Use of lmo7 inhibitors in the manufacture of a product for treating glioma
By developing a nucleic acid molecule and lentiviral vector delivery system targeting the LMO7 gene, the problem of inhibiting cell proliferation and migration in the treatment of glioma has been solved, achieving a highly efficient and low-toxicity therapeutic effect.
Patent Information
- Application Number
- CN202311372095.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-23
- Publication Date
- 2026-05-19
- Estimated Expiration
- 2043-10-23
AI Technical Summary
Current treatments for gliomas are often ineffective in inhibiting the proliferation and migration of tumor cells, and also present the problem of drug toxicity and side effects.
Using the LMO7 gene as a target, we developed LMO7 inhibitors, including nucleic acid molecules such as double-stranded RNA or shRNA, which were delivered to glioma cells via lentiviral vectors to reduce the expression of the LMO7 gene and inhibit cell proliferation and migration.
It significantly inhibits the proliferation and migration of glioma cells, reduces LMO7 gene expression, improves treatment efficiency, reduces drug toxicity and side effects, and is a high-throughput and highly reproducible procedure.
Smart Images

Figure CN117398403B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology, and in particular to the use of LMO7 inhibitors in the preparation of products for the treatment of glioma. Background Technology
[0002] Gliomas are among the most common malignant tumors with high morbidity and mortality rates, posing a serious threat to patients' health. Although the level of early diagnosis and treatment of gliomas has greatly improved, patients with advanced gliomas still face the risk of recurrence after prognosis. Therefore, the treatment of gliomas has always been a focus of medical research. Identifying the specific genes of gliomas, clarifying their expression status, and developing drug formulations targeting these specific genes are of great significance in effectively improving the treatment efficiency of gliomas and reducing the toxic side effects of drugs. Summary of the Invention
[0003] In view of the shortcomings of the prior art described above, the purpose of this invention is to provide the use of LMO7 inhibitors in the preparation of products for treating gliomas, in order to solve the problems in the prior art.
[0004] To achieve the above and other related objectives, the present invention provides the use of the human LMO7 gene as a target in the preparation of drugs for the treatment of glioma.
[0005] This invention also provides the use of LMO7 inhibitors in the preparation of products having at least one of the following characteristics:
[0006] 1) Treatment of glioma;
[0007] 2) Inhibits the proliferation rate of glioma cells;
[0008] 3) Inhibits the growth of gliomas;
[0009] 4) Inhibits the migration of glioma cells.
[0010] The present invention also provides a nucleic acid molecule that reduces the expression of the LMO7 gene in glioma cells, said nucleic acid molecule comprising double-stranded RNA or shRNA.
[0011] Furthermore, the target sequences of the double-stranded RNA or shRNA are shown in SEQ ID NO: 1, 6, and 9.
[0012] The present invention also provides an LMO7 gene interference nucleic acid construct containing a gene fragment encoding the siRNA in the aforementioned nucleic acid molecule, which can express the siRNA.
[0013] This invention also provides a method for preparing the LMO7 gene interference nucleic acid construct, the method comprising the following steps:
[0014] (1) Linearization tool lentiviral vector;
[0015] (2) Single-stranded primers are annealed to form oligo DNA;
[0016] (3) After ligating oligo DNA with a linearized lentiviral vector, the colonies were transformed;
[0017] (4) After colony PCR identification, sequencing and plasmid extraction, the LMO7 gene interference nucleic acid construct was obtained.
[0018] The present invention also provides an LMO7 gene interference lentivirus, which is prepared by viral packaging of the aforementioned LMO7 gene interference nucleic acid construct with the assistance of lentiviral helper plasmids and host cells.
[0019] The present invention also provides the use of the aforementioned nucleic acid molecule, or the aforementioned LMO7 gene interference nucleic acid construct, or the aforementioned LMO7 gene interference lentivirus, wherein the use is for preparing a drug for treating glioma, or for preparing a kit for reducing LMO7 gene expression in glioma cells.
[0020] The present invention also provides a composition for the prevention or treatment of glioma, wherein the active ingredient comprises:
[0021] The aforementioned nucleic acid molecules; and / or, the aforementioned LMO7 gene interference nucleic acid constructs; and / or, the aforementioned LMO7 gene interference lentiviruses, and pharmaceutically acceptable vectors or excipients.
[0022] As described above, the use of the LMO7 inhibitor of the present invention in the preparation of products for treating glioma has the following beneficial effects: a suitable RNAi target sequence and oligo DNA double-stranded sequence were designed for the target gene, and a lentiviral vector plasmid containing the above-mentioned oligo DNA double-stranded sequence and the final lentivirus were constructed; the resistance gene carried in the lentivirus can effectively reduce the mRNA expression level of the target gene LMO7, and the knockdown effect is very obvious, with high inhibitory efficiency on the cell proliferation and cell migration of glioma cells, which can be used in drugs for treating glioma, and the present invention can be operated at high throughput and has high reproducibility. Attached Figure Description
[0023] Figure 1 To detect the baseline expression level of the LMO7 gene in different cell types (HEB, U251, SHG-44) using real-time qPCR;
[0024] Figure 2 The expression level of the LMO7 gene in U251 cells infected with the lentiviruses of Examples 1-3 was detected using a real-time qPCR method.
[0025] Figure 3 The cell counting method was used to measure the fold change in cell growth of U251 cells from day 1 to day 5 after infection with the lentivirus of Example 3;
[0026] Figure 4 To detect the cell migration rate of U251 cells infected with the lentivirus of Example 3 using a scratch assay;
[0027] Figure 5 The number of U251 cells that migrated after 24 hours of culture following infection with the lentivirus of Example 3 was measured for Transwell assays. Detailed Implementation
[0028] This invention provides the use of the human LMO7 gene as a target in the preparation of drugs for the treatment of glioma.
[0029] The LMO7 gene is LIM domain 7, NCBI Reference Sequence: NM-001306080.2.
[0030] The use of the human LMO7 gene as a target in the preparation of glioma therapeutic drugs specifically refers to screening drugs or formulations by targeting the LMO7 gene to identify those that can inhibit human LMO7 gene expression as candidate drugs for glioma treatment. For example, the LMO7 gene lentivirus described in this invention was obtained through screening using the human LMO7 gene as a target and can be used as a drug with inhibitory effects on glioma cell proliferation. In addition, antibody drugs and other similar drugs can also target the LMO7 gene.
