A molecular marker related to calf growth and development and its application

Abstract

The invention discloses a molecular marker bta-miR-655 related to calf growth and development and its application, belonging to the technical field of molecular marker preparation. The molecular marker bta-miR-655 is a miRNA, and its nucleotide sequence is shown in SEQ ID NO.1. The expression level of the bta-miR-655 is highly correlated with the weight and growth and development of the calf. The higher the weight, the lower the expression level of bta-miR-655, and the lower the weight, the higher the expression level of bta-miR-655. The bta-miR-655 can be used as a molecular marker related to the growth and development of the calf, used for the superior breeding of the calf, and has important practical application value in the genetic assisted breeding of the calf.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker preparation, and in particular relates to a molecular marker related to calf growth and development and application thereof. Background Art

[0002] The development of the rumen in newborn calves directly affects feed intake, nutrient digestibility and overall growth. Even small changes in early feeding regimes and nutrition can greatly affect rumen development, which can have long-term effects on growth, health, weight and milk production. The development of the rumen in newborn calves is one of the most important and interesting areas in calf rearing.

[0003] Analyzing the overall characteristics of trait-related gene expression patterns at the whole genome level to reveal the molecular basis of early calf development is one of the important research directions for calf breeding in the future. miRNAs are single-stranded RNA molecules with a length of 21-23 nt, which play a key role in mammalian growth and development, cell proliferation and differentiation by regulating the expression of target genes. So far, it has been determined that miRNAs play a key role in muscle and fat development, and only limited miRNAs have been reported between fat and muscle tissues of beef cattle. However, the underlying mechanisms of the changes observed in other tissues remain largely unknown and require further study. So far, no research reports on miRNAs related to cattle growth and development have been developed. Therefore, it is possible to develop a miRNA related to calf growth and development, and to predict the growth and development of the calf by detecting the expression of a certain indicator. This has significant application potential in genetically assisted breeding of calves, and may also help design new selection strategies to improve Chinese Holstein calf breeding. Summary of the invention

[0004] The purpose of the present invention is to provide a molecular marker related to calf growth and development and its application. The molecular marker is a miRNA, which can be used as a molecular marker related to calf growth and development and used for calf superior breeding. It has important practical application value in genetic assisted breeding of calves.

[0005] In order to achieve the above-mentioned object, the present invention provides a molecular marker related to the growth and development of calves, the molecular marker is bta-miR-655, and its nucleotide sequence is shown in SEQ ID NO.1. The expression level of bta-miR-655 is negatively correlated with the growth and development of calves, that is, when the expression level of bta-miR-655 is high, it indicates that the growth and development of the calf is poor, and when the expression level of bta-miR-655 is low, it indicates that the growth and development of the calf is good.

[0006] The molecular marker bta-miR-655 provided by the present invention can be applied to cattle breeding, including growth and development screening of calves and / or assisted breeding of cattle.

[0007] The present invention also provides a set of primers for identifying the above molecular marker bta-miR-655, and the nucleotide sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.3 respectively.

[0008] The primers provided by the present invention can be used for calf growth and development screening or / and assisted breeding of cattle.

[0009] The present invention also provides a monitoring and screening kit for calf growth and development, the kit comprises the above primers, and the kit can be used for calf growth and development screening and / or cattle assisted breeding.

[0010] The molecular marker bta-miR-655 of the present invention provides a molecular marker related to calf growth and development, and has the following advantages:

[0011] (1) The present invention provides a molecular marker bta-miR-655, the expression level of which can reflect the weight or growth and development of calves. By detecting this molecule, the growth and development of calves can be monitored, and it can be used for auxiliary genetic breeding related to calf growth and development to improve breeding efficiency.

[0012] (2) The present invention also provides a set of primers for identifying the molecular marker bta-miR-655, which can be used to monitor the weight or growth and development of calves through PCR, and has broad application prospects in the cattle breeding industry, such as in assisted breeding of cattle.

