A fluorescent aptamer biosensor for detecting kanamycin and a preparation method and application thereof

By utilizing a fluorescent aptamer biosensor and leveraging the π-π stacking and hydrogen bonding between DNA-Cu/AgNCs and NH2–UiO–66, a rapid, stable, and economical detection of kanamycin has been achieved, solving the problems of sensitivity and operational complexity in existing kanamycin detection technologies.

CN117347336BActive Publication Date: 2026-06-12HEFEI UNIV OF TECH

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HEFEI UNIV OF TECH
Filing Date
2023-10-07
Publication Date
2026-06-12

AI Technical Summary

Technical Problem

Existing technologies for detecting kanamycin suffer from limitations in sensitivity, operational complexity, high cost, and complex equipment, lacking a simple, stable, and economical rapid detection method.

Method used

A fluorescent aptamer biosensor was developed, which synthesized fluorescent copper-silver nanoclusters DNA-Cu/AgNCs with aptamers as templates as energy donors and prepared zirconium metal-organic framework NH2–UiO–66 as energy acceptor. Rapid detection of kanamycin was achieved by utilizing π-π stacking and hydrogen bonding.

🎯Benefits of technology

A rapid, stable, and economical kanamycin detection method was achieved, with a response time of only 2 minutes and the entire detection system completed within 25 minutes. A good quantitative relationship was found between fluorescence intensity and kanamycin concentration.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117347336B_ABST
    Figure CN117347336B_ABST
Patent Text Reader

Abstract

The application relates to a fluorescent aptamer biosensor for detecting kanamycin and a preparation method and application thereof, and relates to the technical field of biosensors.The fluorescent aptamer biosensor is prepared by synthesizing fluorescent copper-silver nanocluster DNA-Cu / AgNCs as an energy donor with an aptamer as a template, and preparing zirconium metal organic framework NH2-UiO-66 as an energy acceptor.The DNA-Cu / AgNCs as the energy donor in the aptamer fluorescent sensor has high fluorescence, better stability and higher quantum yield.The NH2-UiO-66 as the energy acceptor in the system has the characteristics of a three-dimensional porous structure, a large specific surface area, a regular pore structure, adjustable particle size and pore, and the like, is easy to manufacture, has the advantages of cost-effectiveness, high efficiency and environmental protection.The aptamer fluorescent sensor for detecting kanamycin has a fast detection speed, and after the kanamycin target is added, the response time is only 2 minutes, and the whole detection system can be completed within 25 minutes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biosensor technology, specifically to a fluorescent aptamer biosensor for detecting kanamycin, its preparation method, and its application. Background Technology

[0002] Various techniques have been developed for the detection of kanamycin, including colorimetric methods, electrochemical methods, photoelectrochemical methods, enzyme-linked immunosorbent assay (ELISA), high-performance liquid chromatography (HPLC), capillary electrophoresis (CE), gas chromatography-mass spectrometry (GC-MS), and surface-enhanced Raman scattering (SERE). Each method has its advantages and disadvantages. Colorimetric methods have limited sensitivity; electrochemical methods involve cumbersome electrode modification and poor stability; ELISA requires antibodies due to economic reasons, resulting in high costs; and other methods such as HPLC, capillary electrophoresis, and SERE are mostly time-consuming, complex in operation, and require complex equipment. Therefore, to overcome the shortcomings of traditional detection methods, it is necessary to develop a simple, stable, and economical rapid detection method, namely, using a fluorescent aptamer biosensor to detect the antibiotic kanamycin. Summary of the Invention

[0003] This invention proposes a fluorescent aptamer biosensor for detecting kanamycin.

[0004] The technical solution is as follows: This fluorescent aptamer biosensor synthesizes fluorescent copper-silver nanoclusters DNA-Cu / AgNCs with aptamers as templates as energy donors, and simultaneously prepares zirconium metal-organic framework NH2–UiO–66 as energy acceptor.

[0005] Another technical solution is the preparation method of a fluorescent aptamer biosensor;

[0006] The synthesis steps of DNA-Cu / AgNCs are as follows: First, the aptamer nanocluster sequence, i.e. DNA (Cu / AgNCs), is dissolved in PBS solution. AgNO3 and Cu(NO3)2·3H2O are added to the PBS solution containing the aptamer nanocluster sequence, and then the mixture is placed in an ice bath. After that, freshly prepared NaBH4 solution is added and shaken vigorously. The mixture of aptamer nanocluster sequence, AgNO3, Cu(NO3)2, and NaBH4 is incubated at room temperature to obtain a pale yellow DNA-Cu / AgNCs solution, which is then stored in a refrigerator at 4°C in the dark.

