for expression, thereby achieving efficient expression of target proteins such as substrate peptides, endosome fusion peptides, and antibodies targeting cell surface antigens. Preferably, the vector for the fusion protein is plasmid pET28a.

[0079] A second aspect of the present invention provides a method for preparing an siRNA drug delivery system, comprising the following steps: mixing a fusion protein with an siRNA drug to perform reaction I, wherein the fusion protein contains a substrate peptide, an endosome fusion peptide, an antibody targeting a cell surface antigen, and a tag protein for linking to the siRNA drug.

[0080] The siRNA drug delivery system provided by this invention has a simple preparation method. It forms a stable drug delivery system by covalently coupling and self-assembling a fusion protein with an siRNA drug, which is beneficial for its promotion and application in the preparation of anti-tumor drugs.

[0081] According to the present invention, preferably, the molar ratio of the fusion protein to the siRNA drug is 1.5-2.5:1. The inventors have found that, under this preferred embodiment, the siRNA drug delivery system can achieve highly efficient delivery of the siRNA drug, and the siRNA drug exhibits good stability, which is beneficial for improving its silencing effect in vivo and in vitro, and enhancing its anti-tumor efficacy.

[0082] According to the present invention, preferably, the conditions for reaction I include at least: protection from light, a temperature of 5-40°C, and a time of 1-3 hours. The inventors have found that under this preferred embodiment, the generation efficiency and stability of the siRNA drug delivery system can be effectively improved.

[0083] According to the present invention, preferably, the siRNA drug is an siRNA capable of specifically inhibiting and silencing the expression of leukocyte immunoglobulin receptor B4.

[0084] According to the present invention, preferably, the siRNA drug contains a completely reverse complementary sense strand and an antisense strand, wherein the nucleotide sequences of the sense strand and the antisense strand are as shown in any pair of SEQ ID NO.1 and SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10.

[0085] According to the present invention, preferably, the substrate peptide is a Fruin substrate peptide, the endosome fusion peptide is an HA2 peptide, and the antibody targeting the cell surface antigen is a single-chain antibody H22 targeting CD64.

[0086] According to the present invention, preferably, the amino acid sequence of the Fruin substrate peptide is shown in SEQ ID NO.11, the amino acid sequence of the HA2 peptide is shown in SEQ ID NO.12, and the amino acid sequence of the single-chain antibody H22 is shown in SEQ ID NO.13.

[0087] According to the present invention, preferably, the siRNA drug is attached to a benzylguanine group, and the tag protein is covalently linked to the benzylguanine group.

[0088] According to the present invention, preferably, the tag protein is a SNAP-tag, and the amino acid sequence of the SNAP-tag is shown in SEQ ID NO.14.

[0089] According to the present invention, preferably, the vector for the fusion protein is plasmid pET28a.

[0090] In this invention, the fusion protein can be prepared by using fusion expression technology to connect a substrate peptide, an endosome fusion peptide, and an antibody targeting a cell surface antigen to a vector plasmid to form a recombinant plasmid, and then transforming and expressing the recombinant plasmid with recombinant bacteria. The preparation method of the fusion protein may include: transforming (e.g., metal bath heat shock transformation), transducing, or transfecting the recombinant plasmid containing the fusion protein into host cells (e.g., *E. coli*) using conventional methods in the art to obtain recombinant bacteria; and purifying the recombinant bacteria after induction culture to obtain the fusion protein.

[0091] According to the present invention, preferably, the benzylguanine group is linked to the siRNA drug via a disulfide bond in the form of a benzylguanine derivative.

[0092] According to the present invention, preferably, the process of linking the benzylguanine (BG) group to the siRNA drug includes: mixing the benzylguanine derivative (BG derivative) with succinimide 3-(2-pyridyldithio)-propionate (SPDP) for reaction II, purifying and drying to obtain product I (i.e., BG-SH), and mixing the siRNA drug with product I after cysteine ​​modification for reaction III to form BG-SS-siRNA.

[0093] In this invention, the temperature, time, and other conditions of reactions II and III can be optimized to improve the corresponding reaction efficiency. For example, the temperature of reaction II is 5-40℃ and the time is 0.8-2h; the temperature of reaction III is 5-40℃ and the time is 10-15h. The purification process is to remove excess raw materials to improve the purity of product I, and drying can be achieved by freeze drying.

[0094] According to the present invention, the BG derivative can be any conventional substance containing a benzylguanine group, and the amounts of BG derivative and SPDP, and the amounts of siRNA drug and product I can be rationally selected according to their product structures. Preferably, the BG derivative is 6-aminomethylbenzylguanine, the molar ratio of the BG derivative to SPDP is 0.8-1:1, and the molar ratio of the siRNA drug to product I is 1:80-120.

[0095] For example, the synthesis and release of BG-SS-siRNA specifically includes: firstly, introducing a cysteine ​​group into the 3' end of the positive strand of the siRNA drug via a chemical reaction to obtain SH-siRNA; then, performing a condensation reaction between 6-aminomethylbenzylguanine and succinimide 3-(2-pyridyldithio)-propionate (SPDP), removing excess raw material, and lyophilizing to obtain BG-SH; mixing BG-SH and SH-siRNA for dehydrogenation to form a disulfide bond, removing excess raw material, and lyophilizing to obtain BG-SS-siRNA; its synthetic route is as follows:

[0096]

[0097] According to a particularly preferred embodiment of the present invention, a method for preparing an siRNA drug delivery system includes the following steps:

[0098] (1) Using plasmid pET28a as a vector, the fusion protein H22(scFV)-Furin-HA2-SNAP was constructed using fusion expression technology;

[0099] (2) 6-Aminomethylbenzylguanine was dissolved in anhydrous dimethylformamide and then mixed with SPDP at a molar ratio of 0.8-1:1. The mixture was stirred at room temperature for 0.8-2 h, and excess raw material was removed by silica gel column chromatography. The mixture was then lyophilized to obtain BG-SH. siRNA-SH and BG-SH were mixed in PBS buffer at a molar ratio of 1:80-120 and reacted at room temperature for 10-15 h. Excess BG-SH was removed by dialysis, and the mixture was then lyophilized to obtain BG-SS-siRNA. The sense strand of the siRNA drug is:

[0100] 5'-GmsAmsGmGmAfCmAfGfAfCmAmGmAmUmGmGmAmCmAm-3'

[0101] The antisense strand of siRNA drugs is:

[0102] 5'-UmsGfsUmCmCmAfUmCfUfGmUmCmUmGfUmCfCmUmCmsUmsUm-3';

[0103] (3) The fusion protein obtained in step (1) and the BG-SS-siRNA obtained in step (2) were reacted at a molar ratio of 1.5-2.5:1 at room temperature in the dark for 2 hours. Excess BG-SS-siRNA was removed by ultrafiltration to obtain the siRNA drug delivery system (APSBS system).