[0031] The glioma treatment drug is a molecule that can specifically inhibit the transcription or translation of the LMO7 gene, or specifically inhibit the expression or activity of the LMO7 protein, thereby reducing the expression level of the LMO7 gene in glioma cells and achieving the purpose of inhibiting the proliferation and migration of glioma cells.
[0032] The glioma treatment or diagnostic drugs prepared through the LMO7 gene include, but are not limited to: nucleic acid molecules, antibody drugs, peptides, proteins, or viruses.
[0033] The nucleic acids include, but are not limited to: antisense oligonucleotides, double-stranded RNA (dsRNA), ribozymes, small interfering RNA or short hairpin RNA (shRNA) prepared by ribonuclease III.
[0034] The virus is selected from lentiviruses, retroviruses, adenoviruses, or adeno-associated viruses.
[0035] The dosage of the glioma treatment drug is sufficient to reduce the transcription or translation of the human LMO7 gene, or sufficient to reduce the expression or activity of the human LMO7 protein, so as to reduce the expression of the human LMO7 gene by at least 50%, 80%, 90%, 95%, or 99%.
[0036] The aforementioned method of treating gliomas with drugs primarily aims to inhibit the proliferation or migration of glioma cells by reducing the expression level of the human LMO7 gene. Specifically, during treatment, substances that effectively reduce the expression level of the human LMO7 gene are administered to the patient.
[0037] In one embodiment, the nucleotide sequence of the target is shown in SEQ ID NO: 1, 6, and 9. Specifically, it is: TACTACTGAACTGGATGATTA (SEQ ID NO. 1).
[0038] CACTTGAGAAGTCTAAGAGAA (SEQ ID NO.6)
[0039] CAACTTCTGGAATTTACAACT (SEQ ID NO. 9).
[0040] This invention also provides the use of LMO7 inhibitors in the preparation of products having at least one of the following characteristics:
[0041] Treatment of glioma;
[0042] Inhibits the proliferation rate of glioma cells;
[0043] Inhibits the growth of gliomas;
[0044] Inhibits the migration of glioma cells.
[0045] The product must include an LMO7 inhibitor, and use the LMO7 inhibitor as the active ingredient for the aforementioned effects.
[0046] In the product, the effective ingredient that performs the aforementioned function may be only an LMO7 inhibitor, or it may contain other molecules that can perform the aforementioned function.
[0047] That is, the LMO7 inhibitor is the sole active ingredient or one of the active ingredients in the product.
[0048] The product can be a single-component substance or a multi-component substance.
[0049] There are no special restrictions on the form of the product; it can be in various forms such as solid, liquid, gel, semi-liquid, or aerosol.
[0050] The product is primarily targeted at mammals. Preferred mammals include rodents, even-toed ungulates, perissodactyls, lagomorphs, and primates. Preferred primates include monkeys, apes, or humans.
[0051] The product in question is a medicine.
[0052] The LMO7 inhibitor can be a nucleic acid molecule, antibody, or virus.
[0053] In some embodiments of the present invention, the LMO7 inhibitor may be a nucleic acid molecule that reduces LMO7 gene expression in glioma cells. Specifically, the nucleic acid molecule may be double-stranded RNA or shRNA.
[0054] In some embodiments of the present invention, the LMO7 inhibitor is a lentivirus. The target sequence of the lentivirus is shown in any one of SEQ ID NO. 1, 6, and 9.
[0055] The present invention also provides a method for treating glioma, comprising administering a therapeutically effective amount of an LMO7 inhibitor to a subject.
[0056] The object can be a mammal or glioma cells of a mammal. The mammal is preferably a rodent, even-toed ungulate, perissodactyl, lagomorph, or primate. The primate is preferably a monkey, ape, or human. The glioma cells can be isolated glioma cells.
[0057] The subject can be a patient suffering from glioma or an individual with glioma awaiting treatment. Alternatively, the subject can be ex vivo glioma cells from a patient with glioma or an individual awaiting treatment.
[0058] The LMO7 inhibitor can be administered to subjects before, during, and after treatment for glioma.
[0059] In this invention, "therapeutic effective amount" or "effective dose" refers to the dose or concentration at which a certain drug is effective in treating a disease. For example, for the lentiviruses disclosed in this invention, the therapeutic effective amount is the dose or concentration at which the lentivirus can eliminate all or part of a tumor, inhibit or slow tumor growth, inhibit the growth or proliferation of cells mediating a cancerous state, inhibit tumor cell metastasis, alleviate any symptoms or markers associated with a tumor or cancerous state, prevent or delay the development of a tumor or cancerous state, or some combination thereof.
[0060] The present invention also discloses a nucleic acid molecule that reduces the expression of the LMO7 gene in glioma cells. The nucleic acid molecule comprises double-stranded RNA or shRNA, wherein the double-stranded RNA contains a nucleotide sequence capable of hybridizing with the LMO7 gene; and the shRNA contains a nucleotide sequence capable of hybridizing with the LMO7 gene.
[0061] Furthermore, the double-stranded RNA comprises a first strand and a second strand, which are complementary to form an RNA dimer, and the sequence of the first strand is substantially identical to the target sequence in the LMO7 gene. Preferably, the nucleotide sequence encoding the first strand is shown in SEQ ID NO: 1, 6, 9.
[0062] The target sequence in the LMO7 gene is the segment in the LMO7 gene that is recognized and silenced by the nucleic acid molecule when the nucleic acid molecule is used to specifically silence the expression of the LMO7 gene.
[0063] Furthermore, the target sequences of the double-stranded RNA or shRNA are shown in SEQ ID NO: 1, 6, and 9.
[0064] Furthermore, the double-stranded RNA is a small interfering RNA (siRNA).
[0065] One strand of the double-stranded RNA, namely the first strand, is a small interfering RNA designed with the sequence shown in SEQ ID NO:1, 6 or 9 as the RNA interference target sequence and targeting the human LMO7 gene. The other strand, namely the second strand, has a sequence complementary to the first strand sequence. This siRNA can specifically silence the expression of the endogenous LMO7 gene in glioma cells.
[0066] The shRNA comprises a sense strand and an antisense strand, and a stem-loop structure connecting the sense strand and the antisense strand. The sequences of the sense strand and the antisense strand are complementary, and the sequence of the sense strand is substantially the same as the target sequence in the LMO7 gene.
[0067] The shRNA, after being processed by enzyme digestion, can become small interfering RNA (siRNA), which can then specifically silence the expression of the endogenous LMO7 gene in glioma cells.