[0013] (3) The molecular markers and the method for developing the molecular markers in the present invention are helpful for designing new selection strategies to improve the breeding of Chinese Holstein calves. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 The results are the comparison of the expression levels of bta-miR-655 in individuals with different body weights in the present invention. DETAILED DESCRIPTION

[0015] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0016] Note: All methods not specifically described in the present invention are conventional methods in the art, and all reagents not specifically described are conventional reagents in the art.

[0017] The growth and development of the rumen will directly affect the animal's feed intake, nutrient digestibility and overall growth. It can also be said that the growth and development of the rumen directly affects the body weight. The better the rumen growth and development, the higher the body weight, and the worse the growth and development, the lower the body weight. Therefore, the present invention chooses to explore the calf rumen that is most directly related to the growth and development of the calf as the target, and intends to develop molecular markers related to growth and development.

[0018] The present invention obtains rumen tissue samples of 80-day-old Chinese Holstein calves with different weights under the same feeding conditions, performs whole transcriptomic analysis on the samples, and obtains a bta-miR-655 with significant expression differences. It is found that the expression level of bta-miR-655 is highly correlated with the weight difference of calves. The expression level of this miRNA in the rumen of high-weight individuals is significantly lower than that in the rumen of low-weight individuals. Combined with sequencing technology and conventional analysis methods, the accuracy of the result is verified by RT-qPCR. The weight of cattle is also one of the main characteristics of growth and development. The higher the weight, the better the growth and development, and the lower the weight, the poorer the growth and development. After investigation, it was found that the expression level of bta-miR-655 was negatively correlated with the growth and development of calves, that is, when the expression level of bta-miR-655 was high, it indicated that the calf's growth and development was poor, and when the expression level of bta-miR-655 was low, it indicated that the calf's growth and development was good. Therefore, this miRNA can be used as a molecular marker to monitor the growth and development of calves, including auxiliary breeding and superior breeding of calves, and has great application prospects.

[0019] Example 1 Development of molecular markers related to calf growth and development

[0020] 1) Rumen tissue samples were collected from 80-day-old Chinese Holstein calves with different body weights under the same feeding conditions (a total of 6 cases, 3 samples from the high body weight group and 3 samples from the low body weight group) and stored in a -80℃ refrigerator. Total RNA was extracted from each sample for whole-genome transcriptomics sequencing.

[0021] 2) RNA qualitative and quantitative analysis:

[0022] The degradation and contamination of the extracted total RNA were monitored using 1% agarose gel, and the integrity of the RNA was assessed using the Agilent RNANano6000 detection kit before library construction.

[0023] 3) Library preparation for small RNA sequencing:

[0024] Small RNA libraries were prepared from a total of 2 μg of total RNA isolated from each sample using the NEBNext “Multiplex Small RNA Library Prep Kit for Illumina” according to the manufacturer’s instructions. Briefly, the purified RNA was mixed with the NEB 3’SR adapter, and then the SRRT primer was hybridized to the excess 3’SR adapter (which remained free after the 3’ ligation reaction) and the single-stranded DNA adapter was converted to a double-stranded DNA molecule. This step is important to prevent adapter dimer formation. 5’-terminal adapters were ligated to the 5’ ends of miRNAs, siRNAs, and piRNAs, and then the first-strand cDNA was synthesized using M-MuLV reverse transcriptase (RNaseH). PCR amplification was performed using LongAmpTaq2X Master Mix, SR primers for Illumina, and index (X) primers. PCR products were purified on an 8% polyacrylamide gel (100 V, 80 min). DNA fragments corresponding to 140–160 bp (small RNA length plus 3’ and 5’ adapters) were recovered and dissolved in 8 μL elution buffer. Finally, library quality was assessed on an Agilent Bioanalyzer 2100 system using a DNA High Sensitivity Array.

[0025] 4) Clustering and sequencing:

[0026] Cluster analysis of index-encoded samples was performed on the cBot Cluster Generation System using the TruSeq PE Cluster Analysis Kit v4-cBot-HS (Illumia) following the manufacturer’s instructions. After cluster generation, library preparation was sequenced on the Illumina HiSeq 2500 platform and paired-end reads were generated.

