Use of nerve growth factor-inducible protein or gene thereof
By overexpressing the nerve growth factor-induced protein gene through a lentiviral vector, oligodendrocyte regeneration was promoted, which solved the problem of insufficient motor function recovery in patients with spinal cord injury and achieved significant improvement in motor function.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-07-11
- Publication Date
- 2026-06-02
AI Technical Summary
In current technologies, the effects of nerve regeneration and functional recovery on patients with spinal cord injuries are limited, and there is a lack of effective treatment methods.
The nerve growth factor-inducible protein gene was overexpressed using a lentiviral vector, and the VGF gene was integrated into the host chromosome via the lentiviral vector to promote the regeneration of oligodendrocytes.
It significantly improves motor function recovery in animal models of spinal cord injury, promotes the expression of VGF and MBP proteins at the site of spinal cord injury, and enhances the motor function recovery effect in patients with spinal cord injury.
Smart Images

Figure CN115845030B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, and in particular to the application of nerve growth factor-induced protein or its gene. Background Technology
[0002] Spinal cord injury is a severe injury to the central nervous system, leading to impaired sensory and motor function and imposing a heavy burden on patients' families and society. In clinical practice, surgery or rehabilitation training have limited efficacy for spinal cord injury patients and cannot effectively promote nerve regeneration and functional recovery. Gene editing, as a therapeutic approach, shows promising potential in spinal cord injury repair.
[0003] The neuroendocrine regulatory peptide VGF (neuro-inducible nerve growth factor) was first discovered during the rapid induction of nerve growth factor in PC12 cells. VGF is widely expressed in various neural tissues, with the highest VGF mRNA expression level in the human hypothalamus. In addition, VGF is also highly expressed in the medial and lateral frontal gyri and many neuroendocrine tissues, including the pituitary gland and various gastrointestinal and pancreatic neuroendocrine cells. VGF is involved in various physiological processes, such as food intake and energy balance, water and electrolyte balance, reproduction, pain, tumors, learning, and memory. VGF is also closely related to the pathogenesis of depression, Parkinson's disease (PD), Alzheimer's disease (AD), and other neurological disorders.
[0004] Lentivirals are a type of retrovirus with a single-stranded RNA genome. Recombinant lentiviral vectors are tool vectors developed based on HIV-1 (human immunodeficiency virus type 1) and utilizing the VSVG coat protein of herpesviruses. Lentivirals can effectively integrate foreign genes into the host chromosome, achieving persistent expression. Lentivirals can effectively infect various cell types, including nerve cells, and possess advantages such as long expression duration, high safety, and low immunogenicity, providing a powerful gene manipulation tool for scientific research and clinical treatment.
[0005] To date, there have been no reports on the role of VGF in spinal cord injury, nor have there been any reports on the application of VGF overexpression using lentiviral vectors for spinal cord injury repair. Summary of the Invention
[0006] The purpose of this invention is to address the shortcomings of the prior art by providing the application of nerve growth factor-induced protein or its gene.
[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0008] The first aspect of the present invention is to provide the use of nerve growth factor-inducing protein or its gene in the preparation of a medicament for treating spinal cord injury.
[0009] A second aspect of the present invention is to provide a lentivirus that overexpresses the nerve growth factor-inducible protein gene for the treatment of spinal cord injury, or for the preparation of a medicament for the treatment of spinal cord injury.
[0010] A third aspect of the present invention is to provide a method for preparing a lentivirus as described above, comprising the steps of:
[0011] After PCR amplification of the nerve growth factor-induced protein gene, the PCR amplification product was cloned into the CSII-EF plasmid. The cloned product CSII-EF-VGF, along with psPAX and pMD2.G, was transfected into wild-type 293T cells. After a period of time, cell debris removal, viral precipitation, resuspension, and identification were performed sequentially to obtain the lentivirus.
[0012] Preferably, the nucleotide sequence of the forward primer in the PCR amplification is shown in SEQ ID NO: 3; and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 4.
[0013] Preferably, the cell debris removal includes: collecting the culture medium containing the lentivirus, centrifuging it, taking the supernatant, and filtering it to remove cell debris.
[0014] Preferably, the resuspension includes: collecting the precipitated virus and stirring and incubating it at 4°C for 45 min, centrifuging it, and then resuspending it in a culture medium.
[0015] Preferably, the identification includes determining the titer of the lentivirus.
[0016] The present invention adopts the above technical solution and has the following technical effects compared with the prior art:
[0017] This invention demonstrates through cell and animal experiments that lentiviruses overexpressing the nerve growth factor-induced protein gene can promote the regeneration of oligodendrocytes, thereby effectively improving the recovery of motor function in animal models of spinal cord injury. Attached Figure Description
[0018] Figure 1 To detect the expression level of VGF after overexpression of different doses of lentivirus in oligodendrocyte precursor cells by qPCR;
[0019] Figure 2 Figure A shows the use of 10 8 Immunofluorescence staining of mature oligodendrocyte marker MBP (green) after TU / mL lentivirus treatment; cell nuclei were labeled with DAPI (blue); scale bar, 10 μm;
[0020] Figure 2 Figure B in the middle shows the quantitative analysis of the average dendrite length of cells among different groups;
[0021] Figure 3 Figure A shows the BMS behavioral scores of mice with spinal cord injury treated with lentivirus for 8 weeks.