[0068] Furthermore, the stem-loop sequence of the shRNA can be selected from any of the following: UUCAAGAGA, AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU, and CCACACC.
[0069] Furthermore, the encoding nucleotide sequence of the shRNA is shown in SEQ ID NO.2~3 or SEQ ID NO.7~8 or SEQ ID NO.10~11.
[0070] Furthermore, the LMO7 gene is derived from humans.
[0071] The present invention also provides an LMO7 gene interference nucleic acid construct containing a gene fragment encoding the siRNA in the aforementioned nucleic acid molecule, which can express the siRNA.
[0072] The LMO7 gene interference nucleic acid construct can be obtained by cloning the gene fragment encoding the aforementioned human LMO7 gene siRNA into a known vector.
[0073] Furthermore, the LMO7 gene interference nucleic acid construct is an LMO7 gene interference lentiviral vector.
[0074] The nucleotide sequences of the LMO7 gene interference nucleic acid constructs are shown in SEQ ID NO.15~17.
[0075] The LMO7 gene interference lentiviral vector disclosed in this invention is obtained by cloning a DNA fragment encoding the aforementioned LMO7 gene siRNA into a known vector. The known vector is often a lentiviral vector. After the LMO7 gene interference lentiviral vector is packaged into infectious viral particles, it infects glioma cells to obtain the siRNA, which is used to specifically silence the expression of the LMO7 gene.
[0076] Furthermore, the LMO7 gene-interfering lentiviral vector also contains a promoter sequence and / or a nucleotide sequence encoding a detectable marker in glioma cells; for example, the detectable marker is green fluorescent protein (GFP).
[0077] Furthermore, the lentiviral vector may be selected from any one of: BR-V108, pLKO.1-puro, pLKO.1-CMV-tGFP, pLenti6 / BLOCK-iT-DEST, pcDNA1.2 / V5-GW / lacZ, pLenti6.2 / N-Lumio / V5-DEST, pGCSIL-GFP, or pLenti6.2 / N-Lumio / V5-GW / lacZ.
[0078] The method for preparing the LMO7 gene interference nucleic acid construct of the present invention includes the following steps:
[0079] (1) Linearize the lentiviral vector and obtain the target gene fragment;
[0080] (2) Single-stranded primers are annealed to form oligo DNA;
[0081] (3) After ligating oligo DNA with a linearized lentiviral vector, the colonies were transformed;
[0082] (4) Colony PCR identification, sequencing, and plasmid extraction were performed to obtain the LMO7 gene interference nucleic acid construct;
[0083] In step (1), BR-V108 is selected as the tool lentiviral vector, and the sequence of the target gene fragment includes SEQ ID NO:1, 6 or 9.
[0084] In step (2), the single-stranded primer contains the following sequences: SEQ ID NO.2~3 or SEQ ID NO.7~8 or SEQ ID NO.10~11.
[0085] The primers are annealed to form oligo DNA, which contains the upstream sequence shown below: SEQ ID NO.2 or SEQ ID NO.7 or SEQ ID NO.10, and the downstream chain shown below: SEQ ID NO.3 or SEQ ID NO.8 or SEQ ID NO.11.
[0086] In the preparation step (3), the tool vector needs to be digested with enzymes at EcoRI and AgeI. After the digested tool vector and oligo DNA are reacted in the reaction system for 1-3 hours, the ligation product is transformed into competent E. coli cells for transformation.
[0087] In the colony PCR identification, the identification primer-F sequence is CCTATTTCCCATGATTCCTTCATA, and the identification primer-R sequence is GTAATACGGTTATCCACGCG.
[0088] The present invention also provides an LMO7 gene interference lentivirus, which is prepared by viral packaging of the aforementioned LMO7 gene interference nucleic acid construct with the assistance of lentiviral helper plasmids and host cells.
[0089] In some embodiments of the present invention, the lentiviral helper plasmids include pMD2.G vector plasmids (e.g., Addgene, Plasmid #12259) and pSPAX2 vector plasmids (e.g., Addgene, Plasmid #12260).
[0090] The virus packaging process is a conventional technique in the field, and this invention does not impose any particular limitations on it.
[0091] In some embodiments of the present invention, the virus packaging process is as follows:
[0092] (1) 12-18 hours before transfection, digest the host cells and adjust the cell density to approximately (4.5-6) × 10⁶. 6 / 15ml, re-seedled into a cell culture vessel and cultured. When the cell density reaches 70%–80%, it is ready for transfection;
[0093] (2) The cell culture medium was replaced with serum-free medium 2 hours before transfection;
[0094] (3) Add LMO7 gene interference nucleic acid construct and lentivirus helper plasmid solution to Opti-MEM R1 medium and let stand at room temperature; add the corresponding mass of transfection reagent to another Opti-MEM R1 medium and let stand at room temperature; gently mix the two and let stand at room temperature.
[0095] (4) Add the mixture dropwise to the host cell culture medium and culture the cells;
[0096] (5) Collect cell supernatant 48h and 72h after transfection and separate the lentivirus.
[0097] The mass ratio of the plasmids is LMO7 gene interference nucleic acid construct: pMD2.G vector plasmid: pSPAX2 vector plasmid = (8-12): (6-9): (3-7).
[0098] The host cell can be selected as a 293T cell.
[0099] This lentivirus can infect glioma cells and produce small interfering RNA targeting the LMO7 gene, thereby inhibiting the proliferation of glioma cells. This LMO7 gene-interfering lentivirus can be used to prepare drugs for the treatment of glioma.
[0100] The present invention also provides the use of the aforementioned nucleic acid molecule, or the aforementioned LMO7 gene interference nucleic acid construct, or the aforementioned LMO7 gene interference lentivirus, for the purpose of preparing a drug for treating glioma, or for preparing a kit for reducing LMO7 gene expression in glioma cells.
[0101] The object of the method can be a person.
[0102] The LMO7 gene siRNA or lentivirus of this invention can be used to inhibit the proliferation of glioma cells, and further can be used as a drug or preparation for treating glioma. When used as a drug or preparation for treating glioma, a safe and effective amount of the nucleic acid molecule is administered to a mammal. The specific dosage should also take into account factors such as the route of administration and the patient's health condition, which are all within the scope of a skilled physician's expertise.
[0103] The present invention also provides a composition for the prevention or treatment of glioma, wherein the active ingredient comprises:
[0104] The aforementioned nucleic acid molecules; and / or, the aforementioned LMO7 gene interference nucleic acid constructs; and / or, the aforementioned LMO7 gene interference lentiviruses, and pharmaceutically acceptable vectors or excipients.
