Composition for preventing or treating degenerative neurological diseases comprising a compound inducing expression of anti-aging gene klotho

By using a compound represented by chemical formula 1 to enhance the expression of the klotho gene, the problem of the difficulty in effectively preventing or treating degenerative neurological diseases in existing technologies has been solved, and effective prevention and improvement of these diseases have been achieved.

CN117136055BActive Publication Date: 2026-07-03KLOTHO SCI
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202280026649.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2021-09-30
Filing Date
2022-03-28
Publication Date
2026-07-03
Estimated Expiration
2042-03-28

AI Technical Summary

Technical Problem

Current technologies are unable to effectively induce the expression of the anti-aging gene klotho, resulting in an inability to effectively prevent or treat degenerative neurological diseases.

Method used

A compound, represented by chemical formula 1 or a pharmaceutically acceptable salt thereof, has been developed that can significantly increase the expression level of the klotho gene for use in the preparation of pharmaceutical or food compositions for the prevention or treatment of degenerative neurological diseases.

Benefits of technology

By increasing the expression of the klotho gene, the compound can effectively prevent or improve degenerative neurodegenerative diseases such as stroke, Alzheimer's disease, prolong life and improve cognitive function.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117136055B_ABST
    Figure CN117136055B_ABST
Patent Text Reader

Abstract

This invention relates to compositions for the prevention or treatment of degenerative neurological diseases, comprising a compound that induces the expression of the anti-aging gene klotho as an active ingredient. The compound of this invention, expressed by chemical formula 1, exhibits excellent efficacy in increasing the expression level of the Klotho gene, a gene related to aging, and can be effectively used as a pharmaceutical composition or food composition for the prevention, improvement, or treatment of degenerative neurological diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to compositions for the prevention or treatment of degenerative neurological diseases containing compounds that induce the expression of the anti-aging gene klotho. Background Technology

[0002] It is known that imbalances in the control of the neuroimmune system are the cause of many neurodegenerative diseases. Numerous studies have been reported on brain damage caused by neuroinflammatory responses in the central nervous system, such as Parkinson's disease, Alzheimer's disease, traumatic injury, stroke, and epileptic seizures.

[0003] In 1981, the existence of genes that could regulate aging in rapidly aging mice (SAM) was identified. These mice, incidentally produced during the mating of AKR / J series rats, aged more rapidly than their counterparts and were found to have multiple gene variants. Subsequently, a group of aging-related genes were reported in the 1990s. These genes belong to the RecQ family and express genes called DNA helicases. Mutations in these genes have been reported to lead to premature aging or cancer, known to affect DNA repair. A single aging-related gene was the klotho gene, reported in 1997. The klotho gene was discovered incidentally during the creation of a transgenic rat model of hypertension. Rats that could not express this gene exhibited premature aging and shortened lifespan. More interestingly, subsequent increases in gene expression in male rats resulted in a 20.0%–30.8% lifespan extension, while in females it was 18.8%–19.0%. This is the first time the world has been informed that the lifespan of rats can be extended or shortened based on the expression of a single gene. Furthermore, the base sequence of the Klotho gene is highly similar across animals; reportedly, rats and humans share 98% of it. This indicates that lifespan in humans can also be regulated based on the expression of the klotho gene.

[0004] The α-klotho gene (hereinafter referred to as klotho), a gene in the human klotho gene family known to be associated with aging, is located on chromosome 13 and produces a membrane protein with a base sequence similar to β-glucosidase. Klotho proteins have been reported to be primarily expressed in renal tubular epithelial cells and the choroid plexus of the brain, and in some parathyroid glands. The klotho gene is associated with various aging phenotypes. In rats lacking the klotho gene, syndromes similar to the aging process are observed, including shortened lifespan, reduced activity, growth retardation, atherosclerosis, arterial calcification, osteoporosis, genital immaturity, infertility, skin atrophy, and emphysema. In Klotho variant rats, arteriosclerosis similar to Monckeberg-type arteriosclerosis caused by human aging was observed in all arteries from the aorta to the arterioles, with impaired angiogenesis and vasculogenesis.

[0005] Klotho mRNA expression was significantly higher in kidney tissue than in other tissues, but decreased in the kidneys of rats with hypertension, type 2 diabetes, diabetic nephropathy, and chronic renal failure models. In rats with decreased Klotho expression, the production of nitric oxide (NO), a vascular endothelial-derived relaxant, was reduced. Injection of the klotho gene into Otsuka Long-Evans Tokushima fatty rats (OLETF) with multiple cardiovascular disease risk factors using a viral gene delivery vector improved endothelial dysfunction, increased NO production, inhibited vascular thickening and fibrosis, and thus lowered blood pressure. Furthermore, the klotho gene affects glucose and insulin metabolism in rats, and statins, representative treatments for hypercholesterolemia, increase klotho mRNA expression in proximal renal tubular cells. In rats with reduced Klotho expression, bone loss due to impaired osteoblast and osteoclast differentiation and low bone turnover is observed, similar to age-related bone loss and senile osteoporosis in humans. Furthermore, in Klotho mutant rats, abnormal elongation of trabecular bone in the epiphyseal region and abnormal trabecular bone tissue in microcomputed tomography (MCT) imaging are observed, indicating impaired bone resorption. Clinical phenotypic changes caused by Klotho gene mutations in humans are diverse. Functional variants of Klotho (KL-VS) with mutations at three sites on the Klotho gene exon2 are associated with lipid metabolism, blood pressure, lifespan, cognitive function, coronary artery disease, and cerebrovascular disease. Microsatellite polymorphisms and single nucleotide polymorphisms (SNPs) of the Klotho gene are associated with bone mineral density. In healthy adult women, single nucleotide polymorphisms of the Klotho gene have also been reported to be associated with cardiovascular disease risk factors and bone mineral density. Recently, several papers have reported the association between the Klotho gene and Alzheimer's disease. Reports indicate that in mouse models of Alzheimer's disease and dementia, overexpression of Klotho extended lifespan by 30% and inhibited cognitive decline. Simultaneously, Klotho expression reduced the production of β-amyloid protein in the brain by 50%. Furthermore, reports have been submitted showing that in humans, Klotho expression is inversely proportional to the progression of Alzheimer's disease, and that Klotho protein reduces the amount of inflammatory cytokines in the blood of Alzheimer's patients.

[0006] Efforts have been ongoing to develop substances that can induce the expression of the klotho gene, which has a significant anti-aging effect. Among known substances, those reported to induce klotho expression include rapamycin, vitamin D, and statins. In 2012, a research team at Boston University screened a library of up to 150,000 compounds for compounds that could induce klotho gene expression and reported three compounds.

[0007] Among the aforementioned compounds, the inventors selected a compound with a structure highly promising for drug development, designated compound H. Through experimental verification, they confirmed that this compound could express the klotho gene in cells, and published the results of their research on its mechanism of action. Subsequently, they conducted experiments analyzing the structure of compound H (Comparative Example 1) to determine the structural characteristics of compounds capable of inducing klotho expression, and based on this, prepared a novel compound with an activity increased more than 10-fold. Simultaneously, the inventors confirmed that the aforementioned novel compound inducing the expression of the anti-aging gene klotho has efficacy in degenerative neurological diseases, thus completing this invention. Summary of the Invention

[0008] Technical issues

[0009] The object of the present invention is to provide a pharmaceutical composition comprising a compound represented by chemical formula 1 or a pharmaceutically acceptable salt thereof for the prevention or treatment of degenerative neurological diseases.

[0010] Another object of the present invention is to provide a health food composition or food composition comprising a compound represented by chemical formula 1 or a pharmaceutically acceptable salt thereof for the prevention or improvement of degenerative neurological diseases.

[0011] Technical solution

[0012] To achieve the above objectives, the present invention provides a pharmaceutical composition for the prevention or treatment of degenerative neurological diseases comprising a compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.

[0013] Chemical Formula 1:

[0014]

[0015] (In the above chemical formula 1, L) 1 For single key or

[0016] R 1 and R 2 They are -H, -OH, and C, respectively. 1-10Straight-chain or side-chain alkyl groups, or C 6-8 Aryl amides, wherein, in the aryl group of the above aryl amide, halogen, -NO2, and C are present. 1-10 One or more of the straight-chain or side-chain haloalkanes can be substituted;

[0017] The above R 1 and R 2 They can form C together with the carbon atoms they are attached to. 6-8 aryl;

[0018] R 3 R 4 R 5 R 6 and R 7 These are -H, halogen, -NO2, or C, respectively. 1-10 (linear or side-chain alkyl groups).

[0019] Furthermore, the present invention provides a health food composition for preventing or improving degenerative neurological diseases, comprising the above-described compound represented by chemical formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.

[0020] Furthermore, the present invention provides a food composition for the prevention or improvement of degenerative neurological diseases comprising the above-described compound represented by Chemical Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.

[0021] Furthermore, the present invention provides methods for the prevention or treatment of degenerative neurological diseases, including administering or ingesting to an individual a composition comprising the compound represented by chemical formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.

[0022] Furthermore, the present invention provides for the prevention or treatment of degenerative neurological diseases, including the use of a compound represented by the above-described chemical formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.

[0023] The effects of the invention

[0024] The compound of the present invention, represented by chemical formula 1, is highly effective in increasing the expression level of the Klotho gene, which is a gene related to aging, and can be effectively used as a pharmaceutical composition or food composition for the prevention, improvement or treatment of degenerative neurological diseases. Attached Figure Description

[0025] Figure 1 Part (a) shows the results of luciferase expression experiments of the reporter gene using a promoter including the start of the human klotho gene up to 1.7 kbp in Comparative Examples 1 to 4.

[0026] Figure 1Part (b) shows the results of luciferase expression experiments of the reporter gene using the promoter of the human klotho gene from the start of the gene up to 240 bp in Comparative Examples 1 to 4.