[0022] Figure 3 Figure B in the middle shows the expression of proteins such as VGF, MBP, and OLIG2 at the site of spinal cord injury in mice treated with VGF lentivirus via immunoblotting.
[0023] Figure 4 Immunofluorescence staining of the spinal cord for VGF and MBP in different treatment groups; scale bar, 1000 μm; and magnified images of the spinal cord injury sites; scale bar, 100 μm. Detailed Implementation
[0024] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0025] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other.
[0026] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but this is not intended to limit the scope of the invention.
[0027] Example 1
[0028] VGF[Homo sapiens]NCBI Reference Sequence:NP_003369.2:
[0029]
[0030]
[0031] BLAST results showed that the protein sequence of human VGF had 84% homology and 88% similarity to the protein sequence of mouse VGF, indicating that the VGF sequence is relatively conserved and highly similar between humans and mice. Therefore, mouse experiments were used to verify its therapeutic effect.
[0032] Example 2
[0033] The full-length coding sequence of the nerve growth factor-induced protein gene was obtained by PCR amplification using cDNA from the brain of mice (mus musculus, female C57BL / 6, Shanghai Slack Laboratory Animal Co., Ltd.) as a template and Platinum SuperFi II DNA amplification kit (Thermo Fisher Scientific, catalog number 12361010). The forward primer was CGGAATTCTGGCAGCCCGTTGGTCAT (SEQ ID NO: 3), and the reverse primer was GTTAACCTGAGAGGGAGGAGGAGCGACA (SEQ ID NO: 4).
[0034] The PCR amplification products were digested with restriction endonuclease EcoRI (New England Biolabs, catalog number R0101S) and restriction endonuclease HpaI (New England Biolabs, catalog number R0105S), and then cloned into the CSII-EF plasmid (Addgene, catalog number 80007) using Anza T4 DNA ligase (Thermo Fisher Scientific, catalog number IVGN2108).
[0035] The cloned product CSII-EF-VGF was co-transfected into wild-type 293T cells (Chinese Academy of Sciences Cell Bank, catalog number SCSP-502) using Lipofectamine 3000 reagent (Thermo Fisher Scientific, catalog number L3000015), lentiviral packaging vector psPAX (Addgene, catalog number 12260), and pMD2.G (Addgene, catalog number 12259).
[0036] 24 and 52 hours after transfection, the culture medium containing lentiviral particles was collected, centrifuged at 3000g for 10 minutes, and the supernatant was filtered through a 0.45μm filter to remove cell debris. 5× lentiviral precipitation buffer (Beijing TransGen Biotech, catalog number FV101-01) was added to precipitate the virus, and the mixture was stirred and incubated at 4℃ for 45 minutes. After centrifugation at 7000g for 45 minutes, the virus particles were resuspended in DMEM / F12 medium (Thermo Fisher Scientific, catalog number A4192001), and the virus titer was determined before aliquoting and storage at -80℃.
[0037] Example 3
[0038] Oligodendrocyte precursor cells were isolated from day 1 newborn rat pups (Rattus norvegicus, female Sprague Dawley, Shanghai Silex Laboratory Animal Co., Ltd.). First, cortical tissue was rapidly removed and divided into small pieces, then digested with papain (Worthington, LS003126) solution in a 37°C water bath. After digestion, the cell suspension was neutralized with fresh culture medium, filtered through a 100 μm cell filter, and centrifuged at 1000 rpm for 5 minutes. The precipitate was resuspended in DMEM / F12 medium containing 10% fetal bovine serum (Thermo Fisher Scientific, 16000044) and 1× penicillin antibiotics, and placed in cell culture flasks. After 4–7 days of culture, the cells were digested and then purified using differential adhesion to remove microglia, collecting non-adherent oligodendrocyte precursor cells. The cells were then cultured at 1×10⁻⁶. 5 The oligodendrocyte precursor cells were seeded into 12-well plates at a density of / wells, and differentiation culture medium was added to promote the differentiation of oligodendrocyte precursor cells into oligodendrocytes. Differentiation lasted for 7 days.
[0039] Culture media containing different concentrations of lentivirus were prepared, with concentrations of 10... 4 TU / mL, 10 6 TU / mL and 10 8 TU / mL, different concentrations of lentivirus were added for treatment on day 3 of cell differentiation, and cells were collected on day 7 and total RNA was extracted. cDNA was obtained by reverse PCR, and the expression of VGF gene was detected by qPCR. Figure 1 The results show that 10 8 Lentiviral treatment with TU / mL increased VGF expression by 98-fold compared to the control group, indicating that the lentivirus was successfully constructed.