[0105] "Pharmaceutical acceptable" means that when the molecular basis and the composition are properly administered to animals or humans, they do not produce adverse, allergic, or other adverse reactions.
[0106] A "pharmaceutically acceptable carrier or excipient" should be compatible with the active ingredient, meaning it can be miscible with it without significantly reducing the drug's efficacy under normal circumstances. Specific examples of substances that can serve as pharmaceutically acceptable carriers or excipients include sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium methylcellulose, ethylcellulose, and methylcellulose; tragacanth gum powder; malt; gelatin; talc; solid lubricants such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil, and cocoa butter; polyols such as propylene glycol, glycerin, sorbitol, mannitol, and polyethylene glycol; alginic acid; emulsifiers such as Tween; wetting agents such as sodium lauryl sulfate; colorants; flavoring agents; tableting agents; stabilizers; antioxidants; preservatives; pyrogen-free water; isotonic salt solutions; and phosphate buffers, etc. These substances are used as needed to help stabilize the formulation or to improve its activity or bioavailability or to produce an acceptable taste or smell when taken orally.
[0107] The composition may be a pharmaceutical composition.
[0108] When the composition is used for the prevention or treatment of glioma in a subject, an effective dose of the composition needs to be administered to the subject. Using this method, the growth, proliferation, recurrence, and / or metastasis of the glioma are inhibited. Further, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the growth, proliferation, recurrence, and / or metastasis of the glioma are inhibited.
[0109] The composition is not particularly limited in form and can be in various forms such as solid, liquid, gel, semi-fluid, or aerosol.
[0110] The composition is primarily intended for use with mammals. Preferred mammals include rodents, even-toed ungulates, perissodactyls, lagomorphs, and primates. Preferred primates include monkeys, apes, or humans.
[0111] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.
[0112] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention; in the specification and claims of the present invention, unless otherwise expressly stated in the text, the singular forms "a", "an" and "this" include the plural forms.
[0113] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.
[0114] Example 1
[0115] This embodiment provides a lentivirus for glioma, wherein the coding sequence of the RNAi target fragment of the lentivirus is: TACTACTGAACTGGATGATTA (SEQ ID NO.1).
[0116] Secondly, the above target sequences are constructed into the corresponding lentiviral vector to construct the lentiviral vector plasmid. The preparation steps include:
[0117] Select the appropriate tool vector to obtain the target gene fragment;
[0118] BR-V108 was selected as the tool vector, and its nucleotide sequence is shown in SEQ ID NO: 14:
[0119]
[0120] The core sequence of the target gene fragment is TACTACTGAACTGGATGATTA.
[0121] Synthesize single-stranded primers and oligo DNA;
[0122] In step (2), the single-stranded primer contains the following sequence:
[0123] 5'-ccggTACTACTGAACTGGATGATTActcgagTAATCATCCAGTTCAGTAGTAtttttg-3' (SEQID NO.2)
[0124] 5'-aattcaaaaaTACTACTGAACTGGATGATTActcgagTAATCATCCAGTTCAGTAGTA-3' (SEQ ID NO. 3).
[0125] The primers are annealed to form oligo DNA, which contains the following sequence:
[0126] Upstream chain: 5'-ccggTACTACTGAACTGGATGATTActcgagTAATCATCCAGTTCAGTAGTAtttttg-3' (SEQ ID NO.2);
[0127] Downstream chain: 5'-aattcaaaaaTACTACTGAACTGGATGATTActcgagTAATCATCCAGTTCAGTAGTA-3' (SEQ ID NO.3).
[0128] The annealing system was: 2.5 μL upstream chain (10 μmol / L) + 2.5 μL downstream chain (10 μmol / L) + 5 μL annealing buffer + 10 μL ultrapure water; the annealing temperature was: 95℃ for 5 min in a PCR instrument; 95℃ for 50 s, 25℃ for 3 min, for 99 cycles; and stored at 8℃.
[0129] Oligo DNA was ligated into a linearized tool vector and then transformed.
[0130] The tool vector was first digested with enzymes at EcoRI and AgeI. The digestion system consisted of 16 μL ultrapure water + 30 μL 10×CutSmart Buffer (manufacturer: NEB, component catalog number: B6004SVIAL) + 12 μL purified plasmid DNA (1 μg / μL) + 1 μL AgeI (10 U / μL) + 1 μL EcoRI (10 U / μL). The reaction was carried out at 37℃ for 3 h. After digestion, agarose gel electrophoresis was performed to recover the target fragment.
[0131] The digested tool vector and oligo DNA were reacted in a reaction system at 22°C for 1 hour. The reaction system consisted of: 50 ng of digested tool vector + 2 μL oligo DNA (100 ng / μL) + 2 μL 10×T4 DNA ligase Buffer (EL0011, ThermoFisher) + 0.5 μL T4 DNA ligase (EL0016, Fermentas) + ultrapure water (to a total volume of 20 μL).
[0132] 10 μL of ligation product was added to 100 μL of competent cells (GTC-BC-G001) and thawed on ice. The cells were then placed on ice for 1 min. The cells were then heat-shocked in a 42°C water bath for 40 s and placed on ice for 2 min. 200 µL of antibiotic-free LB liquid medium was added and the cells were shaken at 37°C at 200 rpm for 1 h. 150 µL of the bacterial culture was then evenly spread on LB solid medium containing ampicillin (Amp) resistance and incubated at 37°C for 14 h.
[0133] (4) Colony PCR identification, sequencing, and plasmid extraction;
[0134] In the colony PCR identification, the sequence of primer-F was CCTATTTCCCATGATTCCTTCATA (SEQ ID NO. 4), and the sequence of primer-R was GTAATACGGTTATCCACGCG (SEQ ID NO. 5). The PCR reaction system was: 10 μl 2×Hieff UNICON® HotStart PCR Master Mix (With Dye) (manufacturer: Yisheng, product number: 10732ES03) + 0.4 μl primer-F + 0.4 μl primer-R + ultrapure water (to a total volume of 20 μl). The PCR amplification conditions were: 94℃ for 3 min; 94℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, 22 cycles; 72℃ for 5 min. After PCR, 5 μl of product was taken and the bands were detected by 1% agarose gel electrophoresis (for electrophoresis loading: the blank control used ultrapure water as a template; the negative control used an empty vector without the target gene inserted as a template).