[0104] A third aspect of the present invention provides the application of the above-described siRNA drug delivery system and / or the siRNA drug delivery system prepared by the above-described method in the preparation of antitumor drugs.

[0105] According to the present invention, preferably, the antitumor drug is a drug for treating acute myeloid leukemia.

[0106] The present invention will be described in detail below through embodiments.

[0107] In the following examples, the BCA kit, glutathione (reduced form), tetrasodium ethylenediaminetetraacetate, and ribonuclease (RNase A) were all purchased from Beijing Solarbio Science & Technology Co., Ltd.; SNAP-Surface Alexa Fluor 488, restriction endonuclease NcoI, and restriction endonuclease XhoI were purchased from New England Biolabs, USA; succinimide 3-(2-pyridyldithio)-propionate (SPDP) was purchased from Thermo Fisher Scientific, USA; and Lipofectamine... Cells were purchased from Invitrogen (USA), 4% paraformaldehyde and CCK-8 kit were purchased from Dalian Meilun Biotechnology Co., Ltd., CD3 antibody and CD28 antibody were purchased from BD Biosciences (USA), FITC-CD64 antibody was purchased from Biolegend (USA), and E. coli DH5α competent cells and E. coli BL21(DE3) competent cells were purchased from Tiangen Biotech Co., Ltd. Cells were cultured in 1640 medium containing 10% FBS, 1% penicillin-streptomycin, and 0.1% β-mercaptoethanol at a density greater than 1×10⁻⁶ cells / year. 6 The cells were ready for passage; Raji cells were purchased from Shanghai Zhongqiao Xinzhou Biotechnology Co., Ltd., and cultured in 1640 medium containing 10% FBS and 1% penicillin-dextrose antibody, passaged every two days. Unless otherwise specified, other raw materials and reagents were standard commercially available products, and the room temperature was 25±5℃.

[0108] Example 1

[0109] (1) Primer design: Based on the nucleic acid sequence and primer design principles, the corresponding upstream and downstream primers F1 and R1 were designed and synthesized by Suzhou Genewiz Biotechnology Co., Ltd.

[0110] F1: TAATACGACTCACTATAGGG (SEQ ID NO.15),

[0111] R1: TGCTAGTTATTGCTCAGCGG (SEQ ID NO.16),

[0112] (2) Establish the PCR reaction system: buffer 3μL, primer 0.5μL, template (10nM) 2μL, polymerase buffer 2μL, add water to 20μL; PCR reaction conditions are: preheating 96℃ for 3min, denaturation 95℃ for 15s, annealing 62℃ for 15s, extension 72℃ for 45s, denaturation-extension cycle 23 times, 72℃ for 2min.

[0113] After the PCR reaction is complete, prepare a 1% agarose gel for nucleic acid electrophoresis. After electrophoresis, cut off the target gene and recover it using an agarose gel recovery kit.

[0114] (3) DNA digestion and ligation

[0115] The PCR gel recovery product from step (2) along with the vector was double-digested with a restriction endonuclease to obtain the target gene fragment with sticky ends. The digestion system was: 10×NEB buffer 5μL, DNA fragment or vector 1μg, Ncol 1μL, Xhol 1μL, water added to 50μL, and reacted at 37℃ for 1h.

[0116] The double-digested products (including the target gene and the digested vector) were ligated in a constant temperature system at 50℃ for 30 min. The ligation system consisted of 3 μL of purified PCR product, 2 μL of digested vector, and 5 μL of seamless assembly MIX.

[0117] (4) Plasmid transformation: Add a small amount of plasmid to competent DH5α cells, gently shake to mix, and let stand on ice for 30 min; heat shock in a metal bath at 42℃ for 90 s; let stand on ice for 3 min; add LB medium to each tube, and gently shake at 220 rpm in a shaker at 37℃ for 0.5 h.

[0118] (5) Verification of recombinants: Prepare agar plates containing kanamycin resistance; spread 100 μL of bacterial culture evenly on LB agar plates and spread the bacteria evenly on the surface of the plates using a sterile spreader; invert the plates and incubate overnight at 37°C until colonies appear; randomly select 8 single colonies from the plates and transfer them to LB medium, shake at 37°C and 220 rpm for 12 h, and take the bacterial culture for PCR identification. The PCR reaction system and PCR reaction conditions are the same as in step (2). After the reaction, identify the colonies by 1% agarose gel electrophoresis. The results are shown in the figure. Figure 1 After PCR amplification, a fragment of approximately 1600 bp was obtained, which was consistent with the expected fragment size, indicating that a positive recombinant was successfully obtained.

[0119] by Figure 1The bacterial culture of positive clone 8 was incubated overnight at 37°C with shaking to extract plasmids. The plasmid extraction procedure was performed according to the kit instructions. The concentration of the extracted plasmid was determined using Nanodrop. Double digestion with Xbal / Xhol was performed, and the results of the recombinant plasmid double digestion were characterized by 1% agarose gel electrophoresis. Figure 2 As shown, the obtained gene fragment is approximately 1600 bp, consistent with the expected size of 1601 bp; enzyme digestion results indicate that the recombinant plasmid pET28a-H22(scFV)-Furin-HA2-SNAP containing the H22(scFV)-Furin-HA2-SNAP gene was obtained, and its physical map is shown below. Figure 3 ;

[0120] (6) Expression of the fusion protein: Single colonies were picked from LB plates and inoculated into shake tubes containing LB medium, and cultured overnight at 37°C with shaking. The next day, 1% of the culture was inoculated into TB medium (formulation: tryptone 11.8 g / L, yeast extract 23.6 g / L, K2HPO4 9.4 g / L, KH2PO4 2.2 g / L, glycerol 4 ml / L) and cultured. 600 Add IPTG to a final concentration of 0.05 mM when the concentration is between 0.6 and 0.8, and incubate overnight on a shaker at 16°C; collect the bacterial pellet by centrifugation at 5000 rpm for 10 min.