[0027] Figure 2 The results of luciferase expression experiments using reporter genes with a promoter up to -2.1 kb upstream of the human klotho gene are shown in Examples 1 to 6.

[0028] Figure 3 The results of luciferase expression experiments using a reporter gene with a promoter up to -2.1 kb upstream of the human klotho gene are shown in Examples 1 to 3.

[0029] Figure 4 The results were obtained by RT-PCR to confirm the mRNA expression levels of the klotho (KL) gene in Examples 1 and 2.

[0030] Figure 5 To confirm the results of the expression of the klotho gene in RPTEC cells treated with the compounds of Examples 1 to 2 and Examples 7 to 10.

[0031] Figure 6 To confirm the cytotoxicity results in HK2 cells treated with the compounds of Examples 1, 9 and 10.

[0032] Figure 7 The results were used to confirm the inhibitory effect of the KS1 compound (Example 10) on neuronal aging in HT22 cells (neurons derived from mouse hippocampus).

[0033] Figure 8 The results were used to confirm the inhibitory effect of the KS1 compound (Example 10) on nerve cells in HT22 cells (nerve cells derived from mouse hippocampus).

[0034] Figure 9 The results were used to confirm the effect of the KS1 compound (Example 10) on reducing the expression of cognitive impairment proteins in a 5xFAD cognitive impairment animal model.

[0035] Figure 10 The results were used to confirm the effect of the KS1 compound (Example 10) on increasing the expression of the neuronal marker NeuN in a 5xFAD cognitive impairment animal model.

[0036] Figure 11 The results were used to confirm the effect of the KS1 compound (Example 10) on improving object recognition ability in a 5xFAD cognitive impairment animal model.

[0037] Figure 12 The results were used to confirm the spatial learning and memory improvement effects of compound KS1 (Example 10) in a 5xFAD cognitive impairment animal model through a passive avoidance experiment. Detailed Implementation

[0038] The present invention will now be described in detail.

[0039] This invention relates to compositions for the prevention, improvement or treatment of degenerative neurological diseases comprising a compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.

[0040] The compound of the present invention, represented by chemical formula 1, is highly effective in increasing the expression level of the Klotho gene, which is a gene related to aging, and can be effectively used as a pharmaceutical composition or food composition for the prevention, improvement or treatment of degenerative neurological diseases.

[0041] Pharmaceutical compositions for the prevention or treatment of degenerative neurological diseases

[0042] The present invention provides a pharmaceutical composition comprising a compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof for the prevention or treatment of degenerative neurological diseases.

[0043] Chemical Formula 1:

[0044]

[0045] In the above chemical formula 1,

[0046] L 1 For single key or

[0047] R 1 and R 2 They are -H, -OH, and C, respectively. 1-10 Straight-chain or side-chain alkyl groups, or C 6-8 Aryl amides, wherein, in the aryl group of the above aryl amide, halogen, -NO2, and C are present. 1-10 One or more of the straight-chain or side-chain haloalkanes can be substituted;

[0048] The above R 1 and R 2 They can form C together with the carbon atoms they are attached to. 6-8 aryl;

[0049] R 3 R 4 R 5 R 6 and R7 They can be -H, halogen, -NO2, or C, respectively. 1-10 Straight-chain or side-chain alkyl groups.

[0050] In one embodiment of the present invention,

[0051] The above L 1 For single key or

[0052] R 1 and R 2 They are -H, -OH, and C, respectively. 1-5 Straight-chain or side-chain alkyl groups, or C 6-7 Aryl amides, wherein, in the aryl group of the above aryl amide, halogen, -NO2, and C are present. 1-5 One or more of the straight-chain or side-chain haloalkanes can be substituted;

[0053] The above R 1 and R 2 They can form C together with the carbon atoms they are attached to. 6-7 aryl;

[0054] R 3 R 4 R 5 R 6 and R 7 They can be -H, halogen, -NO2, or C, respectively. 1-5 Straight-chain or side-chain alkyl groups.

[0055] In one embodiment of the present invention,

[0056] The above L 1 For single key or

[0057] R 1 and R 2 They are -H, -OH, -CH3 or phenylamide, wherein, in the phenyl group of the above phenylamide, one or more of -Cl, -NO2 and -CH2Cl can be substituted;

[0058] The above R 1 and R 2 They can form phenyl groups together with the carbon atoms they are attached to;

[0059] R 3 R 4 R 5 R 6 and R 7 They can be -H, -F, -Cl, -NO2, or -CH2CH3, respectively.

[0060] In one embodiment of the present invention,

[0061] The above L 1 For single key or

[0062] R 1 -H, -OH, -CH3,

[0063] R 2 -H;

[0064] The above R 1 and R 2 They can form phenyl groups together with the carbon atoms they are attached to;

[0065] R 3 It is -H or -Cl;

[0066] R 4 -H, -F, or -Cl;

[0067] R 5 It can be -F, -Cl, -NO2, or -CH2CH3;

[0068] R 6 -H;

[0069] R 7 It can be -H.

[0070] As preferred examples of compounds represented by chemical formula 1 in this invention, the following group of compounds can be cited.

[0071] 1) N-(benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide;

[0072] 2) 8-Methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole;

[0073] 3) 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol;

[0074] 4) N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide;

[0075] 5) N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-3,4-dichlorobenzamide;

[0076] 6) N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-3-(chloromethyl)benzamide;

[0077] 7) 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole;

[0078] 8) N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazol-2-amine;

[0079] 9) N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine; and

[0080] 10)N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine.

[0081] The compounds of the present invention represented by the above-described Chemical Formula 1 can be used in the form of pharmaceutically acceptable salts. As salts, acid addition salts formed by pharmaceutically acceptable free acids are useful. The expression "pharmaceutically acceptable salt" refers to any organic or inorganic addition salt of a basic compound of Chemical Formula 1 that has a relatively non-toxic and harmless effective effect on the patient, and whose side effects do not diminish the beneficial efficacy of the basic compound of Chemical Formula 1. For these salts, inorganic and organic acids can be used as free acids. Inorganic acids include hydrochloric acid, bromic acid, nitric acid, sulfuric acid, perchloric acid, phosphoric acid, etc., and organic acids include citric acid, acetic acid, lactic acid, maleic acid, fumaric acid, gluconic acid, mesylic acid, glycolic acid, succinic acid, tartaric acid, galacturonic acid, primordial acid, glutamic acid, aspartic acid, oxalic acid, (D) or (L) malic acid, maleic acid, mesylic acid, ethanesulfonic acid, 4-toluenesulfonic acid, salicylic acid, citric acid, benzoic acid, or malonic acid, etc. Furthermore, these salts include alkali metal salts (sodium salts, potassium salts, etc.) and alkaline earth metal salts (calcium salts, magnesium salts, etc.). For example, acid addition salts may include acetates, aspartates, benzoates, benzenesulfonates, bicarbonates / carbonates, bisulfates / sulfates, borates, dextrorotatory camphor sulfonic acid, citric acid, ethanedisulfonates, ethanesulfonates, formates, fumarates, glucohepanoates, gluconates, glucuronides, hexafluorophosphates, perbenzoates, hydrochlorides / chlorides, hydrobromides / bromines, hydroiodates / iodates, hydroxyethyl sulfonates, lactic acid, malates, maleates, and malonic acid. Salts, methanesulfonates, methyl sulfates, naphthalates, 2-naphthalenesulfonates, nicotinates, nitrates, orotates, oxalates, palmitates, pyrates, phosphates / hydrogen phosphates / dihydrogen phosphates, sucrose salts, stearates, succinates, tartrates, toluenesulfonates, trifluoroacetates, aluminum, arginine, benzylamine, calcium, choline, diethylamine, diolamine, glycine, lysine, magnesium, meglumine, alkanolamine, potassium, sodium, tromethamine, zinc salts, etc., preferably hydrochloride or trifluoroacetate.

[0082] Furthermore, the compounds of the present invention represented by the above-described chemical formula 1 not only contain pharmaceutically acceptable salts, but also all salts, isomers, hydrates and solvates that can be prepared by conventional methods.

[0083] The addition salts of the present invention can be prepared by conventional methods. For example, the compounds of Formula 1 can be prepared by dissolving a water-soluble organic solvent in a solution such as acetone, methanol, ethanol, or acetonitrile, adding an excess of organic acid or an aqueous solution containing an inorganic acid, followed by precipitation or crystallization. Then, the solvent or excess acid is evaporated from the mixture, and the mixture is dried to obtain the addition salt, or it can be prepared by filtration of the precipitated salt.

[0084] Preparation method 1

[0085] This invention provides a method for preparing a compound represented by chemical formula 1A, which comprises the following steps as shown in reaction formula 1:

[0086] Step 1: After dissolving compound 2 in an organic solvent, compound 3 is added, and the mixture is reacted at a temperature of 10°C to 50°C for 12 to 20 hours to obtain compound 4; and

[0087] Step 2: Add an organic solvent containing potassium superoxide to an organic solvent containing compound 4 obtained in step 1 above, and react at a temperature of 15°C to 30°C for 10 to 16 hours to obtain compound 1A.

[0088] Reaction 1:

[0089]

[0090] In the above reaction formula 1,

[0091] R 1 R 2 R 3 R 4 R 5 R 6 and R 7 As defined in chemical formula 1 as claimed in claim 1,

[0092] The above-mentioned compound 1A is included in chemical formula 1 of claim 1.

[0093] In the preparation method of the present invention, as examples of the above-mentioned organic solvents, methanol (MeOH), dimethylformamide (DMF), acetonitrile (MeCN), tetrahydrofuran (THF), dichloromethane (DCM), 1,2-dimethoxyethane, benzene, toluene, xylene, dimethyl sulfoxide (DMSO), or dioxane may be used alone or in combination.