[0135] The identified positive clone transformants were inoculated into LB liquid medium containing the corresponding antibiotics and cultured at 37°C for 14 hours. After colony PCR identification, the samples were sent for sequencing.
[0136] The correctly sequenced bacterial culture was transferred to 150 ml of LB liquid medium containing Amp resistance and cultured overnight at 37°C with shaking. The bacterial culture was then collected, and plasmids were extracted using the Tiangen endotoxin-free plasmid extraction kit.
[0137] 1. Cell enrichment: Take 10 mL of bacterial suspension, centrifuge at 8000 rpm for 4 min, and collect the bacterial cells; 2. Bacterial lysis: Resuspend the bacterial cells in 1 mL of GP1 Buffer and transfer to a 2.0 mL centrifuge tube; 3. Termination of lysis: Add 0.5 mL of GP2 Buffer, gently invert to mix, let stand for 1 min, and centrifuge at 12000 rpm for 1 min; Take 0.7 mL of the supernatant from the previous step and add it to the activated adsorption column GP, centrifuge at 3000 rpm for 1 min; Remove the waste liquid in the collection tube; 4. Washing: Add 0.5 mL of GPW Buffer, centrifuge at 12000 rpm for 1 min; 5. Recovery: Replace the collection tube, add 0.2 mL of GP3 Buffer to the adsorption column, let stand for 1 min, and centrifuge at 12000 rpm for 1 min; 6. Stabilization: Place the centrifuge tube containing the recovery solution in a 37℃ incubator for 15 min.
[0138] The nucleotide sequence of the lentiviral vector plasmid is shown in SEQ ID NO.15:
[0139]
[0140] The lentivirus was prepared by co-transfecting 293T cells with the aforementioned lentiviral vector plasmid, psPAX2 vector plasmid, and pMD2.G vector plasmid.
[0141] The preparation steps of the lentivirus are as follows: (1) 24 hours before transfection, 293T cells (ATCC ACS-4500) in logarithmic growth phase are digested with trypsin, and the cell density is adjusted to about 5×10⁻⁶ cells with medium containing 10% FBS. 6 Re-seed 15 mL of the solution into 10 cm cell culture dishes and incubate at 37°C with 5% CO2. The cells are ready for transfection when the confluence reaches 70%–80%.
[0142] (2) The cell culture medium was replaced with serum-free medium 2 hours before transfection;
[0143] (3) Add DNA solution (10 μg lentiviral vector plasmid, 7.5 μg pMD2.G vector plasmid, and 5 μg pSPAX2 vector plasmid) to 500 μL Opti-MEM R1 medium and let stand at room temperature for 5 min; add the corresponding mass of Iberia transfection reagent DYB3893 to another 500 μL Opti-MEM R1 medium and let stand at room temperature for 5 min; gently mix the two and let stand at room temperature for 20 min.
[0144] (4) Add the mixture to the 293T cell culture medium, mix gently, and place in a 37℃, 5% CO2 cell culture incubator for 6 hours. Replace with 10 mL of 10% FBS medium and continue culturing in a 37℃, 5% CO2 incubator for 60 hours.
[0145] (5) Collect cell supernatant 48h and 72h after transfection and separate to obtain lentivirus.
[0146] Example 2
[0147] This embodiment provides a lentivirus for glioma, wherein the RNAi target sequence of the lentivirus has the following fragment coding sequence: CACTTGAGAAGTCTAAGAGAA (SEQ ID NO.6).
[0148] Secondly, the above target sequences are constructed into the corresponding lentiviral vector to construct the lentiviral vector plasmid. The preparation steps include:
[0149] (1) Select a tool vector to obtain the target gene fragment;
[0150] BR-V108 was selected as the tool vector, and the core sequence of the target gene fragment is CACTTGAGAAGTCTAAGAGAA.
[0151] (2) Synthesize single-stranded primers and oligo DNA;
[0152] In step (2), the single-stranded primer contains the following sequence:
[0153] 5'-ccggCACTTGAGAAGTCTAAGAGAActcgagTTCTCTTAGACTTCTCAAGTGtttttg-3' (SEQID NO.7)
[0154] 5'-aattcaaaaaCACTTGAGAAGTCTAAGAGAActcgagTTCTCTTAGACTTCTCAAGTG-3' (SEQ ID NO. 8).
[0155] The primers are annealed to form oligo DNA, which contains the following sequence:
[0156] Upstream chain: 5'-ccggCACTTGAGAAGTCTAAGAGAActcgagTTCTCTTAGACTTCTCAAGTGtttttg-3' (SEQ ID NO.7);
[0157] Downstream chain: 5'-aattcaaaaaCACTTGAGAAGTCTAAGAGAActcgagTTCTCTTAGACTTCTCAAGTG-3' (SEQ ID NO.8).
[0158] The annealing system is the same as in Example 1.
[0159] (3) The oligo DNA was ligated to a linearized tool vector and then transformed;
[0160] The tool vector was first digested with enzymes at EcoRI and AgeI. The digestion system consisted of 255 μL ultrapure water, 30 μL 10×CutSmart Buffer, 12 μL purified plasmid DNA (1 μg / μL), 1 μL AgeI (10 U / μL), and 1 μL EcoRI (10 U / μL). The reaction was carried out at 37℃ for 2 h. After digestion, agarose gel electrophoresis was performed to recover the target fragment.
[0161] The enzyme-digested vector and oligo DNA were reacted in a reaction system at 16°C for 3 hours. The reaction system consisted of: 1 μL Linearized Vector (100 ng / μL) + 1 μL Insert (100 ng / μL) + 2 μL 10×T4 DNA ligase Buffer + 1 μL T4 DNA ligase + ultrapure water (to a final volume of 20 μL).
[0162] Thaw TOP10 competent cells on ice, add 20 μL of ligation product to 200 μL of competent cells, and place on ice for 1 min; heat shock in a 42℃ water bath for 40 s, and place on ice for 5 min; add 200 µL of antibiotic-free LB liquid medium, and shake in a 37℃ incubator at 200 rpm for 1 h; take 150 µL of bacterial culture and spread it evenly on LB solid medium containing Amp resistance, and incubate in a 37℃ incubator for 24 h.