[0007] The aptamer nanocluster sequence is: (5'-3')CCCTTAATCCCC TGGGGGTTGAGGCTAAGCCGA;

[0008] The synthesis steps of NH2-UiO-66 are as follows: weigh ZrCl4 and H2ATA and dissolve them in DMF, sonicate until they are evenly dispersed, then add benzoic acid and stir until dissolved. Transfer the mixture to a polytetrafluoroethylene reactor for reaction, then remove it and cool it to room temperature overnight. Then wash it with DMF and ethanol, and then dry it overnight.

[0009] Preferably, in the synthesis steps of the DNA-Cu / AgNCs: the concentration of the aptamer nanocluster sequence is 100 μmol / L; the concentration of the PBS solution is 40 mmol / L, pH = 7; the concentration of AgNO3 is 1 mmol / L; the concentration of Cu(NO3)2·3H2O is 1 mmol / L; the ice bath time is 15 min; the concentration of NaBH4 is 2 mmol / L; the shaking time is 1 min; and the incubation time is 90 min.

[0010] Preferably, in the synthesis step of the DNA-Cu / AgNCs, the final concentration ratio of the aptamer nanocluster sequence, AgNO3, Cu(NO3)2, and NaBH4 is 1:3:8:11.

[0011] Preferably, in the synthesis steps of NH2-UiO-66: ZrCl4 mass is 140 mg; H2ATA mass is 49.25 mg; DMF volume is 20 mL; ultrasonication for 30 min until uniform dispersion; benzoic acid mass is 366.5 mg; reaction in a polytetrafluoroethylene reactor at 120 °C for 48 h.

[0012] Another technical solution: the application of a fluorescent aptamer biosensor for detecting kanamycin. The specific steps are as follows: First, add PBS buffer solution to a centrifuge tube, then add NH2-UiO-66 to the centrifuge tube and mix thoroughly with PBS; then add DNA-Cu / AgNCs to the mixture, incubate the mixture in the dark, and after the fluorescence quenches and returns to room temperature, add the kanamycin to be detected. The fluorescence recovers after 2 minutes at room temperature, and the fluorescence of the above system is measured using a fluorescence spectrometer.

[0013] Preferably, the concentration of the PBS buffer solution is 40 mmol / L and the pH is 7; the incubation temperature under dark conditions is 37°C and the incubation time is 20 min.

[0014] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0015] A fluorescent aptamer sensor based on DNA-Cu / AgNCs and NH2–UiO–66 was developed to detect kanamycin residues in milk. Fluorescent copper-silver nanoclusters, templated with the aptamer, were synthesized as energy donors, while a zirconium metal-organic framework NH2–UiO–66 was prepared as an energy acceptor. Due to the π-π stacking, hydrogen bonding, and coordination between NH2–UiO–66 and DNA-Cu / AgNCs, NH2–UiO–66 can adsorb and quench the fluorescence of DNA-Cu / AgNCs. When kanamycin is present, the aptamer has a stronger affinity for kanamycin, recognizing and binding to it, reducing the π-π stacking between NH2–UiO–66 and single-stranded DNA. This leads to resolution from the aptamer surface, with fluorescence recovery at 560 nm. Furthermore, the fluorescence recovery time is only two minutes, achieving real-time detection. The fluorescence intensity is then used to quantify the kanamycin by analyzing the relationship between fluorescence intensity and kanamycin concentration.

[0016] (1): The aptamer fluorescence sensor of the present invention is a new detection system formed by nanoclusters with aptamers as templates and zirconium metal-organic framework. In this system, DNA-Cu / AgNCs, which is the energy donor, has high fluorescence, better stability and higher quantum yield. NH2-UiO-66, which is the energy acceptor in this system, has a three-dimensional porous structure, large specific surface area, regular pore structure and adjustable particle size and pore size. It is also easy to manufacture and has the advantages of cost-effectiveness, high efficiency and environmental protection.