[0040] The concentration is 10. 8 Lentiviral culture medium at TU / mL was used. Lentiviral virus was added on day 3 of cell differentiation. On day 7, cells were fixed with 4% paraformaldehyde (Soluble Biotech, Beijing, catalog number P1110) for 10 minutes, then permeabilized with 0.3% Triton X-100 (Soluble Biotech, Beijing, catalog number T8200) for 10 minutes, blocked with 5% goat serum (Soluble Biotech, Beijing, catalog number SL038) for 1 hour, incubated with MBP primary antibody overnight at 4°C, washed with PBS (Soluble Biotech, Beijing, catalog number P1020), and incubated with the corresponding fluorescent secondary antibody at room temperature for 1 hour. After washing with PBS, cells were incubated with the nuclear dye DAPI (Soluble Biotech, Beijing, catalog number C0065) at room temperature. Cells were observed and photographed under a fluorescence microscope. Figure 2The results showed that lentiviruses significantly promoted the maturation of oligodendrocytes and increased the average dendritic length of oligodendrocytes, indicating that lentiviruses can promote the differentiation of oligodendrocyte precursor cells into mature oligodendrocytes.
[0041] Example 4
[0042] Female C57BL / 6 mice, aged 6-8 weeks and weighing 18-22 grams, were selected. A spinal cord aspiration and transection model was used. The surgical site was disinfected, and then the T8-T9 vertebral segment was removed under a microscope. After opening the dura mater, the spinal cord tissue was aspirated, creating a 2 mm long cavity. The mice were divided into two groups: the injury group (SCI) and the lentivirus-encapsulated fibrin glue group (VGF Lentivirus, dose 10). 6 (TU). Mice with spinal cord injuries were sutured after undergoing different treatments. Postoperatively, the mice were given bladder massage twice daily to aid urination.
[0043] BMS Score: The body weight of the mice in both groups was recorded weekly, and two independent observers who did not know the group scored the recovery of motor function of the mice weekly according to the Basso Mouse Scale (BMS) scoring criteria. Figure 3 The results showed that the BMS score in the lentivirus group was significantly higher than that in the control group 8 weeks after surgery, which means that lentivirus treatment can promote the recovery of motor function in mice with spinal cord injury.
[0044] Western blot analysis of VGF, MBP, and OLIG2 protein expression in injured spinal cord: Mice were sacrificed to collect spinal cord tissue from the injured segment. Tissue proteins were extracted using a protein extraction kit (Jiangsu Kaiji Biotechnology Co., Ltd., KGP2100) and quantified. Polypropylene gel electrophoresis was performed, followed by membrane transfer and blocking. After incubation with primary and secondary antibodies, the tissue was exposed to ECL chemiluminescence solution and photographed. Figure 3 The results showed that VGF, MBP and OLIG2 proteins were significantly upregulated at the site of spinal cord injury, indicating that lentiviral treatment can promote the regeneration of oligodendrocytes.
[0045] Immunofluorescence staining to detect the effect of lentiviral treatment on VGF and MBP expression in the spinal cord: Mouse spinal cord tissue was perfused, dehydrated with sucrose, embedded in OCT, and frozen sections were prepared. Sections were washed in PBS, permeabilized with 0.3% Triton X-100 for 10 minutes, blocked with 5% goat serum for 1 hour, incubated with VGF or MBP primary antibody overnight at 4°C, washed with PBS, and incubated with the corresponding fluorescent secondary antibody at room temperature for 1 hour. After washing with PBS, sections were incubated with the nuclear dye DAPI at room temperature, and observed and photographed under a fluorescence microscope. Figure 4Immunostaining results showed that lentiviral treatment significantly increased the expression of VGF and MBP at the site of spinal cord injury, indicating that lentivirus can promote the regeneration of oligodendrocytes in the injured spinal cord.
[0046] In summary, this invention has demonstrated through cell and animal experiments that lentiviruses overexpressing the nerve growth factor-induced protein gene can promote the regeneration of oligodendrocytes, thereby effectively improving the recovery of motor function in animal models of spinal cord injury.
[0047] The above description is merely a preferred embodiment of the present invention and does not limit the implementation and protection scope of the present invention. Those skilled in the art should realize that any equivalent substitutions and obvious changes made based on the description and illustrations of the present invention should be included within the protection scope of the present invention.
Claims
1. The application of a lentivirus overexpressing the nerve growth factor-inducible protein gene in the preparation of a drug for treating spinal cord injury, characterized in that, The preparation steps of the lentivirus include: After PCR amplification of the nerve growth factor-induced protein gene, the PCR amplification product was cloned into the CSII-EF plasmid. The cloned product CSII-EF-VGF, psPAX, and pMD2.G were transfected into wild-type 293T cells. After a period of time, cell debris removal, virus precipitation, resuspension, and identification were performed sequentially to obtain the lentivirus. The nucleotide sequence of the forward primer in the PCR amplification is shown in SEQ ID NO: 3; the nucleotide sequence of the reverse primer is shown in SEQ ID NO:
4. The cell debris removal includes: collecting the culture medium containing the lentivirus, centrifuging it, taking the supernatant and filtering it to remove cell debris; The resuspension includes: collecting the precipitated virus and incubating it with stirring at 4°C for 45 min, centrifuging it and then resuspending it in a culture medium; The identification includes determining the titer of the lentivirus.
Citation Information
Patent Citations
Slow-virus vector system and preparation method thereof
CN102229963A