[0163] (4) Colony PCR identification, sequencing, and plasmid extraction;
[0164] In the colony PCR identification, the sequence of primer-F was CCTATTTCCCATGATTCCTTCATA (SEQ ID NO. 4), and the sequence of primer-R was GTAATACGGTTATCCACGCG (SEQ ID NO. 5). The PCR reaction system was: 0.2 μL Taq Plus DNA Polymerase + 2 μL 10× Buffer + 0.4 μL primer-F + 0.4 μL primer-R + ultrapure water (to a total volume of 20 μL). The PCR amplification conditions were: 94℃ for 3 min; 94℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, 22 cycles; 72℃ for 5 min. After PCR, 5 μL of product was taken and the bands were detected by 1% agarose gel electrophoresis (electrophoresis loading: blank control: ultrapure water as template; negative control: empty vector without inserted target gene as template).
[0165] The identified positive clone transformants were inoculated into LB liquid medium containing the corresponding antibiotics and cultured at 37°C for 14 hours. After colony PCR identification, the samples were sent for sequencing.
[0166] The correctly sequenced bacterial culture was transferred to 150 ml of LB liquid medium containing Amp resistance and cultured overnight at 37°C with shaking. The bacterial culture was collected and plasmids were extracted using the Tiangen endotoxin-free plasmid extraction kit (steps as in Example 1). The nucleotide sequence of the lentiviral vector plasmid is shown in SEQ ID NO.16.
[0167]
[0168] The lentivirus was prepared by co-transfecting 293T cells with the aforementioned lentiviral vector plasmid, psPAX2 vector plasmid, and pMD2.G vector plasmid.
[0169] The preparation steps of the lentivirus are as follows: (1) 18 hours before transfection, 293T cells in logarithmic growth phase are digested with trypsin and the cell density is adjusted to about 4.5 × 10⁻⁶ cells with medium containing 10% FBS. 6 Re-seed 15 mL of the solution into 10 cm cell culture dishes and incubate at 37°C with 5% CO2. The cells are ready for transfection when the confluence reaches 80%.
[0170] (2) The cell culture medium was replaced with serum-free medium 2 hours before transfection;
[0171] (3) Add DNA solution (12 μg lentiviral vector plasmid, 9 μg pMD2.G vector plasmid, and 7 μg pSPAX2 vector plasmid) to 500 μL Opti-MEM R1 medium and let stand at room temperature for 5 min; add the corresponding mass of Eberspächer transfection reagent DYB3893 to another 500 μL Opti-MEM R1 medium and let stand at room temperature for 5 min; gently mix the two and let stand at room temperature for 20 min.
[0172] (4) Add the mixture to the 293T cell culture medium, mix gently, and place in a 37℃, 5% CO2 cell culture incubator for 6 hours. Replace with 10 mL of 10% FBS medium and continue culturing in a 37℃, 5% CO2 incubator for 60 hours.
[0173] (5) Collect cell supernatant 48h and 72h after transfection and separate to obtain lentivirus.
[0174] Example 3
[0175] This embodiment provides a lentivirus for glioma, wherein the RNAi target sequence of the lentivirus has the following fragment coding sequence: CAACTTCTGGAATTTACAACT (SEQ ID NO.9).
[0176] Secondly, the above target sequences are constructed into the corresponding lentiviral vector to construct the lentiviral vector plasmid. The preparation steps include:
[0177] (1) Select a tool vector to obtain the target gene fragment;
[0178] BR-V108 was selected as the tool vector, and the core sequence of the target gene fragment is CAACTTCTGGAATTTACAACT.
[0179] (2) Synthesize single-stranded primers and oligo DNA;
[0180] In step (2), the single-stranded primer contains the following sequence:
[0181] 5'-ccggCAACTTCTGGAATTTACAACTctcgagAGTTGTAAATTCCAGAAGTTGtttttg-3' (SEQ ID NO.10)
[0182] 5'-aattcaaaaaCAACTTCTGGAATTTACAACTctcgagAGTTGTAAATTCCAGAAGTTG-3' (SEQ ID NO. 11).
[0183] The primers are annealed to form oligo DNA, which contains the following sequence:
[0184] Upstream chain: 5'-ccggCAACTTCTGGAATTTACAACTctcgagAGTTGTAAATTCCAGAAGTTGtttttg-3' (SEQ ID NO.10);
[0185] Downstream chain: 5'-aattcaaaaaCAACTTCTGGAATTTACAACTctcgagAGTTGTAAATTCCAGAAGTTG-3' (SEQ ID NO.11).
[0186] The annealing system is the same as in Example 1.
[0187] (3) The oligo DNA was ligated to a linearized tool vector and then transformed;
[0188] The tool vector was first digested with enzymes at EcoRI and AgeI. The digestion system consisted of 255 μL ultrapure water, 30 μL 10×CutSmart Buffer, 12 μL purified plasmid DNA (1 μg / μL), 1 μL AgeI (10 U / μL), and 1 μL EcoRI (10 U / μL). The reaction was carried out at 37℃ for 2 h. After digestion, agarose gel electrophoresis was performed to recover the target fragment.
[0189] The enzyme-digested vector plasmid and oligo DNA were reacted in a reaction system at 16℃ for 1 h. The reaction system was: 1 μL Linearized Vector (100 ng / μL) + 1 μL Insert (100 ng / μL) + 2 μL 10×T4 DNA ligase Buffer + 1 μL T4 DNA ligase + ultrapure water (to a total volume of 20 μL).
[0190] Thaw TOP10 competent cells on ice, add 20 μL of ligation product to 200 μL of competent cells, and place on ice for 1 min; heat shock in a 42℃ water bath for 40 s, and place on ice for 2 min; add 200 µL of antibiotic-free LB liquid medium, and shake in a shaker at 37℃ at 200 rpm for 45 min; take 150 µL of bacterial culture and spread it evenly on LB solid medium containing Amp resistance, and incubate in a 37℃ incubator for 12 h.
[0191] (4) Colony PCR identification, sequencing, and plasmid extraction;
[0192] In the colony PCR identification, the sequence of primer-F was CCTATTTCCCATGATTCCTTCATA (SEQ ID NO. 4), and the sequence of primer-R was GTAATACGGTTATCCACGCG (SEQ ID NO. 5). The PCR reaction system was: 0.2 μL Taq Plus DNA Polymerase + 2 μL 10× Buffer + 0.4 μL primer-F + 0.4 μL primer-R + ultrapure water (to a total volume of 20 μL). The PCR amplification conditions were: 94℃ for 3 min; 94℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, 22 cycles; 72℃ for 5 min. After PCR, 5 μL of product was taken and the bands were detected by 1% agarose gel electrophoresis (electrophoresis loading: blank control: ultrapure water as template; negative control: empty vector without inserted target gene as template).