[0121] (7) Purification of fusion protein: Resuspend the bacterial pellet obtained in step (7) in buffer A (20mM PB, 150mM NaCl, pH=8.0), sonicate on ice for 3 seconds, 5 seconds interval, 420W for 15 minutes, centrifuge at 16000g for 30 minutes, collect the supernatant, filter the supernatant through a 0.22μm filter membrane and inject it into the loading loop; install a HisTrip 5mL pre-packed column, install the column in liquid-liquid contact to prevent air bubbles; store the column in 20% ethanol, wash the column with water for 5-10 column volumes (CV) before use; equilibrate the Ni-NTA column for 5 CV using affinity chromatography buffer A; inject the treated supernatant into a 50mL Superloop loop at a flow rate of 0.5mL / min; use 20CV of buffer A and buffer B (20mM PB, 150mM NaCl, pH=8.0) to purify the fusion protein. The column was eluted using a gradient of NaCl, 300 mM imidazole, pH 8.0, and the elution fraction was collected in 1.5 mL EP tubes. After SDS-PAGE verification, the target protein H22(scFv)-Furin-HA2-SNAP was collected. The SDS-PAGE verification results are shown below. Figure 4 A.

[0122] Test Example 1

[0123] 1.1 Molecular weight (MW) of the fusion protein

[0124] A linear regression equation between lgMW and Rf was established using the standard protein molecular weight and migration rate. Based on the Rf value of the fusion protein, the linear regression equation was derived as: lgMW = 2.0662 - 1.3192Rf, R... 2 =0.9944, thus the molecular weight of the fusion protein is 55KD.

[0125] 1.2 BCA method for determining fusion protein concentration

[0126] The concentration of the unknown protein sample was calculated using the BCA method, and the specific steps are as follows: The final concentration of BSA standard was 0.5 mg / mL. The standard was added to 96-well plates at concentrations of 0 μL, 2 μL, 4 μL, 6 μL, 8 μL, 12 μL, 16 μL, and 20 μL. PBS was added to each well to a final concentration of 20 μL. 200 μL of working solution was added, and the plates were incubated at 37°C with a shaker. The absorbance of each well at 562 nm was measured using a microplate reader. A standard curve was plotted based on the relationship between absorbance and concentration. The target protein obtained in Example 1 was diluted 4-fold and added to a 96-well plate as the test sample. PBS was added to a final concentration of 20 μL, and other experimental steps were the same as above. The concentration of the protein was measured at A... 562 The absorbance was 0.256. Subtracting the absorbance of the blank well (0.098) and substituting it into the equation of the standard curve, the protein concentration was found to be 1.037 mg / ml.

[0127] 1.3 Western Blot and SDS-PAGE Characterization

[0128] 1.3.1 Western Blot Detection

[0129] Prepare a 12% SDS-PAGE gel. Denature the target protein obtained in Example 1 and add it to the sample wells. Set the initial voltage to 80V. After the bands emerge from the stacking gel, adjust the voltage to 120V. After electrophoresis, remove the gel plate and place the SDS-PAGE gel into the gel box. Incubate the SDS-PAGE gel in transfer buffer and equilibrate at room temperature on a shaker for 1 hour to remove salts acquired during electrophoresis. Cut a PVDF membrane and two sheets of thick filter paper to the same size as the gel. Activate the PVDF membrane with anhydrous methanol for 10 minutes before use, then place it together with the thick filter paper in a container. Soak in transfer buffer for 10 min; open the safety cover of the semi-dry transfer tank, remove the cathode device, and place moistened filter paper, PVDF membrane, gel, and another piece of moistened filter paper on the anode plate in sequence. Remove air bubbles with a roller, cover the cathode, turn on the power, set it to 15V, and run for 15 min. After the transfer is completed, soak the PVDF membrane in 1×TBST for 5 min to remove SDS; soak the PVDF membrane in 5% skim milk powder and seal it on a shaker for 2 h. After sealing, wash the PVDF membrane twice with TBST solution for 5 min each time.

[0130] Primary antibody incubation: The PVDF membrane was incubated overnight at 4°C with the prepared 6×His antibody solution, and washed 3 times with TBST solution for 10 min each time;

[0131] Incubation of secondary antibody: Immerse the PVDF membrane in HRP goat anti-mouse antibody and incubate at room temperature for 1 hour. Wash three times with 1×TBST for 10 minutes each time.

[0132] Development and Imaging: Liquids A and B in the ultrasensitive ECL chemiluminescence reagent kit are mixed thoroughly in a 1:1 ratio, ensuring this process is done in the dark. The PVDF membrane is placed on plastic wrap, and the ECL reagent is added dropwise onto the membrane. Incubation is performed in the dark for 1 minute. The PVDF membrane is then inverted on a developing apparatus for development. The results are as follows: Figure 4 As shown.

[0133] 1.3.2 Marking of SNAP Tags

[0134] The target protein purified in Example 1 was labeled using SNAP-Surface Alexa Fluor 488. The SNAP substrate reacted with SNAP, resulting in green fluorescence. The reaction consisted of 50 μM SNAP-tag purified protein, 250 μM SNAP-tag substrate, 50 mM DTT, and PBS, incubated at 37°C for 30 min on a shaker. After the labeling reaction, unreacted substrate and labeled SNAP-tag fusion protein were separated by gel filtration or dialysis. Samples were then run on SDS-PAGE gels and analyzed using a gel imaging system. The results are shown in [Figure number missing]. Figure 4 .

[0135] The target protein purified in Example 1 was further confirmed using SDS-PAGE and Wesrern Blot. The fusion protein's C-terminus was identified as a His tag, and a His-tag monoclonal antibody was used as the primary antibody to verify the expression of the His tag on the purified target protein. Wesrern Blot results showed a distinct band only around 55 kDa, indicating that the purified protein expressed the His tag. Figure 4 (B); the fusion protein has a SNAP tag at its N-terminus. Based on the high specificity of the reaction between SNAP and BG, a green fluorescent substrate BG was used to specifically react with SNAP, causing the purified protein to be labeled with green fluorescence. When the protein sample was run on an SDS-PAGE gel, a clear fluorescent band was observed at 55 kDa, indicating that the purified protein expressed the SNAP tag. Figure 4 (C). The above results indicate that the protein was expressed intact, and the target protein H22(scFv)-Furin-HA2-SNAP was successfully purified.