[0027] 5) Data processing

[0028] The raw data obtained by sequencing contains a small number of reads with sequencing adapters or low sequencing quality. Reads with adapters are removed; reads with N ratio (N means that the base information cannot be determined) greater than 0.002 are removed; when the number of low-quality bases contained in a single-end read exceeds 50% of the length ratio of the read, this pair of paired reads needs to be removed.

[0029] 6) Comparative analysis

[0030] Bowtie software was used to draw clean reads with Silvadatabase, GtRNAdb database, Rfam database and Repbase database sequences, respectively, and then ribosomal RNA (rRNA), transfer RNA (tRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA) and other ncRNA and repeat sequences were filtered. The remaining reads were used to detect known miRNAs and new miRNAs, which were predicted by comparing the data with known miRNAs from miRBase. Randfold tool software was used for new miRNA secondary structure prediction.

[0031] 7) Differential expression analysis

[0032] To compare the miRNA expression levels in each sample to determine DEmiRNAs (differentially expressed miRNAs), the expression levels of miRNAs obtained from each sample were analyzed using edgeR software and DE miRNAs were screened after normalizing the number of reads using the transcripts per million (TPM) algorithm. Differential expression analysis of the two conditions / groups was performed using the DE-SeqR package. DE-Seq provides statistical routines for determining differential expression in digital miRNA expression using a model based on the negative binomial distribution. The p-values ​​obtained were adjusted using the Benjamini and Hochberg method to control the false discovery rate, i.e., miRNAs with adjusted p-values ​​were used. If DESeq found an adjusted p-value of <0.05, the miRNAs were considered to be differentially expressed.

[0033] 8) GO and KEGG enrichment analysis

[0034] Gene Ontology (GO) enrichment analysis was performed on candidate target genes of differentially expressed miRNAs. Based on the Wallenius noncentral hypergeometric distribution of GOseq, gene length bias can be adjusted and GO enrichment analysis can be performed. KEGG is a database resource used to understand the high-level functions and utilities of biological systems, such as cells, organisms, and ecosystems, from molecular-level information, especially large-scale molecular data sets generated by genome sequencing and other high-throughput experimental systems. KOBAS software is used to detect the statistical enrichment of candidate target genes in KEGG pathways.

[0035] 9) Screening of miRNAs

[0036] To verify the repeatability and accuracy of miRNA expression data from RNA sequencing, quantitative reverse transcriptase PCR (RT-qPCR) analysis of DEmiRNAs was performed on the same samples. Based on its potential functional importance, bta-miR-655 was selected as the target through relevant literature search and preliminary experimental results. Quantitative reverse transcriptase PCR (qRT-PCR) analysis and verification were performed on the RNA extracted from the rumen tissues of the two groups with body weight differences. cDNA was prepared from the total RNA remaining after transcriptome sequencing according to the instructions of Superscript III Reverse Transcription (Invitrogen, Carlsbad, CA, USA). SYBRGreen analysis was performed using SYBRPremix ExTaq (TaKaRa, Dalian, China) in a CFXConnect real-time PCR detection system (Bio-Rad, Munich, Germany). β-actin was used as an internal control. The qPCR amplification system was 10 μL, including 3 μL of water, 0.5 μL of forward and reverse primers, 5 μL of mix (SYBRGreen), and 1 μL of cDNA. The following cycle conditions were used: 95°C for 1 min and 20 s; 49°C for 20 s; 95°C for 5 s, 60°C for 5 s, and 95°C for 5 s, for a total of 45 cycles. Data were obtained using 2 -ΔΔCt Methods Statistics were performed, and the Studentt test in Simplot11.2 software was used for statistical analysis to compare the differences in samples when p<0.05. It was found that miRNA (bta-miR-655) was differentially expressed in the rumen tissue of calves with different body weights. The nucleotide sequence of bta-miR-655 is shown in SEQ ID NO.1, and the specific sequence is as follows. Its expression level is significantly correlated with the weight of the calves. The higher the weight, the lower the expression level of bta-miR-655, and the lower the weight, the higher the expression level of bta-miR-655. The weight of cattle is also one of the main manifestations of growth and development. The higher the weight, the better the growth and development, and the lower the weight, the poorer the growth and development. Therefore, bta-miR-655 can be used as a molecular marker to monitor the growth and development of calves.