[0094] In the preparation method of the present invention, as an example of a compound that can be prepared by the above preparation method, it may be 8-methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole, 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole, N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazole-2-amine, N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazole-2-amine or N-(3,4-difluorophenyl)benzo[d]oxazole-2-amine.

[0095] Preparation method 2

[0096] This invention provides a method for preparing a compound represented by chemical formula 1B, as shown in reaction formula 2 below, comprising the following steps:

[0097] Step 1: After dissolving compound 5 in an organic solvent, add compound 3 and react at a temperature of 10°C to 50°C for 12 to 20 hours to obtain compound 6;

[0098] Step 2: Add dropwise an organic solvent containing potassium superoxide to an organic solvent containing compound 6 obtained in Step 1 above, and react for 12 to 24 hours to obtain compound 7; and

[0099] Step 3: Dissolve compound 7 in an organic solvent, add boron tribromide, and react at room temperature for 20 to 28 hours to obtain compound 1B.

[0100] Reaction 2:

[0101]

[0102] In reaction formula 2 above,

[0103] R 3 R 4 R 5 R 6 and R 7 As defined in chemical formula 1 as claimed in claim 1,

[0104] The above-mentioned compound 1B is included in chemical formula 1 of claim 1.

[0105] In the preparation method of the present invention, as examples of the above-mentioned organic solvents, methanol, dimethylformamide, acetonitrile, tetrahydrofuran, dichloromethane, 1,2-dimethoxyethane, benzene, toluene, xylene, dimethyl sulfoxide, or dioxane may be used alone or in combination.

[0106] In the preparation method of the present invention, as an example of a compound that can be prepared by the above preparation method, it can be 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol.

[0107] Preparation method 3

[0108] This invention provides a method for preparing a compound represented by chemical formula 1C, as shown in reaction formula 3 below, comprising the following steps:

[0109] Step 1 involves dissolving compound 8, carbon disulfide, iodomethane, and sodium hydride in an organic solvent and reacting the mixture at a temperature of 10°C to 50°C for 2 to 8 hours to obtain compound 9; and

[0110] Step 2: After dissolving compound 9 and compound 2 in an organic solvent, react for 2 to 8 hours to obtain compound 1C.

[0111] Reaction 3:

[0112]

[0113] In the above reaction formula 3,

[0114] R 1 R 2 R 3 R 4 R 5 R 6 and R 7 As defined in chemical formula 1 as claimed in claim 1,

[0115] The above-mentioned compound 1C is included in chemical formula 1 of claim 1.

[0116] In the preparation method of the present invention, as examples of the above-mentioned organic solvents, methanol, dimethylformamide, acetonitrile, tetrahydrofuran, dichloromethane, 1,2-dimethoxyethane, benzene, toluene, xylene, dimethyl sulfoxide, or dioxane may be used alone or in combination.

[0117] In the preparation method of the present invention, as an example of a compound that can be prepared by the above preparation method, it can be N-(benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide.

[0118] Preparation method 4

[0119] This invention provides a method for preparing a compound represented by compound 1D, as shown in reaction formula 4 below, comprising the following steps:

[0120] Step 1: Compound 10 and Compound 3 are dissolved in an organic solvent and reacted at a temperature of 10°C to 50°C for 20 to 28 hours to obtain Compound 11.

[0121] Step 2: Add an organic solvent containing potassium superoxide to an organic solvent containing compound 11 obtained in step 1 above, and react at a temperature of 10°C to 50°C for 12 to 24 hours to obtain compound 12.

[0122] Step 3: Compound 12 and the catalyst are added to an organic solvent, hydrogen gas is introduced, and the mixture is reacted at a temperature of 10°C to 50°C for 12 to 20 hours to obtain compound 13; and

[0123] Step 4: After dissolving compounds 13 and 14 in an organic solvent, react them at a temperature of 10°C to 50°C for 12 to 24 hours to obtain compound 1D.

[0124] Reaction 4:

[0125]

[0126] In the above reaction formula 4,

[0127] R 3 R 4 R 5 R 6 and R 7 As defined in chemical formula 1 as claimed in claim 1;

[0128] R 8 Halogen, -NO2 and C 1-10 One or more of the straight-chain or side-chain haloalkanes;

[0129] The above-mentioned compound 1D is included in chemical formula 1 of claim 1.

[0130] In the preparation method of the present invention, as examples of the above-mentioned organic solvents, methanol, dimethylformamide, acetonitrile, tetrahydrofuran, dichloromethane, 1,2-dimethoxyethane, benzene, toluene, xylene, dimethyl sulfoxide, or dioxane may be used alone or in combination.

[0131] In the preparation method of the present invention, as an example of a compound that can be prepared by the above preparation method, it can be N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide, N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-3,4-dichlorobenzamide or N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-3-(chloromethyl)benzamide.

[0132] In this invention, the above composition can increase the expression level of the Klotho gene.

[0133] In this invention, the aforementioned degenerative neurological diseases include, but are not limited to, one or more diseases selected from the group consisting of stroke, amnesia, memory loss, memory impairment, dementia, amnesia, cognitive dysfunction, Parkinson's disease, Alzheimer's disease, Pick's disease, Creutzfeld-Kacob's disease, Huntington's disease, and Lou Gehrig's disease.

[0134] The compounds of the present invention can be administered in various dosage forms, including oral and parenteral administration, in clinical applications. In the case of formulation, they are prepared by using diluents or excipients such as commonly used fillers, expanders, binders, wetting agents, disintegrants, and surfactants.

[0135] Solid dosage forms for oral administration include tablets, pills, powders, granules, capsules, lozenges, etc., which are formulated by mixing one or more compounds of the present invention with at least one excipient such as starch, calcium carbonate, sucrose, lactose, or gelatin. Furthermore, in addition to simple excipients, lubricants such as magnesium stearate and talc are used. Liquid dosage forms for oral administration include suspensions, oral solutions, emulsions, or syrups, etc., which may contain various excipients such as humectants, sweeteners, flavorings, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin.

[0136] As preparations for parenteral administration, these include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, suppositories, etc. Non-aqueous solutions and suspensions may use propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As a base for suppositories, semi-synthetic fatty acid esters (Witepsol), polyethylene glycol, Tween 61, cocoa butter, glyceryl laurate, glycerin, gelatin, etc., may be used.

[0137] Furthermore, the effective dosage of the compound of the present invention for the human body can vary depending on the patient's age, weight, sex, administration method, health status, and disease severity. Typically, it ranges from approximately 0.001 mg / kg / day to 100 mg / kg / day, preferably from 0.01 mg / kg / day to 35 mg / kg / day. When based on an adult patient weighing 70 kg, the dosage is typically from 0.07 mg / day to 7000 mg / day, preferably from 0.7 mg / day to 2500 mg / day. It can also be administered once daily or several times daily at prescribed intervals, as determined by a doctor or pharmacist.

[0138] Food compositions or health food compositions used to prevent or improve degenerative neurological diseases

[0139] The present invention provides food compositions or health functional food compositions comprising the above-described compounds represented by chemical formula 1 or their pharmaceutically acceptable salts for the prevention or improvement of degenerative neurological diseases.

[0140] In this invention, the above composition can increase the expression level of the Klotho gene.

[0141] In this invention, the aforementioned degenerative neurological diseases include, but are not limited to, one or more diseases selected from the group consisting of stroke, amnesia, memory loss, memory impairment, dementia, amnesia, cognitive dysfunction, Parkinson's disease, Alzheimer's disease, Pick's disease, Creutzfeld-Kacob's disease, Huntington's disease, and Lou Gehrig's disease.

[0142] There are no particular restrictions on the types of food. Examples of foods in which the effective substances of this invention may be added include beverages, meats, sausages, bread, biscuits, cakes, chocolates, candies, snacks, crackers, pizzas, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, alcoholic beverages and microbial complexes, dairy products and dairy processed products, etc., which may include health foods and health functional foods in the general sense.

[0143] Health food and health functional food compositions containing the active ingredients of this invention can be added directly to food or used together with other foods or food ingredients, and can be used appropriately according to conventional methods. The mixing amount of the active ingredients can be appropriately determined according to its intended use (for prevention or improvement). Generally, from 0.1 parts by weight to 90 parts by weight of the above-mentioned composition in health food and health functional food can be added relative to the total amount of the whole food. However, in cases where the above amount is for the purpose of maintaining health or for long-term intake to control health, the above amount can be below the above range, and the active ingredients can also be used in amounts above the above range since there are no safety concerns.

[0144] The health food and health functional food composition of the present invention contains the effective substances of the present invention as essential ingredients in the indicated proportions. Other ingredients are not particularly limited; for example, in a typical beverage, various flavoring agents or natural carbohydrates may be included as additional ingredients. Examples of the aforementioned natural carbohydrates include conventional sugars such as monosaccharides, disaccharides, and polysaccharides, as well as sugar alcohols such as xylitol, sorbitol, and erythritol. Monosaccharides include glucose and fructose; disaccharides include maltose and sucrose; and polysaccharides include dextrin and cyclodextrin. As flavoring agents other than those mentioned above, natural flavoring agents (such as sematriol), stevia extracts (e.g., saccharin A, glycyrrhizin, etc.), and synthetic flavoring agents (such as saccharin and aspartame) can be advantageously used. The proportions of the aforementioned natural carbohydrates are as follows: per 100g of the health functional food composition of the present invention, typically about 1g to 20g, preferably about 5g to 12g.

[0145] In addition to the above-mentioned components, the health food and health functional food compositions containing the effective substances of the present invention may include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavoring agents, coloring agents and extenders (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective gel thickeners, pH adjusters, stabilizers, preservatives, glycerol, alcohols, and carbonation agents used in carbonated beverages. Furthermore, the health food and health functional food compositions of the present invention may include fruit pulp used in the preparation of natural fruit juices, fruit juice beverages, and vegetable beverages.