[0136] 1.4 Protein targeting validation

[0137] 1.4.1 Expression of CD64 on the cell surface

[0138] The fusion protein H22 (scFv) fragment can specifically bind to the CD64 receptor on the cell surface, thereby achieving targeted therapy for patients with AMLM4 / M5 subtypes. To verify the protein's targeting ability, a cell line with high CD64 expression needs to be identified. The specific experimental steps are as follows:

[0139] THP-1 cells and Raji cells were seeded into 6-well plates at a cell density of 5 × 10⁶ cells / well. 5 Cells were collected by centrifugation at a density of 10 cells / mL, washed three times with PBS, and Raji cells and THP-1 cells were incubated with FITC-CD64 antibody on ice for 30 minutes, washed three times with PBS, and passed through a 300-mesh sieve before flow cytometry to detect the fluorescence intensity on the cell surface.

[0140] 1.4.2 In vitro cell targeting of H22(scFv)-Fruin-HA2-SNAP

[0141] The fusion protein was labeled with a green fluorescent SNAP substrate overnight at 4°C. THP-1 cells and Raji cells were seeded into 12-well plates, and cells were collected by centrifugation. Raji cells and THP-1 cells were incubated with the fluorescently labeled fusion protein on ice for 30 min. After washing three times with pre-chilled PBS, the cells were sieved, and the intracellular fluorescence intensity was detected by flow cytometry. The results are shown in the figure. Figure 5 The positive rate of THP-1 cells can reach over 99%. Figure 5 (A) indicates that THP-1 cells highly express CD64 on their surface; the fluorescence intensity of Raji cells after adding CD64 antibody was no different from that of the control group, indicating that Raji cells hardly express CD64.

[0142] THP-1 cells and Raji cells were seeded into 12-well plates, and 100 nM of H22(scFv)-Fruin-HA2-SNAP fusion protein was added. Cells were incubated for 2 h, centrifuged to collect cells, washed three times with PBS, resuspended in PBS, and smeared using a cell slide machine. Cells were fixed with 4% paraformaldehyde for 10 min, stained with DAPI for 30 min, washed with PBS, air-dried, mounted with anti-fluorescence quenching mounting medium, and observed and photographed using a laser confocal microscope. Results are shown below. Figure 6 The fluorescence intensity of the fusion protein was significantly enhanced after incubation with THP-1 cells. Figure 5 (B) indicates that the protein can be taken up by THP-1 cells. The fluorescence intensity of the fusion protein after incubation with Raji cells showed no significant change compared to the control group, indicating that the protein cannot be taken up by Raji cells; confocal results ( Figure 5 The results from C) also indicate that the protein can be taken up by THP-1 cells but not by Raji cells.

[0143] In summary, the target protein H22(scFv)-Furin-HA2-SNAP can be selectively taken up by THP-1 cells, providing the conditions for its subsequent targeted therapy in vivo.

[0144] Example 2

[0145] (1) Immunophenotypic analysis of LILRB4 cell line: THP-1 cells were seeded in 6-well plates and the following experimental groups were set up: blank, CD64, LILRB4, and CD64+LILRB4. Cells were collected by centrifugation, resuspended in 100 μL of pre-chilled PBS, and the corresponding flow cytometry antibodies were added. The cells were incubated on ice for 30 min, washed three times with PBS, and then passed through a cell sieve before being analyzed for intracellular fluorescence intensity. The results are as follows: Figure 6 As shown, the positive rate of LILRB4 in THP-1 cells was over 99%, indicating that THP-1 cells highly express LILRB4 and can be used for subsequent in vitro and in vivo experiments.

[0146] (2) qRT-PCR screening of LILRB4 siRNA sequences: The LILRB4 mRNA sequence was downloaded from NCBI, and five candidate siRNAs targeting LILRB4 mRNA were designed using online tools. Certain specific sites of the siRNAs were modified using methods such as 2'-fluoropolymerization, 2'-methoxypolymerization, and thiophosphate modification to improve their stability and targeting specificity in serum while maintaining siRNA activity. The sense and antisense strand sequences of the LILRB4-1 to LILRB4-5 siRNA drugs targeting LILRB4 are shown in Table 1. Among them, the LILRB3-3 siRNA sequence showed the best inhibition efficiency against the LILRB4 gene, with a silencing efficiency of approximately 45%. The primer nucleotide sequences for LILRB4 and GAPDH are shown in Table 2.

[0147] Table 2

[0148]

[0149] Using the siRNA drug siNC as a negative control group, the positive chain (SEQ ID NO.21) is as follows:

[0150] UmsUmsCmUmCfCmGfAfAfCmGmUmGmUmCmAmCmGmUm;

[0151] The antisense chain (SEQ ID NO.22) is as follows:

[0152] AmsCfsGmUmGmAfCmAfCfGmUmUmCmGfGmAfGmAmAmsUmsUm;

[0153] The silencing effect of siRNA on the mRNA level of the target gene LILRB4 was detected by qRT-PCR. The specific experimental steps are as follows:

[0154] Seeding: THP-1 cells were seeded in 12-well plates and the experimental groups were as follows: PBS, Lipo / LILRB4-1, Lipo / LILRB4-2, Lipo / LILRB4-3, Lipo / LILRB4-4, Lipo / LILRB4-5 and Lipo / NC, with 3 replicates in each group;

[0155] Transfection: Except for PBS, the other groups were transfected with siRNA using Lipofectamine 2000 (Lipo). The Lipo / siRNA complex was added to the cells, and the cells were incubated for 4 hours. The medium was then replaced with 1640 complete medium and cultured for another 48 hours.

[0156] mRNA extraction: THP-1 cells were washed three times with PBS. Trizol reagent was added to each well, and the mixture was pipetted and collected into centrifuge tubes. The cells were incubated at room temperature for 5 min. Chloroform was added, the cells were shaken for 20 seconds, incubated for 2 min, and centrifuged at 12000g for 15 min. The supernatant was transferred to a new centrifuge tube, isopropanol was added, and the cells were incubated at room temperature for 10 min before centrifugation. The supernatant was discarded. The cells were washed with 75% ethanol and centrifuged at 7500g for 5 min. The supernatant was discarded, and the cells were inverted on paper towels to air dry until the white precipitate became transparent. DEPC water was added, and the RNA was dissolved by heating in a metal bath. The extracted mRNA was placed on ice, and the RNA concentration was measured using Nanodrop.

[0157] Reverse transcription: cDNA was synthesized using a reverse transcription kit. After thawing all components of the kit at room temperature, the kit was quickly placed on ice. Before use, all components were mixed and briefly centrifuged. The gDNA removal reaction system was prepared and incubated at 42°C for 3 min. The reverse transcription reaction system (primer sequences are shown in Table 2) was prepared and added to the reaction solution of the gDNA removal step. The mixture was thoroughly mixed. The PCR instrument was programmed (42°C, 15 min; 95°C, 3 min). The resulting cDNA was placed on ice for subsequent experiments.