[0017] (2): The aptamer fluorescence sensor of the present invention can detect kanamycin quickly. After adding the kanamycin target, the response time is only 2 minutes, and the entire detection system can be completed within 25 minutes. Attached Figure Description

[0018] Figure 1 This invention provides electron microscopy characterization and particle size distribution of DNA-Cu / AgNCs and NH2-UiO-666 materials prepared by the method in Example 1, wherein (A) and (B) are DNA-Cu / AgNCs and particle size histograms, and (C) and (D) are NH2-UiO-66.

[0019] Figure 2 The present invention provides fluorescence spectra of different substances in Example 1 and Comparative Example 1, with excitation at 470 nm and emission at 560 nm.

[0020] Figure 3 Fluorescence spectra of DNA-Cu / AgNCS and RhB.

[0021] Figure 4The present invention provides fluorescence response diagrams for detecting different concentrations (0.5-10 μM) of kanamycin in Example 2: (A) fluorescence spectra of DNA-AgNCs and (B) fluorescence spectra of DNA-Cu / AgNCs at different concentrations (0.5-10 μM) of kanamycin. Detailed Implementation

[0022] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0023] Example 1: A fluorescent aptamer biosensor for detecting kanamycin. This fluorescent aptamer biosensor synthesizes fluorescent copper-silver nanoclusters DNA-Cu / AgNCs with aptamers as templates as energy donors, and simultaneously prepares zirconium metal-organic framework NH2–UiO–66 as an energy acceptor.

[0024] The preparation method of this fluorescent aptamer biosensor is as follows:

[0025] The synthesis steps of DNA-Cu / AgNCs are as follows: First, the aptamer nanocluster sequence, i.e. DNA (Cu / AgNCs), is dissolved in PBS solution (40 mmol / L, pH=7). AgNO3 (concentration 1 mmol / L) and Cu(NO3)2·3H2O (concentration 1 mmol / L) are added to the PBS solution containing the aptamer nanocluster sequence, and then the mixture is placed in an ice bath for 15 min. Then, freshly prepared NaBH4 solution (concentration 2 mmol / L) is added and the mixture is shaken vigorously for 1 min. The final concentration ratio of aptamer nanocluster sequence, AgNO3, Cu(NO3)2, and NaBH4 is 1:3:8:11. The mixture of aptamer nanocluster sequence, AgNO3, Cu(NO3)2, and NaBH4 is incubated at room temperature for 90 min to obtain a pale yellow DNA-Cu / AgNCs solution, which is then stored in a refrigerator at 4°C in the dark.

[0026] The concentration of the aptamer nanocluster sequence was 100 μmol / L; the aptamer nanocluster sequence was (5'-3')CCCTTAATCCCC TGGGGGTTGAGGCTAAGCCGA; the DNA sequences used in the experiment were synthesized and purified by Sangon Biotech (Shanghai) Co., Ltd., and the (5'-3') sequence was: CCC TTAATC CCC TGG GGG TTGAGG CTAAGC CGA, named DNA-Cu / AgNCs, which were synthesized based on the following sequence.

[0027] For example, the copper-silver template sequence CCCTTAATCCCCu / Ag-Aptamer(DNA-Cu / AgNCs)CCCTTAATCCCCTGGGGGTTGAGGCTAAGCCG.

[0028] The synthesis steps of NH2-UiO-66 are as follows: 140 mg of zirconium chloride (ZrCl4) and 49.25 mg of 2-aminoterephthalic acid (H2ATA) were weighed and dissolved in 20 mL of 2-aminoterephthalic acid (DMF). The mixture was sonicated for 30 min until it was evenly dispersed. Then, 366.5 mg of benzoic acid was added and stirred until dissolved. The mixture was then transferred to a polytetrafluoroethylene reactor and reacted at 120 °C for 48 h. After that, the mixture was removed and cooled to room temperature overnight. Then, it was washed several times with DMF and ethanol and dried at 120 °C overnight.

[0029] The DNA-Cu / AgNCs and NH2-UiO-66 prepared using the method in Example 1 were characterized, and the results are as follows: Figure 1 The morphology of the prepared DNA-Cu / AgNCs was characterized by TEM, as shown below. Figure 1 As shown in -A, the morphology and particle size of the DNA-Cu / AgNCs fluorescent probe were analyzed using TEM, and the results are as follows: Figure 1 As shown in Figure A, the TEM image reveals that DNA-Cu / AgNCs are uniformly dispersed and spherical. Particle size distribution histograms were plotted by measuring the particle size of each particle in the image, showing an average particle size of approximately 5.5 nm. TEM characterization indicates that DNA-Cu / AgNCs have a relatively uniform size.