[0146] This ingredient can be used alone or in combination. Although the proportion of this additive is not important, it can generally be selected from 0.1 parts by weight to about 20 parts by weight relative to 100 parts by weight of a health food and health functional food composition containing the active ingredient of the present invention.

[0147] The present invention will now be described in more detail through the following embodiments. However, the following embodiments are merely illustrative of the invention, and the scope of the invention is not limited to the following embodiments.

[0148] Example 1: Preparation of N-(benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide (FCCS-17064)

[0149]

[0150] Step 1: Dimethyl(2-chloro-4-nitrobenzyl) ) Dimethyl (2-) Preparation of chloro-4-nitrobenzoyl)carbonimidodithioate (17064-2-1)

[0151] 2-Chloro-4-nitrobenzamide (500 mg, 2.49 mmol), carbon disulfide (CS2) (759 mg, 9.97 mmol), and iodomethane (1.13 g, 7.97 mmol) were dissolved in N,N-dimethylformamide (7 mL), and then 60% sodium hydride (200 mg, 4.98 mmol) was added. The mixture was stirred at room temperature for 5 hours.

[0152] Ice-cold water was slowly added to the reaction mixture, and ethyl acetate was extracted. The organic layer was washed with brine, dried over Na₂SO₄, and the solvent was removed under reduced pressure. The reaction mixture was purified by silica-gel column chromatography (10% ethyl acetate / n-hexane) to obtain a pale yellow solid of dimethyl (2-chloro-4-nitrobenzyl)iminodithiocarbonate (160 mg, 21%).

[0153] 1 H NMR (400MHz, acetone-d6); δ8.34 (d, 1H, J = 2.0Hz), 8.29 (dd, 1H, J = 2.4, 8.8Hz), 8.20 (d, 1H, J = 8.4Hz), 2.65 (s, 6H).

[0154] Step 2: N-(benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide (N-(Benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide) Preparation of yl)-2-chloro-4-nitrobenzamide (FCCS-17064)

[0155] After dissolving the dimethyl (2-chloro-4-nitrobenzyl)imino dithiocarbonate (150 mg, 0.49 mmol) obtained in step 1 above in dimethylformamide (15 mL), 2-aminophenol (53 mg, 0.49 mmol) was added.

[0156] After circulating the reaction mixture for 6 hours, the solvent was removed under reduced pressure. Purification was performed by silica gel column chromatography (40% ethyl acetate / n-hexane). Diethyl ether was added to the reaction mixture, and the precipitated solid was filtered to obtain a brown solid, N-(benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide (70 mg, 30%).

[0157] 1 H NMR (400MHz, acetone-d6); δ8.36 (d, 1H, J = 2.0Hz), 8.33 (dd, 1H, J = 2.0, 8.4Hz), 8.09 (d, 1H, J = 8.4Hz), 7.62-7.56 (m, 2H), 7.40-7.33 (m, 2H).

[0158] Example 2: Preparation of 8-methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (FCCS-17065)

[0159]

[0160] Step 1: 1-(3,4-dichlorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea (1-(3,4- Preparation of Dichlorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea, 17065-2-1)

[0161] 2-Amino-p-cresol (300 mg, 2.44 mmol) was dissolved in methanol (12 mL), followed by the addition of 3,4-dichlolrophenyl isothiocyanate (497 mg, 2.44 mmol) and stirring at room temperature for 18 hours. The reaction was confirmed by thin-layer chromatography (TLC) and then cooled in a refrigerator (0–4 °C). The precipitated solid was filtered to obtain a white solid (346 mg) of 1-(3,4-dichlorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea, which was used directly in the next step without further purification.

[0162] 1 H NMR (400MHz, acetone-d6); δ7.98 (dd, 1H, J = 0.4, 2.0Hz), 7.55-7.50 (m, 2H), 7.43 (br s, 1H), 6.94-6.90 (m, 1H), 6.85 (d, 1H, J = 8.4Hz) 2.24 (s, 3H).

[0163] Step 2: 8-Methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (8-Methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole) Preparation of dichlorophenyl)aminobenzoxazole (FCCS-17065)

[0164] To a solution of potassium superoxide (KO2) (375 mg, 5.29 mmol) and acetonitrile (MeCN) (15 mL), a solution of 1-(3,4-dichlorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea (346 mg, 1.06 mmol) obtained in step 1 above, dissolved in acetonitrile (25 mL), was slowly added, and the mixture was stirred at room temperature for 18 hours.

[0165] Dichloromethane and water were added to the reaction mixture and extracted. The organic layer was washed with brine, dried over Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (10% ethyl acetate / n-hexane) to obtain the target compound 8-methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (170 mg, 24%, step 2) as a white solid.

[0166] 1 H NMR(400MHz,acetone-d6); δ8.29(d,1H,J=2.8Hz),7.73(dd,1H,J=2.8,8.8Hz),7.76(d, 1H,J=8.8Hz),7.32-7.20(m,1H),7.28(d,1H,J=8.0Hz),7.00-6.970(m,1H),2.41(s,3H).

[0167] Example 3: Preparation of 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol (FCCS-17066)

[0168]

[0169] Step 1: 1-(3,4-dichlorophenyl)-3-(2-hydroxy-5-methoxyphenyl)thiourea (1-(3,4- Preparation of Dichlorophenyl)-3-(2-hydroxy-5-methoxyphenyl)thiourea, 17066-3-1)

[0170] 2-Amino-4-methoxyphenol (1.13 g, 8.12 mmol) was dissolved in methanol (40 mL), followed by the addition of 3,4-dichlorophenyl isothiocyanate (1.99 g, 9.74 mmol). The mixture was stirred at room temperature for 18 hours. After confirming the completion of the reaction by thin-layer chromatography, the mixture was cooled in a refrigerator (0 °C–4 °C). The precipitated solid was filtered to obtain a brown solid (2 g) of 1-(3,4-dichlorophenyl)-3-(2-hydroxy-5-methoxyphenyl)thiourea, which was used directly in the next step without further purification.

[0171] 1 H NMR(400MHz, methanol-d4); δ7.82(d,1H,J=2.4Hz),7.48-7.44(m,2H),7.39(dd,1 H, J=1.4, 8.8Hz), 6.81 (d, 1H, J=8.8Hz), 6.66 (dd, 1H, J=1.6, 8.8Hz), 3.73 (s, 3H).

[0172] Step 2: N-(3,4-dichlorophenyl)-5-methoxybenzo[d]oxazol-2-amine (N-(3,4- Preparation of dichlorophenyl)-5-methoxybenzo[d]oxazol-2-amine, 17066-3-2)

[0173] A solution of potassium superoxide (540 mg, 7.6 mmol) and acetonitrile (20 mL) was slowly added to a solution of 17066-3-1 (525 mg, 1.52 mmol) dissolved in acetonitrile (30 mL), and the mixture was stirred at room temperature for 18 hours. Dichloromethane and water were added to the reaction mixture and extracted. The organic layer was washed with brine, dried over Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (20% ethyl acetate / n-hexane) to obtain a brown solid of N-(3,4-dichlorophenyl)-5-methoxybenzo[d]oxazol-2-amine (230 mg, 35%).

[0174] 1 H NMR (400MHz, acetone-d6); δ8.29(d,1H,J=2.4Hz),7.70(dd,1H,J=2.4,8.8Hz),7.55(d,1H,J= 8.8Hz), 7.30 (d, 1H, J = 8.8Hz), 7.08 (d, 1H, J = 2.8Hz), 7.74 (dd, 1H, J = 2.4, 8.8Hz), 3.84 (s, 3H).

[0175] Step 3: 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol (2-((3,4-dichlorophenyl)) Preparation of amino)benzo[d]oxazol-5-ol (FCCS-17066)

[0176] Under an Ar atmosphere, 200 mg (0.65 mmol) of 17066-3-2 obtained in step 2 above was dissolved in 15 mL (anhydrous) of dichloromethane and cooled in an ice bath. Boron tribromide (3.23 mL, 1.0 M dichloromethane) was slowly added, and the temperature was raised to room temperature and stirred for 24 hours. Sodium hydroxide (NaOH) solution (8 mL, 1.0 M water) was slowly added to complete the reaction, and the organic and aqueous layers were separated by a separatory funnel. The aqueous layer was extracted with ethyl acetate, dried over Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (40% ethyl acetate / n-hexane) to obtain the target compound 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol (97 mg, 50%) as a brown solid.

[0177] 1H NMR(400MHz,acetone-d6); δ8.29(br s,-OH),8.26(d,1H,,J=2.4Hz),7.72(dd,1H,J=2.4,8.8Hz),7.56(d,1H,J=8.8Hz) ,7.21(dd,1H,J=2.0,7..2Hz), 6.95(d,1H,J=2.0Hz), 6.66(dd,1H,J=2.4,8.8Hz).

[0178] Example 4: Preparation of N-(2-(4-Ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide (FCCS-17067)

[0179]

[0180] Step 1: 1-(4-ethylphenyl)-3-(2-hydroxy-5-nitrophenyl)thiourea (1-(4-ethylphenyl)-3- Preparation of (2-hydroxy-5-nitrophenyl)thiourea (Interm-3-1)

[0181] 2-Amino-4-nitrophenol (1.88 g, 12.25 mmol) and 4-ethylphenyl isothiocyanate (2 g, 12.25 mmol) were dissolved in methanol (80 mL) and stirred at room temperature for one day. After removing the solvent under reduced pressure, the solution was purified by silica gel column chromatography (20% ethyl acetate / n-hexane) to obtain 1-(4-ethylphenyl)-3-(2-hydroxy-5-nitrophenyl)thiourea (2.9 g, 65%) as a brown solid.