[0158] qPCR: The following operations require protection from light. Thaw 2×SuperReal PreMix Plus, primers, and cDNA at room temperature, mix thoroughly, and place on ice. Prepare the reaction system according to the instructions. Set the reaction program of the real-time PCR instrument as follows: 95℃, 15min; 95℃, 3s; 60℃, 20s, 40 cycles, and collect fluorescence signals. Obtain the Ct values ​​of the target gene and internal control gene for each PCR reaction. Analyze the quantitative results using Bio-Rad CFX Manager software, using GAPDH as the internal control, according to 2... -△△CtThe relative expression ratio of the target gene was calculated, and the results are shown in [the table below]. Figure 7 .

[0159] (3) Synthesis of BG-SS-siRNA

[0160] Weigh out 6-aminomethylbenzylguanine and dissolve it in 200 μL of anhydrous dimethylformamide. Take 0.05 mol / L MOPS buffer (pH=7) and add it to a 10 mL round-bottom flask. Add a certain amount of succinimide 3-(2-pyridyldithio)-propionate (SPDP). Stir the reaction mixture at room temperature (25±5℃) for 1 h. Remove excess raw material by silica gel column and freeze dry to obtain BG-SH.

[0161] siRNA-SH (obtained by direct solid-phase synthesis of LILRB4-1 to LILRB4-5 modified with Thiol-modifier and attached with cysteine ​​groups by Suzhou Beixin Biotechnology Co., Ltd.) was mixed with BG-SH at a molar ratio of 1:100 in PBS buffer and reacted at room temperature (25±5℃) for 12 h. Excess BG-SH was removed by dialyzing and the mixture was lyophilized to obtain BG-SS-siRNA.

[0162] Test Example 2

[0163] 2.1 Characterization of BG-SS-siRNA

[0164] Clean the gel casting plate thoroughly, install it on the plate holder, and flatten and press it firmly. Prepare the 20% PAGE gel according to the formula, gently mix it, and add it to the casting plate. Insert the gel comb and let it solidify for about 20 minutes. After the PAGE gel has solidified, install the casting plate in the electrophoresis tank, add 2×TBE and soak for about 10 minutes. Gently pull out the gel comb vertically, pipette the sample, maintain a constant voltage of 120V for 1 hour, and then stop electrophoresis. Remove the gel plate, put the gel into the gel box, add dye for staining, and observe and photograph it using a gel imaging system.

[0165] The synthesis of BG-SS-siRNA was characterized using a 20% PAGE gel, with siRNA-SH, siRNA-SH+BG, and BG-SS-siRNA+siRNA-SH serving as control groups. The PAGE gel separated samples according to molecular size; larger molecular weights migrated more slowly. Figure 8 As shown in Figure A, the band of BG-SS-siRNA was significantly higher than that of SH-siRNA, indicating that BG-SS-siRNA was successfully synthesized; the mass spectrometry results are as follows. Figure 8 The result in Figure B shows that the molecular weight of BG-SS-siRNA is 14081.475, which is consistent with the actual molecular weight, indicating that BG-SS-siRNA was successfully synthesized.

[0166] Example 3

[0167] The fusion protein H22(scFv)-Fruin-HA2-SNAP prepared in Example 1 and the BG-SS-siRNA prepared based on LILRB4-3 in Example 2 were reacted at a molar ratio of 2:1 at room temperature in the dark for 2 hours. Excess BG-SS-siRNA was removed by ultrafiltration to obtain the siRNA drug delivery system (APSBS system).

[0168] Test Example 3

[0169] 3.1 Construction and Performance Characterization of the APSBS System

[0170] Wash the gel plates, wash the combs of the appropriate size according to the sample loading volume, and prepare 0.5×TBE solution; weigh agarose, add 0.5×TBE solution, gently stir and mix, microwave to dissolve the agarose gel, and add nucleic acid dye when the temperature drops to about 60℃, stirring and mixing; pour the gel solution into the mold, insert the comb, and after it is completely solidified, gently pull the comb vertically; add 6×loading buffer to the APSBS system prepared in Example 3 and mix well, using the BG-SS-siRNA group as the control group, and gently add the sample wells using a micropipette, being careful not to damage the gel surface around the sample wells; place the gel tank into the electrophoresis tank, set the voltage to 80V to start the gel run, and after the sample is loaded into the gel, change the voltage to 120V and continue electrophoresis for 30 minutes. After electrophoresis is completed, use a gel imaging system to observe and photograph the results. Figure 9 The 2% agarose gel electrophoresis image shows that the APSBS system band is higher than the BG-SS-siRNA band. This is because agarose gel has a network structure, and substances with larger molecular weights experience greater resistance during electrophoresis. Therefore, larger fragments migrate slower, while smaller fragments migrate faster, which is consistent with the theory and the actual situation.

[0171] The constructed APSBS system was concentrated to a concentration range of 10-100 μmol / L, and the molecular weight of the APSBS system was determined using a MALDI-TOF mass spectrometer. The results are shown in [Figure number missing]. Figure 9 The molecular weight of the APSBS system was 68006.459, which is basically consistent with the theoretical molecular weight. All the above results indicate that the APSBS system was successfully constructed.

[0172] Glutathione (GSH) was added sequentially to centrifuge tubes at 120, 30, and 0 min before electrophoresis in the APSBS system, and the tubes were incubated on a shaker until the final GSH concentration was 10 mM. A 2% agarose gel was prepared for electrophoresis. After electrophoresis, the gel was observed and photographed using a gel imaging system. The results are shown below. Figure 9 In the middle C; as the incubation time with GSH increased, the bands in the APSBS system almost completely disappeared, indicating that the siRNA was successfully released.

[0173] 3.2 Nuclease Stability of the APSBS System

[0174] The APSBS system prepared in Example 3 was co-incubated with ribonuclease A (RNase A), and the stability of siRNA was evaluated using an agarose gel retardation assay. RNase A solution was added to the APSBS system sequentially at 120, 90, 60, 30, and 0 min before electrophoresis, with a final RNase A concentration of 100 μg / mL. Unmodified free siRNA, modified free siRNA, and BG-SS-siRNA were used as controls. After incubation for different times, the sample was mixed with 6× loading buffer and carefully added to the sample wells. The gel running results were observed and photographed using a gel imaging system. The results are shown in [Figure number missing]. Figure 10 A.