[0030] Meanwhile, the morphology of NH2-UiO-66 was characterized by TEM. Figure 1 As shown in -C and D, the surface morphology can be clearly displayed, showing a relatively uniform octahedral NH2-UiO-66(Zr) nanocrystal structure with an average particle size in the range of 40-50 nm.

[0031] Comparative Example 1: Synthesis of DNA-AgNCs. The difference between this and the DNA-Cu / AgNCs synthesis in Example 1 is that Cu(NO3)2 was not added, but the other reaction conditions were the same.

[0032] Fluorescence intensity: Comparison of fluorescence intensity of the two nanoclusters, specifically the fluorescence emission intensity of DNA-Cu / AgNCs and DNA-AgNCs at 560 nm under 470 nm excitation. Figure 2 It is clear that copper-silver nanoclusters have higher fluorescence intensity.

[0033] Comparison of quantum yields of DNA-AgNCs and DNA-Cu / AgNCs:

[0034] The quantum yield (QY) represents the luminescence ability of a material; a higher QY value indicates better fluorescence performance. This experiment used a reference method to determine the QY of synthesized DNA-NCs. Figure 3 The fluorescence emission spectra of DNA-Cu / AgNCs and standard RhB (1 μg / mL, anhydrous ethanol as solvent) are shown (Note: the standard and sample should be diluted to absorbance <0.05 beforehand). Then, the QY of the analyte is calculated using the following formula:

[0035]

[0036] Where: Yu is the QY of the analyte; Ys is the QY of the reference substance; Fu is the integrated fluorescence intensity of the analyte; Fs is the integrated fluorescence intensity of the reference substance; Au is the absorbance of the analyte at the same excitation wavelength; As is the absorbance of the reference substance at the same excitation wavelength.

[0037] Based on the above formula, the quantum yield of DNA-Cu / AgNCs, QY, is calculated to be 58.13%.

[0038] According to relevant literature, the quantum yield of DNA-AgNCs synthesized by the same method is 11.5%. In comparison, the fluorescence quantum yield of DNA-Cu / AgNCs is significantly higher.

[0039] Example 2: Comparison of quenching efficiencies of DNA-AgNCs synthesized in Comparative Example 1, DNA-Cu / AgNCs synthesized in Example 1, and quenching material NH2-UiO-66.

[0040] like Figure 4 Fluorescence response diagrams for different concentrations (0.5-10 μM) of kanamycin were obtained, and the quenching rate was calculated as ΔF / F. 初始The fluorescence quenching rates of DNA-AgNCs and DNA-Cu / AgNCs were 45.78% and 58.96%, respectively, and the fluorescence recovery rates ΔF / F0 (14.97% and 23.61% for 1 μM kanamycin) were also obtained. It is clear that DNA-Cu / AgNCs had better quenching and recovery effects.

[0041] Example 3: Detection of kanamycin using the method described in Example 1

[0042] First, add 80.5 μL of PBS buffer (40 mmol / L, pH 7) to a centrifuge tube. Then, add 6 μL (0.5 mg / mL) of NH2-UiO-66 to the centrifuge tube and mix thoroughly with the PBS. Next, add 53.5 μL of DNA-Cu / AgNCs to the mixture. Incubate the mixture at 37°C (600 rpm) in the dark for 20 min to allow fluorescence quenching to recover to room temperature. Then, add 10 μL of kanamycin at different concentrations. After fluorescence recovery at room temperature for 2 min, measure the fluorescence of the above system using a fluorescence spectrometer and record it as F. Simultaneously, a blank control group (without kanamycin) was prepared, with all other operating conditions unchanged. Fluorescence quenching was recorded, and the fluorescence of the above system was measured using a fluorescence spectrometer and recorded as F0. The measurement results are shown below. Figure 5 The fluorescence response of kanamycin at different concentrations (0.05, 0.1, 0.5, 1, 2, 4, 8, 10, 12 μM) was observed. This embodiment utilizes a constructed aptamer fluorescence sensor for rapid kanamycin detection; the response time after adding the kanamycin target is only 2 minutes, and the entire detection system can be completed within 25 minutes.