[0182] 1 H NMR (400MHz, methanol-d4); δ9.24 (d, 1H, J = 2.8Hz), 7.88 (dd, 1H, J = 2.0, 9.2Hz), 7.36 (d, 2H, J = 8 .4Hz), 7.25 (d, 2H, J = 8.8Hz), 6.94 (d, 1H, J = 9.2Hz), 2.66 (q, 2H, J = 7.6Hz), 1.24 (t, 3H, J = 7.6Hz).

[0183] Step 2: N-(4-ethylphenyl)-5-nitrobenzo[d]oxazol-2-amine (N-(4-ethylphenyl)-5- Preparation of nitrobenzo[d]oxazol-2-amine (Interm-3-2)

[0184] After cooling a solution of potassium superoxide (2.8 g, 39.38 mmol) and acetonitrile (130 mL) in an ice bath, a solution of Interm-3-1 (2.5 g, 7.88 mmol) obtained in step 1 above dissolved in acetonitrile (170 mL) was slowly added, and the mixture was stirred at room temperature for 18 hours. Dichloromethane and water were added to the reaction mixture and extracted. The organic layer was washed with brine, dried over Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (10% ethyl acetate / n-hexane) to obtain a brown solid of compound Interm-3-2 (1.78 g, 80%).

[0185] 1 H NMR (400MHz, methanol-d4); δ8.20 (d, 1H, J = 1.0Hz), 8.08 (dd, 1H, J = 0.8, 9.6Hz), 7.59 (d, 2H, J = 8 .8Hz), 7.51 (d, 1H, J = 8.8Hz), 7.22 (d, 2H, J = 8.8Hz), 2.64 (q, 2H, J = 7.6Hz), 1.24 (t, 3H, J = 7.6Hz).

[0186] Step 3: N-(4-ethylphenyl)benzo[d]oxazol-2,5-diamine (N-(4-ethylphenyl)benzo[d] Preparation of oxazole-2,5-diamine (Interm-3-3)

[0187] Palladium on carbon (Pd / C) (1.70 g, 0.80 mmol, 10% by weight, wet support) was weighed and added to a round-flask, which was then purged with Ar gas. A solution of Interm-3-2 (1.58 g, 5.30 mmol) obtained in step 2 above, dissolved in 80 mL of methanol, was slowly added, followed by substitution with H2(g). The mixture was stirred at room temperature for 18 hours while bubbling H2(g). The reaction was confirmed to be complete by thin-layer chromatography, and the solvent was removed by filtration through a diatomaceous earth pad under reduced pressure. The reaction mixture was purified by silica gel column chromatography (40% ethyl acetate / n-hexane) to obtain a light brown solid, Interm-3-3 (1.21 g, 90%).

[0188] 1H NMR (400MHz, Acetone-d6); δ7.71(m,2H),7.19(m,2H),7.03(dd,1H,J=0.8,8.4Hz),6.75(dd, 1H, J=0.8, 2.0Hz), 6.44 (dd, 1H, J=2.0, 8.4Hz), 2.60 (q, 2H, J=7.6Hz), 1.19 (t, 3H, J=7.6Hz).

[0189] Step 4: N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide (N- (2-(4-Ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide, FCCS- Preparation of 17067)

[0190] The Interm-3-3 (253 mg, 1 mmol) and 2-chloro-5-nitrobenzoyl chloride (220 mg, 1 mmol) obtained in step 3 above were dissolved in dimethylformamide (4 mL), and then diisopropylethylamine (DIPEA) (129 mg, 1 mmol) was added. The mixture was stirred at room temperature for 18 hours. After 18 hours, 0.5 equivalents of 2-chloro-5-nitrobenzoyl chloride and diisopropylethylamine were added, and the mixture was stirred for another 8 hours. 10% HCl (aq.) was added to the reaction mixture, and after extraction with ethyl acetate, the organic layer was washed successively with saturated NaHCO3 aqueous solution and brine. After drying the organic layer with Na2SO4, the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (40% ethyl acetate / n-hexane) to obtain the target compound N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide (120 mg, 27%) as a pale yellow solid.

[0191] 1 H NMR (400MHz, DMSO-d6); δ10.71(s,1H),10.53(s,1H),8.48(d,1H,J=2.8Hz),8.34(dd,1H,J=2.4,8.8Hz),7.90(d,1H,J=8.8Hz),7.82(d,1H,J=2.0H z), 7.64 (d, 2H, J = 8.8Hz), 7.46 (d, 1H, J = 8.8Hz), 7.40 (dd, 1H, J = 2.0, 8.4Hz), 7..21 (d, 1H, J = 8.8Hz), 2.58 (q, 2H, J = 7.6Hz), 1.18 (t, 3H, J = 7.6Hz).

[0192] Example 5: Preparation of N-(2-(4-Ethylphenylamino)benzo[d]oxazol-5-yl)-3,4-dichlorobenzamide (FCCS-17068)

[0193]

[0194] Interm-3-3 (253 mg, 1 mmol) and 3,4-dichlorobenzoyl chloride (209 mg, 1 mmol) obtained in step 3 of Example 4 above were dissolved in dimethylformamide (4 mL), followed by the addition of diisopropylethylamine (129 mg, 1 mmol), and stirred at room temperature for 18 hours. 10% HCl (aq.) was added to the reaction mixture, and after extraction with ethyl acetate, the organic layer was washed sequentially with saturated NaHCO3 aqueous solution and brine. The organic layer was dried with Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (40% ethyl acetate / n-hexane) to obtain the target compound FCCS-17068 (270 mg, 64%) as a pale white solid.

[0195] 1 H NMR (400MHz, Acetone-d6); δ8.18(d,1H,J=2.4Hz),7.99(t,1H,J=2.4Hz),7.97(d,1H,J=2.0Hz),7.80-7.20(m,3 H), 7.70-7.50 (m, 1H), 7.35 (d, 1H, J = 8.8Hz), 7.24 (d, 1H, J = 8.8Hz), 2.63 (q, 2H, J = 7.6Hz), 1.22 (t, 3H, J = 7.6Hz).

[0196] Example 6: Preparation of N-(2-(4-Ethylphenylamino)benzo[d]oxazol-5-yl)-3-(chloromethyl)benzamide (FCCS-17069)

[0197]

[0198] Interm-3-3 (253 mg, 1 mmol) and 3-(chloromethyl)benzoyl chloride (189 mg, 1 mmol) obtained in step 3 of Example 4 above were dissolved in dimethylformamide (4 mL), followed by the addition of diisopropylethylamine (129 mg, 1 mmol), and stirred at room temperature for 18 hours. 10% HCl (aq.) was added to the reaction mixture, and after extraction with ethyl acetate, the organic layer was washed sequentially with saturated NaHCO3 aqueous solution and brine. The organic layer was dried with Na2SO4, and the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (30% ethyl acetate / n-hexane) to obtain the target compound FCCS-17069 (170 mg, 40%) as a pale white solid.

[0199] 1 H NMR (400MHz, Acetone-d6); δ8.08(t,1H,J=1.2Hz),8.03(d,1H,J=2.0Hz),7.98(dt,1H,J=1.2,7.6Hz),7.80-7.75(m,2H),7 .69-7.65(m,1H),7.57-7.52(m,3H),7.34(d,1H,J=8.8Hz),7.26-7.22(m,2H),2.62(q,2H,J=7.6Hz),1.22(t,3H,J=7.6Hz).

[0200] Example 7: Preparation of 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (FCCS-17065-A)

[0201]

[0202] Step 1: 1-(3,4-dichlorophenyl)-3-(2-hydroxyphenyl)thiourea (1-(3,4-dichlorophenyl)-3- Preparation of (2-hydroxyphenyl)thiourea (FCCS-17065-A-2-1)

[0203] Under an Ar atmosphere, 2-Aminophenol (300 mg, 2.749 mmol) was dissolved in methanol (anhydrous MeOH) (8 mL), followed by the slow dropwise addition of 3,4-dichlorophenylisothiocyanate (0.47 mL, 3.299 mmol). The mixture was stirred at room temperature for 14 hours. Thin-layer chromatography confirmed the complete disappearance of the starting material. After solvent removal under reduced pressure, silica was added to the crude product for adsorption, and silica gel column chromatography (30% EtOAc / hexane) was performed. f =0.4) to obtain 793 mg (light brown foamy solid, 92%) of 1-(3,4-dichlorophenyl)-3-(2-hydroxyphenyl)thiourea.

[0204] 1 H NMR (400MHz, CD3OD); δ7.82(d,1H,J=2.8Hz),7.63(d,,1H,J=7.6Hz),7.45(d,1H,J=8.8Hz),7.39( dd,1H,J=8.6,2.2Hz),7.11-7.06(m,1H),6.90(dd,1H,J=8.0,1.2Hz),6.85(td,1H,J=7.6,1.2Hz).

[0205] Step 2: 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (2-[N-(3,4-dichlorophenyl)] Preparation of aminobenzoxazole (FCCS-17065-A)

[0206] Under an Ar atmosphere, FCCS-17065-A-2-1 (400 mg, 1.277 mmol) and potassium superoxide (454 mg, 6.386 mmol) obtained in step 1 above were added, followed by acetonitrile (48 mL). The mixture was stirred at room temperature for 14 hours. After confirming the complete disappearance of the starting material using thin-layer chromatography, silica was added to the crude product and adsorption was performed under reduced pressure. Silica gel column chromatography (20% EtOAc / hexane, R) was then performed. f =0..4) to obtain 231 mg (white solid, 65%) of the target compound 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole.