[0175] After incubating unmodified free siRNA with RNase A for 30 min, the siRNA band completely disappeared, indicating that the unmodified free siRNA had poor stability. However, after incubating modified free siRNA, BG-SS-siRNA, and APSBS with RNase A, the siRNA bands remained clearly visible, indicating that the previous modification of siRNA significantly improved its stability. The APSBS system has good nuclease stability.

[0176] 3.3 Serum stability of the APSBS system

[0177] The APSBS system prepared in Example 3 was placed in a shaker at 37°C. Before electrophoresis, 10% fetal bovine serum (FBS) was added to the tube at 120, 90, 60, 30, and 0 min. After incubation for different times, 10 μL of sample was mixed with 6× loading buffer and loaded onto the tube. The results were then analyzed using agarose gel electrophoresis as described above. The results are shown in the figure. Figure 10 In the B-mode, unmodified free siRNA showed a degradation trend after 1 hour, and the siRNA band almost completely disappeared after 2 hours, indicating that the serum stability of unmodified free siRNA was poor. However, when the incubation time of modified siRNA, BG-SS-siRNA and APSBS system was extended to 2 hours, the siRNA band was still clearly visible, indicating that APSBS had good serum stability.

[0178] Test Example 4

[0179] 4.1 The specific binding ability of the APSBS system to leukemia cells

[0180] THP-1 cells were seeded into 12-well plates at 5 × 10⁶ cells per well. 5Cells were divided into the following experimental groups: blank, CD64 antibody, CD64 antibody + APSBS system, CD14 antibody, and CD14 antibody + APSBS system. Cells were collected by centrifugation. Human mononuclear AML cells (THP-1) were pre-incubated with the APSBS system on ice for 20 min, then incubated with either FITC-labeled CD64 antibody or APC-labeled CD14 antibody on ice for 30 min. Intracellular fluorescence intensity was detected by flow cytometry to verify the specific binding ability of the H22(scFv) single-chain antibody to leukemia cells. Results are shown below. Figure 11 .

[0181] The APSBS system utilizes H22 (scFv) to specifically bind to the CD64 antigen on the surface of AML cells, thereby achieving targeted therapy for specific subtypes of AML cells. Figure 13 The results showed that the positive rate of the CD64 antibody alone was over 99%, while the positive rate of the APSBS system + CD64 antibody group was only 9.84%, indicating that the APSBS system pre-binded to the CD64 antigen, preventing the CD64 antibody from binding to the CD64 antigen. The positive rate of the CD14 antibody alone was over 99%, and the positive rate of the APSBS system + CD64 antibody group was also over 99%, indicating that the APSBS system does not bind to the CD14 antigen and does not prevent the CD14 antibody from further binding to the CD14 antigen on the surface of THP-1 cells. These results indicate that the APSBS system can specifically bind to the CD64 antigen on the surface of THP-1 cells.

[0182] 4.2 Cellular uptake in the APSBS system

[0183] The uptake of THP-1 cells by the APSBS system prepared in Example 3 was observed using laser confocal microscopy. The specific procedures were as follows: THP-1 cells were seeded into 12-well plates. An APSBS system was prepared using Cy5-labeled siRNA as a model drug, with free Cy5-siRNA as a control. After adding the drug to the wells and mixing well, the cells were cultured for 2 hours. Cells were collected by centrifugation, washed with PBS, and smeared using a cell slide machine. Cells were fixed with 4% paraformaldehyde, and the nuclei were stained with DAPI. The slides were then mounted with an anti-fluorescence quenching mounting medium. Cell uptake was observed and photographed using a laser confocal microscope. The results are shown below. Figure 12 .

[0184] siRNA drugs have problems such as being unable to accumulate in target tissues and being difficult to transport across the membrane to the cytoplasm. They need to be delivered into the cell efficiently by means of a carrier. Therefore, the uptake of the APSBS system in THP-1 cells was investigated. Figure 12The results showed that no red fluorescence was detected in the free siRNA group, indicating that the free siRNA hardly entered the cells; obvious red fluorescence signals were observed in the APSBS system group, and the siRNA was mainly distributed in the cytoplasm, indicating that the APSBS system can carry siRNA into the cells, thereby exerting anti-tumor effects.

[0185] 4.3 Investigation into the uptake mechanism of fused cells

[0186] THP-1 cells were seeded in 12-well plates. The endocytosis inhibitors Amiloride, M-β-CD (purchased from Beijing Bailingwei Technology Co., Ltd.), Chlorpromazine, and Dynasore (purchased from Beijing Bailingwei Technology Co., Ltd.) were added to each well to achieve final concentrations of 50 μM, 5 mM, 10 μg / ml, and 80 μM, respectively, for 1 h. Then, a SNAP-labeled fusion protein was added, and the cells were cultured for another 2 h. To investigate the effect of energy on cell uptake, one group was cultured at 4°C. After uptake, cells were collected by centrifugation, resuspended in PBS buffer, and vertically added to the cell tray. Cells were centrifuged at 400 rpm for 5 min, transferred to a glass slide, fixed with tissue fixative, and the nuclei were stained with DAPI for 30 min. A drop of anti-fluorescence quenching mounting medium was added to the slide, and the cells were covered with a coverslip. The differences in protein uptake among the different groups were observed. The results are shown in [Figure number missing]. Figure 13 .

[0187] The H22 single-chain antibody triggers endocytosis after specifically recognizing the CD64 antigen on the surface of AML cells. The entry of extracellular macromolecules into cells mainly depends on macropinocytosis, caverin-mediated endocytosis, and clathrin-mediated endocytosis. Therefore, the cellular uptake mechanism of the fusion protein was investigated. Figure 13 The results showed that at 4°C, THP-1 cells took up less than 20% of the fusion protein, indicating that protein entry into cells is an energy-dependent pathway. Chlopromazine, a clathrin inhibitor, reduced protein uptake by 89.61%; Dynasore, a GTPase inhibitor, inhibited dynein-mediated endocytosis, reducing fusion protein uptake by 92.86%. The caveolin inhibitor M-β-CD reduced protein uptake by 62.48%. Na... + / H + The inhibitors of exchange and macropinocytosis, Amiloride, did not cause changes in protein uptake, indicating that the fusion protein enters the cell via endocytosis mediated by dynein, clathrin, and caveolin.