[0193] The identified positive clone transformants were inoculated into LB liquid medium containing the corresponding antibiotics and cultured at 37°C for 14 hours. After colony PCR identification, the samples were sent for sequencing.
[0194] The correctly sequenced bacterial culture was transferred to 150 ml of LB liquid medium containing Amp resistance and cultured overnight at 37°C with shaking. The bacterial culture was collected and plasmids were extracted using the Tiangen endotoxin-free plasmid extraction kit (steps as in Example 1). The nucleotide sequence of the lentiviral vector plasmid is shown in SEQ ID NO.17.
[0195]
[0196] The lentivirus was prepared by co-transfecting 293T cells with the aforementioned lentiviral vector plasmid, psPAX2 vector plasmid, and pMD2.G vector plasmid.
[0197] The preparation steps of the lentivirus are as follows:
[0198] (1) 12 hours before transfection, 293T cells in logarithmic growth phase were digested with trypsin and the cell density was adjusted to approximately 6 × 10⁶ cells / year using medium containing 10% FBS. 6 Re-seed 15 mL of the solution into 10 cm cell culture dishes and incubate at 37°C with 5% CO2. The cells are ready for transfection when the confluence reaches 70%.
[0199] (2) The cell culture medium was replaced with serum-free medium 2 hours before transfection;
[0200] (3) Add DNA solution (10 μg lentiviral vector plasmid, 8 μg pMD2.G vector plasmid, and 6 μg pSPAX2 vector plasmid) to 500 μL Opti-MEM R1 medium and let stand at room temperature for 5 min; add the corresponding mass of Iberia transfection reagent DYB3893 to another 500 μL Opti-MEM R1 medium and let stand at room temperature for 5 min; gently mix the two and let stand at room temperature for 20 min.
[0201] (4) Add the mixture to the 293T cell culture medium, mix gently, and place in a 37℃, 5% CO2 cell culture incubator for 6 hours. Replace with 10 mL of 10% FBS medium and continue culturing in a 37℃, 5% CO2 incubator for 48 hours.
[0202] (5) Collect cell supernatant 48h and 72h after transfection and separate to obtain lentivirus.
[0203] The following examples demonstrate the performance testing of the lentiviruses obtained in Examples 1-3. Here, shCtrl represents the normal target cell group infected with the negative control lentivirus (control group); shLMO7-1, shLMO7-2, and shLMO7-3 correspond to the normal target cell groups infected with the RNAi lentiviruses in Examples 1-3 (experimental groups), respectively. The preparation method for the control group is the same as that for the experimental group, except that the target sequence for the control is shown in SEQ ID NO: 18.
[0204] tTCTCCGAACGTGTCACGT (SEQ ID NO: 18);
[0205] The forward sequence of the single-stranded primer is shown in SEQ ID NO: 19: ccggtTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTTg (SEQ ID NO: 19)
[0206] The reverse strand sequence of the single-stranded primer is shown in SEQ ID NO: 20: AATTCCAAAAATTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAA (SEQ ID NO: 20).
[0207] Example 4: Real-time qPCR detection of the expression level of the target gene LMO7
[0208] First, the LMO7 expression level in the three cell lines before lentivirus infection was detected: After total RNA extraction using the Trizol method from Sigma, 4X gDNA wiper mix and 1.0 μg total RNA were added to a PCR tube, RNase-free H2O was added to 8 μL, and the mixture was centrifuged and incubated at 42℃ for 2 min; 5X qPCR supermix was added, and reverse transcription was performed at 55℃ for 15 min and 85℃ for 2 min; the obtained cDNA was stored at -80℃ for later use. The real-time qPCR reaction system was as follows: 5.0 μL L YBR Green master mixes + 0.25 μL upstream primer (10 μmol / L, sequence AGAAAAGAGGTAGCAGCAACAGA (SEQ ID NO.12)) + 0.25 μL downstream primer (10 μmol / L, sequence GGAAGACAATGTGGCTTTAGAAG (SEQ ID NO.13)) + 0.2 μL Dye2 (Qihengxing, FS-Q1001) + 2.3 μL L Nase-Free H2O; [The reaction mixture was subjected to 2...] -△△Ct The expression level of mRNA was analyzed using a method; the expression results of the LMO7 gene in different cells are shown in [the table below]. Figure 1 .from Figure 1 The results show that the LMO7 gene has a high background expression level in different glioma cells.
[0209] The following steps were followed to infect cells with lentivirus: U251 cells were passaged and cultured. Cells in the logarithmic growth phase were trypsinized to prepare a cell suspension. An appropriate amount of the cell suspension was seeded into 96-well culture media and cultured at 37°C in a 5% CO2 incubator until cell confluence reached approximately 70%. Based on the cell MOI value, the prepared virus was added. Cell status was observed after 12 hours, and the culture medium was changed. Two to three days after infection, for viruses carrying the GFP reporter gene, the GFP fluorescence intensity was observed using a fluorescence microscope. For viruses carrying the Puromycin resistance gene, the medium was replaced with complete culture medium containing an appropriate concentration of Puromycin to screen for stable expression cell lines. Total RNA was extracted and detected using the aforementioned method. The effects of the lentiviruses prepared in Examples 1-3 on LMO7 expression in U251 cells are shown in the table below. Figure 2 ;
[0210] from Figure 2 The results showed that in U251 cells, after infection with lentivirus, compared with the shCtrl group, the LMO7 gene knockdown efficiency of Example 1 (shLMO7-1 group) reached 67.9% (p<0.05); the LMO7 gene knockdown efficiency of Example 2 (shLMO7-2 group) reached 92.3% (p<0.05); and the LMO7 gene knockdown efficiency of Example 3 (shLMO7-3 group) reached 97.9% (p<0.05).
[0211] Example 6: Scratch assay to determine cell migration rate
[0212] U251 cells in the logarithmic growth phase (including the shCtrl and shLMO7 groups) were trypsinized, resuspended in complete culture medium, and counted. The cell density for plating was determined based on cell size (set to 2000 cells / well). Cells were incubated at 37°C in a 5% CO2 incubator, with three replicates per group and a culture volume of 100 μL / well, ensuring a consistent number of cells per well. Celigo assays were performed daily for 5 consecutive days, starting the second day. The number of cells exhibiting green fluorescence in each scan was accurately calculated by adjusting the input parameters in the analysis settings. The data were statistically analyzed and plotted to generate a 5-day cell proliferation curve. The fold change in cell number over time between Example 3 and the control group 5 days after lentivir infection of the target cells is shown in the figure. Figure 3 The results showed that, after lentiviral infection, compared with the shCtrl group, the cell proliferation of the shLMO7 group in Example 3 was significantly inhibited, with a fold change of -5.2 (p<0.05).