[0207] 1H NMR (400MHz, CD3OD); δ8.06(d,1H,J=2.8Hz),7.55(dd,1H,J=8.6,2,6Hz),7.48-7.45( m, 2H), 7.39 (d, 1H, J = 8.0Hz), 7.24 (td, 1H, J = 7.6, 1.2Hz), 7.16 (td, 1H, J = 7.8, 1.2Hz).

[0208] Example 8: Preparation of N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazol-2-amine (FCCS-17065-B)

[0209]

[0210] Step 1: 1-(4,5-dichlorophenyl)-3-(3-hydroxynaphthyl-2-yl)thiourea (1-(3,4-dichlorophenyl)- Preparation of 3-(3-hydroxynaphthalen-2-yl)thiourea (FCCS-17065-B-2-1)

[0211] Under an Ar atmosphere, 3-Amino-2-naphthol (350 mg, 2.119 mmol) was added to methanol (anhydrous MeOH) (7 mL) and chloroform (CHCl13) (2 mL). After stirring at room temperature for 5 minutes, 3,4-dichlorophenyl isothiocyanate (0.38 mL, 2.638 mmol) was slowly added dropwise, and the mixture was stirred at room temperature for 13 hours. Thin-layer chromatography confirmed the complete disappearance of the starting material. After removing the solvent under reduced pressure, dichloromethane (8 mL) was added and stirred for 5 minutes. The undissolved solid was filtered to obtain 792 mg (white solid, 99%) of 1-(4,5-dichlorophenyl)-3-(3-hydroxynaphth-2-yl)thiourea.

[0212] 1 H NMR (400MHz, DMSO-d6); δ10.48(s,1H),10.34(s,1H),9.57(s,1H),8.59(s,1H),8.05(d,1H,J=2.0Hz),7.73(d,1H,J=8.0Hz),7.6 7(d,1H,J=7.6Hz), 7.60(d,1H,J=8.4Hz), 7.52(dd,1H,J=8.6,2.2Hz), 7.35(t,1H,J=7.2Hz), 7..27(t,1H,J=7.6Hz), 7.24(s,1H).

[0213] Step 2: N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazol-2-amine Preparation of naphtho[2,3-d]oxazol-2-amine (FCCS-17065-B)

[0214] Under an Ar atmosphere, FCCS-17065-B-2-1 (400 mg, 1.101 mmol) and potassium superoxide (391 mg, 5.505 mmol) obtained in step 1 above were added, followed by acetonitrile (42 mL), and the mixture was stirred at room temperature for 14 hours. After confirming the complete disappearance of the starting material using thin-layer chromatography, silica was added to the crude product and adsorption was performed under reduced pressure. Silica gel column chromatography (20% EtOAc / hexane, R) was then performed. f =0.5) to obtain 236 mg (white solid, 65%) of the target compound N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazol-2-amine.

[0215] 1 H NMR (400MHz, DMSO-d6); δ11.22 (s, 1H), 8.20 (d, 1H, J = 2.0Hz), 7.98-7.95 (m, 4H), 7.72 (dd, 1H, J = 8.8, 2.4Hz), 7..66 (d, 1H, J = 8.4Hz), 7.47-7.41 (m, 2H).

[0216] Example 9: Preparation of N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine (FCCS-17065-C)

[0217]

[0218] Step 1: 1-(3,4-difluorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea (1-(3,4- Preparation of difluorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea, FCCS-17065-C-2-1)

[0219] Under an Ar atmosphere, methanol (anhydrous MeOH) (8 mL) was added to and dissolved in 2-amino-p-cresol (300 mg, 2.436 mmol), followed by the slow dropwise addition of 3,4-difluorophenylisothiocyanate (0.37 mL, 2.923 mmol). The mixture was stirred at room temperature for 13 hours. Thin-layer chromatography was used to confirm the complete disappearance of the starting material. After solvent removal under reduced pressure, silica was added to the crude product for adsorption, and silica gel column chromatography (30% EtOAc / hexane, R) was performed. f =0.4) to obtain 710 mg (white foamy solid, 99%) of 1-(3,4-difluorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea.

[0220] 1H NMR (400MHz, CD3OD); δ7.57-7.52(m,1H),7.40(s,1H),7.25-7.13(m,2H),6.91(dd,1H,J=8.0,1.6Hz),6.79(d,1H,J=8.0Hz),2.25(s,3H). .

[0221] Step 2: N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine (N-(3,4-difluorophenyl)- Preparation of 5-methylbenzo[d]oxazol-2-amine (FCCS-17065-C)

[0222] Under an Ar atmosphere, FCCS-17065-C-2-1 (400 mg, 1.359 mmol) and potassium superoxide (483 mg, 6.795 mmol) obtained in step 1 above were added, followed by acetonitrile (52 mL) and stirring at room temperature for 14 hours. Thin-layer chromatography confirmed the complete disappearance of the starting material. Silica was added to the crude product and adsorption was performed under reduced pressure. Silica column chromatography (20% EtOAc / hexane, R) was then performed. f =0.45) to obtain 224 mg (white solid, 63%) of the target compound N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine.

[0223] 1 H NMR (400MHz, CD3OD); δ=7.83-7.78(m,1H),7.33-7.29(m,1H),7.27-7.20(m,3H),6.97-6.95(m,1H),2.41(s,3H).

[0224] Example 10: Synthesis of N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine (FCCS-19025)

[0225]

[0226] Step 1: 1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea (1-(3,4-difluorophenyl)-3- Preparation of (2-hydroxyphenyl)thiourea (FCCS-19025-2-1)

[0227] Under an Ar atmosphere, 2-aminophenol (150 mg, 1.37 mmol) was dissolved in methanol (8 mL), and 3,4-difluorophenyl isothiocyanate (224 μl, 1.65 mmol) was slowly added. The mixture was stirred at room temperature for 13 hours. The reaction was confirmed to be complete by thin-layer chromatography, and methanol was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (20% acetone / n-hexane) to obtain a pale yellow solid of 1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea (354 mg, 92%).

[0228] 1 H-NMR(400MHz,MeOH-d4)δ7.62(d,J=8.0Hz,1H),7.55(ddd,J=2.4Hz,1H),7.25-7.13(m,2H),7.11-7.05(m,1H),6.92-6.82(m,2H); ESI-(+)281.3[M+H] + .

[0229] Step 2: N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine Preparation of oxazol-2-amine (FCCS-19025)

[0230] Under an Ar atmosphere, FCCS-19025-2-1 (224 mg, 0.80 mmol) and potassium superoxide (284 mg, 4.00 mmol) obtained in step 1 were dissolved in acetonitrile (25 mL), and the mixture was stirred at room temperature for 14 hours. After confirming the completion of the reaction by thin-layer chromatography, the acetonitrile was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (10%–20% ethyl acetate / n-hexane) to obtain the target compound N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine (160 mg, 82%) as a white solid.

[0231] 1 H-NMR (400MHz, MeOH-d4) δ7.82 (ddd, J = 2.8Hz, 1H), 7.42 (d, J = 7.6Hz, 1H), 7.36 (d, J = 8. 0Hz,1H),7.34-7.29(m,1H),7.28-7.18(m,2H),7.16-7.10(m,1H); ESI-(+)247.2[M+H] + .

[0232] The chemical structural formulas of Examples 1 to 10 are shown in Table 1 below.

[0233]

[0234]

[0235] Comparative Example 1

[0236] N-(2-chlorophenyl)-1H-indole-3-carboxamide was used as Comparative Example 1.

[0237]

[0238] Comparative Example 2

[0239] 2'-Chloroacetanilide (C0621) was purchased and used as Comparative Example 2.

[0240]

[0241] Comparative Example 3

[0242] N-methyl-1H-indole-3-carboxamide (FCCS-16030) was purchased and used as Comparative Example 3.

[0243]

[0244] Comparative Example 4: Preparation of N-(2-((2-chlorophenyl)amino)-2-oxoethyl)-1H-indole-3-carboxamide (FCCS-16031)

[0245]

[0246] Step 1: Methyl 2-(1H-indole-3-carboxamide)acetate (methyl 2-(1H-indole-3- Preparation of carboxamidoacetate (CCS-16031-3-1)

[0247] Indole-3-carboxylic acid (600 mg, 3.72 mmol) and glycine methyl ester (467 mg, 3.72 mmol) were dissolved in chloroform (11 mL) under an Ar atmosphere and cooled in an ice bath. Triethylamine (1.04 mL, 7.446 mmol) and N,N-diisopropylcarbodiimide were then added, and the mixture was stirred at 0 °C for 14 hours. The solution was washed with 10% NaHCO3 aqueous solution, followed by washing with 5% HCl aqueous solution, and residual water was removed by passing through anhydrous Na2SO4 flakes. The solvent was removed under reduced pressure. Silica gel column chromatography (70% ethyl acetate / n-hexane) was performed to obtain 430 mg (white solid, 50%) of methyl 2-(1H-indole-3-carboxyamide) acetate in a mixture state. It was used directly in the next step without further purification. ESI-MS: 231.2 [MH] - .

[0248] Step 2: 2-(1H-indole-3-carboxamido)acetic acid Preparation of acid (FCCS-16031-3-2)

[0249] The 2-(1H-indole-3-carboxamide)acetate (220 mg, 0.947 mmol) obtained in step 1 above was dissolved in tetrahydrofuran (6 mL), and a solution of lithium hydroxide monohydrate (131 mg, 3.126 mmol) dissolved in water (2 mL) was added. The mixture was stirred at room temperature for 1 hour. After adjusting the pH to 2 by adding 1.0 N HCl aqueous solution, the mixture was extracted with ethyl acetate. After removing the remaining water with anhydrous Na2SO4 tablets, the solvent was removed under reduced pressure. 147 mg (yellow foamy solid, 71%) of 2-(1H-indole-3-carboxamide)acetic acid was obtained by silica gel column chromatography (10% methanol / dichloromethane).