[0188] 4.4 siRNA colocalization analysis with lysosomes

[0189] Cy5-labeled siRNA was used in the APBSB system prepared in Example 3 to investigate the intracellular localization of siRNA. THP-1 cells were seeded in confocal microplates containing poly-L-lysine-containing spreaders and cultured for 24 h. After cell adhesion to the spreaders, the cells were incubated in the APBSB system for 2 h. The cells were washed three times with PBS and cultured for 2 h, 4 h, and 8 h. Lysosomes were labeled with Lysotracker at a final concentration of 75 nM for 2 h, followed by Hoechst staining of the cell nuclei for 30 min. After washing with PBS, fresh culture medium was slowly added to the confocal microplates, and the microplates were then observed and photographed under a confocal microscope. The results are shown in the figure below. Figure 14 .

[0190] In the APSBS system, H22(scFv) can target the CD64 antigen on the surface of THP-1 cells to induce endocytosis. Biological reagents entering via endocytosis are easily trapped in endosomes and degraded by specific enzymes in lysosomes, thus failing to exert their therapeutic effect. siRNA drugs must escape from lysosomes to exert their gene silencing function in the cytoplasm; therefore, the distribution and co-localization of siRNA and lysosomes within cells in the APSBS system were investigated. Figure 14 As shown, in the APSBS system, the red fluorescence of siRNA after entering the cell overlaps significantly with the green fluorescence of lysosomes, indicating that most of the siRNA is trapped in the endosomes after entering the cell. As time goes on, the overlapping part of fluorescence gradually decreases, indicating that most of the siRNA escapes from the lysosomes as the cell entry time increases.

[0191] 4.5 Security Assessment of the APSBS System

[0192] To investigate the safety of the drug delivery system, a delivery system conjugated with the negative control siNC, H22(scFv)-Fruin-HA2-SNAP / BG-SS-siNC (APSB@siNC) and the fusion protein H22(scFv)-Fruin-HA2-SNAP (APS) were prepared. The safety of the system for NHDF and THP-1 cells was detected using the CCK-8 assay. THP-1 cells and NHDF cells were cultured at 2×10⁻⁶ cells / cells. 4 Cells were seeded at a density of [number] cells / well in 96-well plates and cultured overnight. Different concentrations of the drug containing different proteins were added to each well: 10 μg / mL, 20 μg / mL, 50 μg / mL, 100 μg / mL, and 150 μg / mL. Cells were incubated for 48 h. Then, 10 μL of CCK-8 reagent was added to each well of the 96-well plate. After 1 h of incubation, the absorbance at 450 nm was measured in each well. Wells without cells but containing only culture medium and CCK-8 reagent served as the blank group, while the untreated cell group served as the control group. The cell viability formula is as follows:

[0193] Cell viability (%) = (OD) 给药组 -OD 空白组 ) / (OD 对照组 -OD 空白组 )×100%;

[0194] The results are as follows Figure 15 As shown, in the APSBS system, the protein concentration was 100 nM, or 5.5 μg / mL, and the cell viability was not lower than 90%. As the protein concentration increased to 150 μg / mL, the viability of THP-1 cells and NHDF cells did not change significantly and remained above 90%, indicating that the APSBS system has good safety.

[0195] 4.6 Evaluation of the silencing effect of the APSBS system

[0196] 4.6.1 Real-time quantitative polymerase chain reaction (qRT-PCR) detection of mRNA expression levels

[0197] THP-1 cells were seeded into 12-well plates at a density of 5 × 10⁶ cells / well. 5 The experimental groups were set up as follows: PBS, Lipo / LILRB4 (LILRB4 was obtained by transfection with Lipofectamine 2000, siRNA concentration was 100 nM), APSB@siNC (delivery system conjugated with negative control siNC H22(scFv)-Fruin-HA2-SNAP / BG-SS-siNC), APSB@siLILRB4 (i.e., the APSBS system prepared in Example 3). Each group was set up with 3 replicates. Each group of drugs (final siRNA concentration was 100 nM) was added and incubated in an incubator for 4 h. 1 mL of 1640 complete medium was added to each well and the culture was continued for 36 h. The remaining experimental steps were the same as step (2) in Example 2. The results are shown in […]. Figure 16 . Figure 16 As shown in Figure A, after THP-1 cells were treated with 100 nM siRNA, the expression level of LILRB4 mRNA in THP-1 cells in the APSB@siLILRB4 group was downregulated by 43.47%, the LILRB4 mRNA level in the Lipo / LILRB4 group was downregulated by 43.64%, while the APSB@siNC group was only downregulated by 3.98%.

[0198] 4.6.2 Western Blot analysis of LILRB4 protein expression levels

[0199] THP-1 cells were seeded into 6-well plates at a density of 5 × 10⁶ cells / well. 5The experimental group settings were as follows: PBS, Lipo / LILRB4, APSB@siNC, APSB@siLILRB4, with siRNA concentration of 100 nM. Cells were incubated with the corresponding drug for 4 h, washed with PBS, resuspended in 1 mL of 1640 complete medium, and cultured for another 36 h. Cells were collected by centrifugation, washed three times with pre-chilled PBS, and each well was added with pre-prepared lysis buffer. Cells were lysed on ice for 30 min, centrifuged at 14000 rpm for 20 min, and the supernatant was collected. Protein concentration was measured using a BCA kit. Subsequent experimental procedures were the same as in 1.3.1. Results are shown in [Figure 1]. Figure 16 . Figure 16 The results showed that, compared with the PBS group, the expression level of LILRB4 protein in the APSB@siLILRB4 group was significantly reduced, while the expression level of LILRB4 protein in the Lipo / LILRB4 group and the APSBS@siNC group did not show a significant reduction. These results indicate that the APSBS system can better silence LILRB4 compared to Lipo transfection with siRNA, and also lay a good experimental foundation for subsequent in vivo applications.

[0200] 4.7 Evaluation of anti-tumor effects

[0201] 4.7.1 Transendothelial migration assay

[0202] HUVEC cells were used at a rate of 3 × 10 5 THP-1 cells were seeded per well onto a transwell membrane and cultured for 3 days, followed by inoculation at a rate of 1 × 10⁻⁶ cells / well. 5 Cells were seeded per well in the upper chamber. Experimental groups were set as follows: PBS, APSB@siNC, and APSB@siLILRB4, with 3 replicates per group. The siRNA concentration was 100 nM. After co-culturing for 18 h, the number of cells in the lower chamber was counted. Results are shown below. Figure 17 Compared with the control group, the APSB@siLILRB4 group had fewer cells in the lower chamber, indicating lower THP-1 cell transendothelial migration in vitro, suggesting that downregulating LILRB4 expression can inhibit leukemia infiltration to some extent.