[0037] bta-miR-655 (SEQ ID NO.1):

[0038] AUAAUACAUGGUUAACCUCUCU.

[0039] Experimental Example 1: Verification of bta-miR-655

[0040] A set of RT-qPCR primers (RT-qPCR-F, RT-qPCR-R) was developed for bta-miR-655 in the transcriptome, and the specific sequences are shown below (5'→3').

[0041] RT-qPCR-F (SEQ ID NO.2):

[0042] CCATAATACATGGTTAACCTCTCTG;

[0043] RT-qPCR-R (SEQ ID NO.3):

[0044] CCAGTGCAGGGTCCGAG.

[0045] Peripheral blood samples were collected from 80-day-old Chinese Holstein calves with different body weights under the same feeding conditions (divided into 30 calves in the high-weight group and 30 calves in the low-weight group, for a total of 60 calves). The genomic RNA of each sample was extracted and converted into cDNA as a template. qPCR verification was performed using the RT-qPCR primers designed above, and the expression level comparison results of bta-miR-655 in calves with different body weights were obtained as shown in the figure. Figure 1 As shown, where '*' represents significant difference; it can be seen that the expression of bta-miR-655 in low-weight group calves is significantly higher than that in high-weight group calves, which is consistent with the conclusion obtained in Example 1, indicating that bta-miR-655 can be used as a molecular marker related to calf growth and development, used for calf growth monitoring and auxiliary breeding, and used for calf auxiliary breeding in cattle breeding. By screening and identifying early calves, including the prediction of calf growth and development and weight screening, it has important practical application value in genetic assisted breeding of calves. This pair of primers (RT-qPCR-F, RT-qPCR-R) can also be used to develop a conventional detection kit for monitoring and screening of calf growth and development, which has significant application value and economic benefits in the field of calf breeding, especially in superior breeding.

[0046] In summary, the bta-miR-655 developed by the present invention is differentially expressed in calves with different weights, and its expression level is highly correlated with the weight of the calves. The expression level in low-weight calves is significantly higher than that in high-weight calves. The miRNA can be used as a molecular marker for monitoring the growth and development of calves and assisting breeding. The primers for identifying the bta-miR-655 can also be used in the dominant breeding of calves, and have significant application value in the selection and growth monitoring of calves. The design ideas and results provided by the present invention may also help design new selection strategies to improve the breeding of Chinese Holstein calves, promote the better development of the cattle breeding industry, and have great application potential.

[0047] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be appreciated that the above description should not be considered as a limitation of the present invention. After reading the above content, it will be apparent to those skilled in the art that various modifications and substitutions of the present invention will occur. Therefore, the protection scope of the present invention should be limited by the appended claims.

Claims

1. An application of a molecular marker related to calf growth and development in calf growth and development screening or / and cattle assisted breeding, characterized in that: The molecular marker is bta-miR-655, and its nucleotide sequence is shown in SEQ ID NO.

1. The expression level of bta-miR-655 is negatively correlated with the growth and development of calves; wherein the cattle are Chinese Holstein cattle breed, and the growth and development screening and / or cattle assisted breeding is to screen 80-day-old high-weight calves.

2. An application of a primer for identifying the molecular marker of claim 1 in growth and development screening of calves and / or assisted breeding of cattle, characterized in that: The nucleotide sequences of the primers are shown as SEQ ID NO.2 and SEQ ID NO.3, respectively, wherein the cattle are Chinese Holstein cattle breed, and the growth and development screening and / or cattle assisted breeding is to screen 80-day-old high-weight calves.

3. Use of a kit for identifying the molecular markers of claim 1 in growth and development screening of calves and / or assisted breeding of cattle, characterized in that: The kit comprises primers whose nucleotide sequences are shown as SEQ ID NO.2 and SEQ ID NO.3 respectively, wherein the cattle are Chinese Holstein cattle breed, and the growth and development screening and / or cattle assisted breeding is to screen 80-day-old high-weight calves.

Images