[0250] 1 H NMR (400MHz, CD3OD); δ 8.10-8.08 (m, 1H), 7.92 (s, 1H), 7.43 (dt, J = 8.0, 1.2Hz, 1H), 7.17 (quint d, J = 7.2, 1.6Hz, 2H), 4.12 (s, 2H).

[0251] Step 3: N-(2-((2-chlorophenyl)amino)-2-oxoethyl)-1H-indole-3-carboxamide (N-(2-((2- Preparation of chlorophenyl)amino)-2-oxoethyl)-1H-indole-3-carboxamide, FCCS-16031)

[0252] Under an Ar atmosphere, 2-(1H-indole-3-carboxamide)acetic acid (200 mg, 0.917 mmol) and N,N,N',N'-tetramethyl-O-(N-succinimidyl)uronium tetrafluoroborate (TSTU) (290 mg, 0.962 mmol) obtained in step 2 above were dissolved in dimethylformamide (4 mL, anhydrous), and N,N-diisopropylethylamine (DIEA) (0.4 mL, 2.293 mmol) was added. The mixture was stirred at room temperature for 3 hours. 2-chloroaniline (0.29 mL, 2.751 mmol) and N,N-diisopropylethylamine (0.64 mL, 3.668 mmol) were then added, and the mixture was heated at 60 °C for 4 hours. After solvent removal under reduced pressure, extraction was performed with dichloromethane and saturated aqueous NH4Cl solution to obtain an organic layer. Residual water was removed by passing the layer through anhydrous Na2SO4, followed by solvent removal under reduced pressure. Silica gel column chromatography (70% ethyl acetate / n-hexane) yielded 20 mg (white solid, 6.6%) of the target compound N-(2-((2-chlorophenyl)amino)-2-oxoethyl)-1H-indole-3-carboxamide.

[0253] 1H NMR (400MHz, CD3OD); δ8.15-8.12(m,1H),8.04(dd,J=8.0,1.2Hz,1H),7.97( s,1H),7.46-7.41(m,2H),7.33-7.28(m,1H),7.23-7.12(m,3H),4.26(s,2H)

[0254] Experimental Example 1-1: Luciferase Expression Experiment (Comparative Examples 1 to 4)

[0255] To evaluate the expression of the klotho gene by assessing luciferase activity, RPTEC (human renal proximal tubule epithelial cell, ATCC CRL-4031) cells, which are epithelial cells of the proximal tubule of human kidney, were purchased from Lonza, Inc.

[0256] For cultivation, Renal Epithelial Growth Medium (REGM) manufactured by Lonza was used. TMBulletkit was used to culture the cells at 37°C and 5% CO2. The plasmid used to express luciferase was configured in a manner that allows the expression of the firefly luciferase gene to be regulated by the promoter site of the human KL (klotho) gene.

[0257] The plasmid was introduced into cells using Roche's X-treme GENE transfection reagent. The activity of luciferase expressed in the cells was measured using a Promega Dual-Luciferase reporter assay system. Luciferase activity was measured after treating cells cultured at the indicated concentrations for 24 hours. Excessively high luciferase activity indirectly indicated increased expression of the kl otho gene.

[0258] Comparative Examples 1 to 4 were treated with RPTEC cells at a concentration of 5 μM. The expression of the reporter gene was confirmed using a reporter gene that included a promoter from the start of the human klotho gene up to 1.7 kbp or a reporter gene that included a promoter from the start of the human klotho gene up to 240 kbp.

[0259] As a result, Figure 1 As shown, the compound of Comparative Example 1 was confirmed to have the highest luciferase activity.

[0260] Experimental Examples 1-2: Luciferase Expression Experiment (Examples 1 to 6)

[0261] Based on the results of Experiment 1-1 above, Examples 1 to 6, which have chemical structures similar to Comparative Example 1, were synthesized, and Experiment 1-2 was carried out.

[0262] Examples 1 to 6 were treated with RPTEC at concentrations of 0.5 μM, 1 μM, and 5 μM, respectively, using epithelial cells of the proximal tubules of human kidneys. Comparative Example 1 was treated with a concentration of 5 μM. The expression of the reporter gene was confirmed using a reporter gene (pHKP-luc) containing a promoter extending 2.1 kb upstream of the human klotho gene. The results are shown in [the table / incomplete]. Figure 2 and Figure 3 .

[0263] like Figure 2 As shown, the expression levels of the reporter genes of the compounds in Examples 1 and 2 were confirmed to be similar to those in Comparative Example 1.

[0264] like Figure 3As shown, Comparative Example 1 and Examples 1 to 3 were treated with RPTEC cells at a concentration of 5 μM. The expression of the reporter gene was confirmed using a reporter gene (pHKP-luc) that includes a promoter up to -2.1 kb upstream of the human klotho gene. The results confirmed that the level of the compound in Example 2 was similar to that in Comparative Example 1.

[0265] Experiment Example 2: Quantitative evaluation of the expression level of the klotho (KL) gene using real-time polymerase chain reaction (Real-time PCR) experiment

[0266] RNA was extracted from RPTEC cells, which were epithelial cells of the proximal tubules of human kidneys, after being treated with the compounds of Comparative Example 1 and Examples 1 to 2 for 6 hours. The Qiagen RNeasy kit was used. The extracted RNA was used to prepare cDNA using the Thermo Fisher Scientific Superscript II kit. Results of the KL (klotho) gene-specific assay performed using the Applied Biosystems Taqman Gene Expression assays kit are shown below. Figure 4 .

[0267] like Figure 4 As shown, the levels of the compound in Example 2 were confirmed to be similar to those in Comparative Example 1.

[0268] Based on the results of this Experiment Example 2, compounds of Examples 7 to 10 with chemical structures similar to those of Example 2 were synthesized and used in subsequent Experiment Example 3.

[0269] Example 3: Quantitative evaluation of klotho (KL) gene expression using conventional polymerase chain reaction (PCR) experiments

[0270] In Examples 7 to 10, RPTEC cells, which are epithelial cells of the proximal tubules of human kidneys, were treated with 2.5 μM for 6 hours. RNA was extracted from the cells, and the extracted RNA was subjected to conventional polymerase chain reaction after cDNA preparation using the Superscript II kit from Thermo Fisher Scientific.

[0271] The primer information used in the experiment is as follows.

[0272] KL-F GATAGAGAAAAATGGCTTCCCTCC (serial number 1)

[0273] KL-R GGTCGGTAAACTGAGACAGAGTGG(Serial Number 2)

[0274] GAPDH-F TGACAACTTTGGTATCGTGGAAGG (Serial Number 3)

[0275] GAPDH-R AGGGATGATGTTCTGGAGAGCC (Serial Number 4)

[0276] After electrophoresis on an agarose gel, the DNA amplified by polymerase chain reaction was confirmed by ethidium bromide staining. The amount of DNA in the bands was quantified using the SpeedyQuant program and shown in the figure. Figure 5 .

[0277] like Figure 5 As shown, it was confirmed that the expression level of the klotho (KL) gene in Examples 8 to 10 was higher than that in Comparative Example 1. In particular, Example 10 showed an expression level that was about 10 times higher than that in Comparative Example 1.

[0278] Experiment Example 4: Toxicity Test

[0279] Comparative Examples 1, 2, and Examples 9 to 10 were treated with cultured HK2 (human kidney-2) cells at concentrations of 25 μM or 12.5 μM for 24 hours. Cytotoxicity was then determined using the EZ-Cytox kit. EZ-Cytox generates formazan with absorbance at 450 nm via mitochondrial enzymes in live cells; therefore, live cells exhibit higher absorbance at 450 nm. The reduction in cytotoxicity by treatment with the compound sample was confirmed when the toxicity of cells treated with the same volume of dimethyl sulfoxide (DMSO) was considered as 1. The results are shown below. Figure 6 .

[0280] like Figure 6 As shown, when treated at concentrations of 12.5 μM or 25 μM, the compound of Example 10 exhibited minimal toxicity, and when compared with Comparative Example 1, a toxicity improvement of more than 20% was confirmed.

[0281] Experimental Example 5. Analysis of the inhibitory effect of KS1 compound (Example 10) on neuronal aging.

[0282] 1) Cell culture and compound treatment

[0283] HT22 cells, representing mouse hippocampal neural cells, were cultured in Duchenne Modified Igor Medium (DMEM) supplemented with 10% fetal bovine serum (FBS). Cells were cultured at 37°C with 5% CO2. When cells reached approximately 80% confluence on the culture dish surface, they were treated with 0.05% trypsin and transferred to new culture dishes for subculturing. The compound was added at each subculture to maintain a final concentration of 2.5 μM. For a negative control, cells cultured three times (#5) containing only dimethyl sulfoxide (DMSO) were used as a control group where senescence was not induced. Cells cultured 20 times (#25) were used as cells for induced senescence.

[0284] 2) Confirm the degree of aging

[0285] To determine the degree of cellular senescence, the "Senescence β-galactosidase Staining Kit" from Cell Signaling Technology was used. Cells were placed in the staining solution on the day of the experiment, and the stained cells were identified after 8 hours. The number of stained cells was determined from the total number of cells observed under a 200x microscope and displayed proportionally. The average number of stained cells was calculated by counting stained cells in three distinct regions within each sample. Since β-galactosidase expression increases with cellular senescence, stained cells were determined to be more senescent than unstained cells.