[0213] U251 cells in the logarithmic growth phase (including the shCtrl and shLMO7 groups) were trypsinized and resuspended in complete culture medium to form a cell suspension. Cell counts were performed. The cell density for plating was determined based on cell size (50,000 cells / well), with a target of over 90% confluence the following day. Cells were incubated at 37°C in a 5% CO2 incubator, with three replicates per group and a culture volume of 100 μL / well. On the second day, the medium was replaced with low-concentration serum. Using a scratching device, a scratch was created by gently pushing upwards from the center of the bottom of the 96-well plate. The cells were gently rinsed twice with serum-free medium, and then low-concentration serum medium (0.5% FBS) was added. The plates were photographed at 0 h. Cells were then incubated at 37°C in a 5% CO2 incubator. Depending on the healing progress, the plates were scanned using Cellomics, and the migration area was analyzed using Cellomics. The test results for Example 3 are shown below. Figure 4 .from Figure 4 The results showed that after lentiviral infection, compared with the shCtrl group, the cell migration rate of the shLMO7 group in Example 3 decreased by 64% after 8 hours (p<0.05).
[0214] Example 7 Cell Transwell Assay
[0215] (1) Take the required number of chambers into an empty 24-well plate, add 100µL of serum-free culture medium into the chamber, and incubate for 1~2 hours;
[0216] (2) Preparation of cell suspension: U251 cells in the logarithmic growth phase of each group (including shCtrl group and shLMO7 group) were digested with trypsin and resuspended in low serum medium to prepare cell suspension; cell counting was performed on the cell suspension using a hemocytometer.
[0217] (3) After step (1) is completed, carefully remove the culture medium from the small chamber, add 600µL of culture medium containing 30% FBS to the lower chamber, dilute the cells with serum-free culture medium at a certain ratio, and add 100µL of the cell suspension (containing 100,000~200,000 cells) to each small chamber; use forceps to transfer the small chamber into the lower chamber containing 30% FBS culture medium, incubate in a tissue culture incubator for 16h, invert the small chamber on absorbent paper to remove the culture medium, gently remove the non-transferred cells with a cotton swab, add 400µL of staining solution to the wells of the 24-well plate, immerse the small chamber in the staining solution for 5min, stain the transferred cells on the lower surface of the membrane, immerse the small chamber in a large water cup, rinse several times, air dry, and photograph the membrane under a microscope. The comparison of the number of transferred cells between the experimental group and the control group after incubation in the Transwell small chamber for 16h in Example 3 is shown in the figure. Figure 5 .from Figure 5The results showed that after lentivirus infection, the Transwell transfer rate in Example 3, i.e., the shLMO7 group, was reduced by 82% compared to the shCtrl group (p<0.05).
[0218] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications and variations of the methods listed herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention.
Claims
1. Use of LMO7 inhibitors in the preparation of products for treating glioma, wherein the products for treating glioma have any of the following effects: 1) Inhibits the proliferation rate of glioma cells; 2) Inhibits the migration of glioma cells; The target sequence of the LMO7 inhibitor is shown in SEQ ID NO. 9; the LMO7 inhibitor is siRNA or shRNA; the siRNA comprises a first strand and a second strand, the first strand and the second strand being complementary to form an RNA dimer, and the nucleotide sequence encoding the first strand in the siRNA is shown in SEQ ID NO. 9; the nucleotide sequence encoding the shRNA is shown in SEQ ID NO. 10~11.
2. The use of a nucleic acid molecule that reduces LMO7 gene expression in glioma cells in the preparation of products for treating glioma, characterized in that, The nucleic acid molecule comprises double-stranded RNA or shRNA, wherein the double-stranded RNA contains a nucleotide sequence capable of hybridizing with the LMO7 gene, the double-stranded RNA comprises a first strand and a second strand, the first strand and the second strand are complementary to form an RNA dimer, and the sequence of the first strand is identical to the target sequence in the LMO7 gene; the shRNA contains a nucleotide sequence capable of hybridizing with the LMO7 gene, the shRNA comprises a sense strand fragment and an antisense strand fragment, and a stem-loop structure connecting the sense strand fragment and the antisense strand fragment, the sequences of the sense strand fragment and the antisense strand fragment are complementary, and the sequence of the sense strand fragment is identical to the target sequence in the LMO7 gene; The target sequence of the double-stranded RNA or shRNA is shown in SEQ ID NO. 9; The double-stranded RNA is siRNA; The nucleotide sequence encoding the first strand in the double-stranded RNA is shown in SEQ ID NO. 9, or the nucleotide sequence encoding the shRNA is shown in SEQ ID NO. 10~11.
3. The use of an LMO7 gene interference nucleic acid construct in the preparation of products for treating glioma, characterized in that, The LMO7 gene interference nucleic acid construct contains a gene fragment encoding the siRNA in the nucleic acid molecule of claim 2, and is capable of expressing the siRNA.
4. The use according to claim 3, characterized in that, The nucleotide sequence of the LMO7 gene interference nucleic acid construct is shown in SEQ ID NO.
17.
5. The use according to claim 3 or 4, characterized in that, The method for preparing the LMO7 gene interference nucleic acid construct includes the following steps: (1) Linearization tool lentiviral vector; (2) Single-stranded primers are annealed to form oligo DNA, and the single-stranded primers contain sequences as shown in SEQ ID NO. 10~11; (3) After ligating oligo DNA with a linearized lentiviral vector, the colonies were transformed; (4) After colony PCR identification, sequencing, and plasmid extraction, the LMO7 gene interference nucleic acid construct was obtained.
6. The use according to claim 5, characterized in that, The method for preparing the LMO7 gene interference nucleic acid construct further includes any one or more of the following features: A) In step (1), the tool lentivirus vector is BR-V108; B) The oligo DNA comprises an upstream chain as shown in SEQ ID NO. 10 and a downstream chain as shown in SEQ ID NO.
11.
7. The use of an LMO7 gene-interfering lentivirus in the preparation of products for treating glioma, characterized in that, The LMO7 gene interference lentivirus is prepared by viral packaging of the LMO7 gene interference nucleic acid construct as described in claim 3 or 4 with the assistance of lentiviral helper plasmids and host cells.