[0043] In summary, the aptamer-based fluorescent sensor of this invention comprises a novel detection system formed by aptamer-template nanoclusters and a zirconium metal-organic framework. The DNA-Cu / AgNCs in this system, acting as the energy donor, exhibit high fluorescence, better stability, and higher quantum yield. The NH2-UiO-66, acting as the energy acceptor, possesses a three-dimensional porous structure, large specific surface area, regular pore structure, and adjustable particle size and pore size. Furthermore, it is easy to manufacture, cost-effective, highly efficient, and environmentally friendly. Moreover, the constructed aptamer-based fluorescent sensor provides rapid detection of kanamycin; after adding the kanamycin target, the response time is only 2 minutes, and the entire detection system can be completed within 25 minutes.

[0044] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A fluorescent aptamer biosensor for detecting kanamycin, characterized in that, This fluorescent aptamer biosensor synthesizes fluorescent copper-silver nanoclusters DNA-Cu / AgNCs with aptamers as templates as energy donors, and simultaneously prepares zirconium metal-organic framework NH2–UiO–66 as energy acceptor.

2. The method for preparing the fluorescent aptamer biosensor according to claim 1, characterized in that, The synthesis steps of DNA-Cu / AgNCs are as follows: First, the aptamer nanocluster sequence, i.e. DNA (Cu / AgNCs), is dissolved in PBS solution. AgNO3 and Cu(NO3)2·3H2O are added to the PBS solution containing the aptamer nanocluster sequence, and then the mixture is placed in an ice bath. After that, freshly prepared NaBH4 solution is added and shaken vigorously. The mixture of aptamer nanocluster sequence, AgNO3, Cu(NO3)2, and NaBH4 is incubated at room temperature to obtain a pale yellow DNA-Cu / AgNCs solution, which is then stored in a refrigerator at 4°C in the dark. The aptamer nanocluster sequence is: (5'-3')CCCTTAATCCCC TGGGGGTTGAGGCTAAGCCGA; The synthesis steps of NH2-UiO-66 are as follows: weigh ZrCl4 and H2ATA and dissolve them in DMF, sonicate until they are evenly dispersed, then add benzoic acid and stir until dissolved. Transfer the mixture to a polytetrafluoroethylene reactor for reaction, then remove it and cool it to room temperature overnight. Then wash it with DMF and ethanol, and then dry it overnight.

3. The method for preparing the fluorescent aptamer biosensor according to claim 2, characterized in that, In the synthesis steps of the DNA-Cu / AgNCs: the concentration of the aptamer nanocluster sequence is 100 μmol / L; the concentration of the PBS solution is 40 mmol / L and pH = 7; the concentration of AgNO3 is 1 mmol / L; (Cu(NO3)2·3H2O concentration 1 mmol / L; ice bath time 15 min; NaBH4 concentration 2 mmol / L; shaking time 1 min; incubation time 90 min.) 4. The method for preparing the fluorescent aptamer biosensor according to claim 2, characterized in that, In the synthesis steps of the DNA-Cu / AgNCs, the final concentration ratio of the aptamer nanocluster sequence, AgNO3, Cu(NO3)2, and NaBH4 is 1:3:8:

11.

5. The method for preparing the fluorescent aptamer biosensor according to claim 2, characterized in that, In the synthesis steps of NH2-UiO-66: ZrCl4 mass is 140mg; H2ATA mass is 49.25mg; DMF volume is 20mL; ultrasonication for 30min until uniform dispersion; benzoic acid mass is 366.5mg; reaction in a polytetrafluoroethylene reactor at 120℃ for 48h.

6. The application of the fluorescent aptamer biosensor for detecting kanamycin prepared according to claim 1, characterized in that, This fluorescent aptamer biosensor is used to detect kanamycin. The specific steps are as follows: First, add PBS buffer solution to a centrifuge tube, add NH2-UiO-66 to the centrifuge tube and mix thoroughly with PBS; then add DNA-Cu / AgNCs to the mixture, incubate the mixture in the dark, and after the fluorescence is quenched and returns to room temperature, add the kanamycin to be detected. The fluorescence recovers after 2 minutes at room temperature, and the fluorescence of the above system is measured using a fluorescence spectrometer.

7. The application of the fluorescent aptamer biosensor for detecting kanamycin prepared according to claim 6, characterized in that, The concentration of the PBS buffer solution was 40 mmol / L and the pH was 7. The incubation temperature was 37°C and the incubation time was 20 min under dark conditions.