[0286] 3) Experimental Results

[0287] Experimental results confirmed that cells cultured for 20 passages showed increased senescence compared to cells cultured for 5 passages. Under a microscope at 200x magnification, approximately 50% of the cells cultured for 20 passages were stained, compared to only 5% of the cells cultured for 5 passages. In the group of cells cultured for the same 20 passages but with KS1 compound (Example 10) added to the culture medium, the degree of staining was reduced, with approximately 40% of the cells stained. That is, cells cultured in the presence of KS1 compound (Example 10) showed approximately 20% less senescence during 20 passages compared to cells grown in medium containing dimethyl sulfoxide. Figure 7 ).

[0288] Experimental Example 6. Analysis of the inhibitory effect of KS1 compound (Example 10) on neuronal inflammation.

[0289] 1) Cell culture and compound treatment

[0290] HT22 cells, derived from mouse hippocampal neurons, were cultured in Duchenne modified Igor medium supplemented with 10% fetal bovine serum. Cells were cultured at 37°C with 5% CO2. When cells reached approximately 80% confluence on the culture dish surface, they were treated with 0.05% trypsin and transferred to new culture dishes for subculturing. The compound was added at each subculture to maintain a final concentration of 2.5 μM. For a negative control, cells cultured three times (#5) with only dimethyl sulfoxide (DMSO) as the solvent were used as a control group where aging was not induced. Cells cultured 20 times (#25) were used as cells for induced aging.

[0291] 2) Inflammation induction experiment

[0292] 10,000 cells were aliquoted into 160 μl of culture medium in each well of a 96-well plate and cultured at 37°C with 5% CO2 for 24 hours. At this point, a compound was added to the culture medium to bring the final concentration to 2.5 μM, and the cells were cultured together. After culturing, 1 μg / mL of lipopolysaccharide (LPS) from Cell Applications was added, followed by an additional 24 hours of culture. Then, 20 μl of the CytoX cell viability assay kit from the same company was added to each well, and the cells were cultured for 1–4 hours. Color changes were then measured at a wavelength of 450 nm.

[0293] 3) Experimental Results

[0294] Experimental results showed that cells cultured for 20 passages exhibited increased cytotoxicity due to lipopolysaccharide (LPS) treatment compared to cells cultured for 5 passages. When absorbance changes were measured using a spectrophotometer, approximately 80% of cells cultured for 20 passages containing dimethyl sulfoxide died due to LPS toxicity, compared to only approximately 50% of cells cultured for 5 passages. Relatively more apoptosis induced by the toxic substance occurred in senescent cells. In the case of cells cultured in a medium supplemented with compound KS1 (Example 10), the proportion of cells dying due to LPS treatment in cells cultured for 20 passages was 60%, compared to 45% in cells cultured for 5 passages. That is, it was confirmed that LPS-induced cytotoxicity was reduced in cells cultured in the presence of compound KS1 (Example 10), resulting in greater cell survival. This indicates that compound KS1 (Example 10) is effective in suppressing inflammation in nerve cells. Figure 8 ).

[0295] Experimental Example 7. Experiment confirming the therapeutic effect of KS1 compound in an animal model of cognitive impairment.

[0296] 1) Animal model and administration method of KS1 compound (Example 10)

[0297] This experiment used 5xFAD mice that were at least 4 months or 6 months old. 5xFAD mice are Alzheimer's disease mice with a genetically inherited overproduction of β-amyloid (Aβ) protein, obtained and used from the KIST Research Animal Resource Center, which holds and sells these mice. Normal mice without the genetically inherited overproduction of β-amyloid protein, obtained from the KIST Research Animal Resource Center, served as the normal control group (WT). All experimental animals underwent a one-week acclimatization process before the experiment. During the experiment, the mice were housed in a controlled environment with a temperature of 22±2℃ and humidity of 40%-60%, with free access to food and a 12-hour light-dark cycle. All animal experiments were conducted in accordance with the animal experiment operation guidelines of the Institutional Animal Care and Use Committee of the Korea Advanced Institute of Science and Technology (KAIST).

[0298] Animal model mice and normal control mice were administered the vehicle (5% dimethyl sulfoxide + 65% polyethylene glycol 400 (PEG400) + 30% saline) or a solution containing KS1 (Example 10) orally (po) daily at a concentration of 10 mg / kg for 4 or 12 weeks. Three mice were used in each experimental group. Body weight was measured weekly during the administration period. After administration, cognitive function tests were performed. After euthanasia, organs were harvested and their changes were confirmed using biochemical methods.

[0299] 2) Experimental methods for confirming cognitive function

[0300] 2-1) Novel object recognition test (NOR)

[0301] The novel object recognition test modifies existing methods, consisting of an adaptation period, an exploration period, and a novel object recognition period. The day before the experiment, mice are placed in an open area for 30 minutes to acclimatize, and then two identical objects are placed at predetermined intervals. While the animals are allowed to explore freely for 10 minutes, the time spent on each object is measured using an animal movement tracking system (Ethovision), after which they are returned to their cages for one day. The next day, one of the objects is replaced with a new substance, and the animal's movement is measured for another 10 minutes. The percentage of time spent on each object during the total exploration time is converted to determine object preference (recognition index) (%).

[0302] 2-2) Passive Avoidance Experiment

[0303] The passive avoidance experimental area was divided into two zones: a light-lit area and a dark area, with the floor made of wire mesh. During training, the experimental animals were placed in the light area. Once an animal moved to the dark area, the door was immediately closed, and the animal received a 0.45mA current flow through its feet for 2 seconds (foot shock). Testing was conducted one day after training, measuring the time it took for the animal to move from the light area back to the dark area (the maximum time was set at 600 seconds). This passive avoidance experiment was used to assess spatial learning and memory.

[0304] 2-3) Statistical processing

[0305] All data are expressed as mean (standard error of mean (SEM)). Differences between groups were confirmed using one-way ANOVA and Tukey's multiple comparisons test. Statistically significant differences were indicated by p < 0.05*, p < 0.01**, or p < 0.001***.

[0306] 3) Experimental Results

[0307] 3-1) Decreased expression of cognitive impairment proteins

[0308] The fluorescence levels of phosphorylated microtubule-associated protein (phospho-Tau) in various locations (HPC: hippocampus; CTX: neocortex) of brain tissue sections isolated from 5xFAD cognitive impairment animal models, control groups (CTLs) and groups treated with KS1 for one month and three months were investigated using immunofluorescence. The results confirmed that the expression of phosphorylated microtubule-associated protein was statistically significantly reduced in mice treated with KS1 (Example 10) compared to mice treated with the solvent. In the hippocampus (HPC), only mice treated for three months showed a reduction, while in the neocortex (CTX), both mice treated for one month and three months showed a reduction. Figure 9 ).

[0309] 3-2) Increased expression of the neuronal marker NeuN

[0310] The fluorescence levels of NeuN in brain tissue sections (CTX: neocortex, CA: Ammon's angle, DG: dentate gyrus) isolated from the 5xFAD cognitive impairment animal model, the control group (CTL) of the normal control animal model, and groups treated with KS1 for one month and three months were investigated using immunofluorescence. The results confirmed that the expression of NeuN neural marker proteins was statistically significantly increased in mice treated with KS1 (Example 10) compared to mice treated with the solvent. Figure 10 Significant increases in NeuN via KS1 could not be confirmed in the neocortex (primary somatosensory cortex, CTX) and dentate gyrus (DG), but increases in NeuN were confirmed in the Cornu Ammonis (CA) group treated with KS1.

[0311] 3-3) Novel Object Recognition Test (NOR)

[0312] When exploring mouse behavior using the novelty object recognition test, it was confirmed that mice with cognitive impairment (5xFAD) treated with KS1 had a statistically significantly higher object exploration ability than mice treated with the solvent. Figure 11 ).

[0313] 3-4) Passive Avoidance Experiment

[0314] The results of the passive avoidance test on spatial learning and memory confirmed that the cognitively impaired (5xFAD) mice had significantly reduced abilities compared to normal mice, but mice given KS1 for 4 weeks maintained abilities similar to those of normal mice. Figure 12 ).

[0315] The present invention has now been described with reference to preferred embodiments. It will be understood by those skilled in the art that the invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustratively rather than limitingly. The scope of the invention is not shown in the foregoing description, but rather particularly in the claims, and all differences within the equivalent scope should be interpreted as included in the invention.

Claims

1. Use of a compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof in the preparation of a pharmaceutical composition for the prevention or treatment of degenerative neurological diseases. Chemical Formula 1: , In the above chemical formula 1, L 1 It is a single bond; R 1 and R 2 They are -H or C respectively. 1-10 Straight-chain or side-chain alkyl groups; R 3 -H; R 4 -F; R 5 -F; R 6 -H; and R 7 -H; The degenerative neurological diseases mentioned above are selected from the group consisting of memory impairment, dementia, amnesia, or cognitive dysfunction.

2. The use according to claim 1, wherein, The degenerative neurological disease mentioned is selected from memory loss or Alzheimer's disease.

3. The use according to claim 1 or 2, characterized in that, The compound represented by the above chemical formula 1 is selected from one of the following groups of compounds: ; as well as 。 4. The use according to claim 1 or 2, characterized in that, The above composition increases the expression level of the Klotho gene.

Citation Information

Patent Citations

  • Compound for inducing expression of anti-aging gene KLOTHO and application thereof

    CN114502541A

  • CXCR3 / CXCL10 antagonistic compounds, process for the preparation thereof, and a pharmaceutical composition for preventing or treating bone metastases comprising the same

    KR101446301B1

  • New benzoxazol derivatives, the preparation thereof and the pharmaceutical composition comprising the same for interleukin-6 antagonist

    KR1020110137868A

  • 2-(phenylamino)benzo[d]oxazol-5-ol derivatives, preparation method thereof, and pharmaceutical composition for use in preventing or treating inflammatory diseases containing the same as an active ingredient

    KR1020170024522A

  • Benzoxazole derivative or analogue thereof for inhibiting 5-lipoxygenase and pharmaceutical composition containing same

    US20070066577A1