[0203] 4.7.2 Killing effect of T cells on THP-1 cells

[0204] THP-1 cells were seeded in 12-well plates and treated with PBS, APSB@siNC, and APSB@siLILRB4 for 48 h, respectively. The treated THP-1 cells were then compared with CD8... + T cells were seeded in 96-well plates at effector-to-target ratios of 1:1, 5:1, and 10:1, with THP-1 cells at a density of 1 × 10⁶ cells / well. 5cells / mL, with 3 replicates per group, THP-1 cells and CD8+ + T cells were co-cultured for 12 hours, and 10% CCK-8 reagent was added to each well. The cells were then incubated at 37°C with 5% CO2 for another 4 hours. The absorbance of each well was measured at 450 nm using a microplate reader. The tumor killing rate was calculated using the following formula:

[0205] Tumor killing rate (%) = [(OD) T +OD E )-OD E+T OD T ×100%; results are shown below. Figure 17 B.

[0206] LILRB4, a marker of monocytic leukemia, inhibits T cell activity by involving downstream LILRB signaling pathways such as SHP-2, NFκB, uPAR, and ARG1 in AML cells. Silencing LILRB4 expression on the surface of AML cells activates T cells, thereby exerting an anti-tumor effect. Figure 17 The results showed that after treatment of THP-1 cells with APSB@siLILRB4, CD8 + The proportion of T cells killing THP-1 cells was significantly higher than that in the control group, and at the same time, CD8 + Increased T cell ratio, CD8 + T cells significantly increased the killing rate of THP-1 cells. This indicates that APSB@siLILRB4 silences LILRB4 expression on THP-1 cells, which activates CD8. + T cells, thus producing a significant killing effect on THP-1 cells.

[0207] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.

Claims

1. An siRNA drug delivery system, characterized in that, The siRNA drug delivery system contains a linker formed by co-assembling a fusion protein and an siRNA drug. The fusion protein contains a substrate peptide, an endosomal fusion peptide, an antibody targeting a cell surface antigen, and a tag protein linked to the siRNA drug. The siRNA drug is an siRNA that can specifically inhibit and silence the expression of leukocyte immunoglobulin receptor B4; the siRNA drug contains a completely inversely complementary sense strand and an antisense strand, the nucleotide sequences of which are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively; The substrate peptide is a fruitin substrate peptide, and the amino acid sequence of the fruitin substrate peptide is shown in SEQ ID NO.11; The endosome fusion peptide is an HA2 peptide, and the amino acid sequence of the HA2 peptide is shown in SEQ ID NO.

12. The antibody targeting cell surface antigen is a single-chain antibody H22 targeting CD64, and the amino acid sequence of the single-chain antibody H22 is shown in SEQ ID NO.13; The siRNA drug has a benzylguanine group attached to it, and the tag protein is covalently linked to the benzylguanine group; the tag protein is a SNAP-tag, and the amino acid sequence of the SNAP-tag is shown in SEQ ID NO.14; The benzylguanine group is linked to the siRNA drug via a disulfide bond in the form of a benzylguanine derivative.

2. An siRNA drug delivery system, characterized in that, The siRNA drug delivery system contains a linker formed by co-assembling a fusion protein and an siRNA drug. The fusion protein contains a substrate peptide, an endosomal fusion peptide, an antibody targeting a cell surface antigen, and a tag protein linked to the siRNA drug. The siRNA drug is an siRNA capable of specifically inhibiting and silencing the expression of leukocyte immunoglobulin receptor B4; the siRNA drug contains a completely inversely complementary sense strand and an antisense strand, the sense strand and the antisense strand being stabilized and modified on the nucleotide sequences shown in SEQ ID NO. 5 and SEQ ID NO. 6, respectively; the 5th, 7th, 8th, and 9th nucleotides of the sense strand are fluorinated, and the remaining positions are methoxylated; the 2nd, 6th, 8th, 9th, 14th, and 16th nucleotides of the antisense strand are fluorinated, and the remaining positions are methoxylated; phosphate ester groups, representing the modifying groups, are present between the 1st-2nd and 2nd-3rd nucleotides at the 5' end of the sense strand, between the 1st-2nd and 2nd-3rd nucleotides at the 5' end of the antisense strand, and between the 1st-2nd and 2nd-3rd nucleotides at the 3' end of the antisense strand; The substrate peptide is a fruitin substrate peptide, and the amino acid sequence of the fruitin substrate peptide is shown in SEQ ID NO.11; The endosome fusion peptide is an HA2 peptide, and the amino acid sequence of the HA2 peptide is shown in SEQ ID NO.

12. The antibody targeting cell surface antigen is a single-chain antibody H22 targeting CD64, and the amino acid sequence of the single-chain antibody H22 is shown in SEQ ID NO.13; The siRNA drug has a benzylguanine group attached to it, and the tag protein is covalently linked to the benzylguanine group; the tag protein is a SNAP-tag, and the amino acid sequence of the SNAP-tag is shown in SEQ ID NO.14; The benzylguanine group is linked to the siRNA drug via a disulfide bond in the form of a benzylguanine derivative.

3. The siRNA drug delivery system according to claim 1 or 2, characterized in that, The process of linking the benzylguanine group to the siRNA drug includes: reacting the benzylguanine derivative with succinimide 3-(2-pyridyldithio)-propionate in reaction II, purifying and drying to obtain product I, and then reacting the siRNA drug with product I after cysteine ​​modification in reaction III. And / or, the benzylguanine derivative is 6-aminomethylbenzylguanine, the molar ratio of the benzylguanine derivative to succinimide 3-(2-pyridyldithio)-propionate is 0.8-1:1, and the molar ratio of the siRNA drug to product I is 1:80-120.

4. A method for preparing the siRNA drug delivery system according to any one of claims 1-3, characterized in that, Includes the following steps: The fusion protein is mixed with the siRNA drug and reaction I is carried out.

5. The method according to claim 4, characterized in that, The molar ratio of the fusion protein to the siRNA drug is 1.5-2.5:

1.

6. The method according to claim 5, characterized in that, The conditions for reaction I include at least the following: protection from light, temperature of 5-40°C, and time of 1-3 hours.

7. The use of the siRNA drug delivery system according to any one of claims 1-3 and / or the siRNA drug delivery system prepared by the method according to any one of claims 4-6 in the preparation of antitumor drugs; wherein the antitumor drug is a drug for treating acute myeloid leukemia.

Citation Information

Patent Citations

  • Self coupling recombinant antibody fusion proteins

    CN101828113A

  • Peptide sequence design and use thereof for peptide-mediated siRNA delivery

    CN104487450A