Multi-enzyme constant temperature amplification kit and detection method for detecting HTLV-1 proviral DNA

By combining multi-enzyme constant temperature amplification technology with lateral flow chromatography test strips, the problems of cumbersome operation and equipment dependence in HTLV-1 proviral DNA detection are solved, and fast and accurate detection results are achieved, which is suitable for on-site application in primary medical institutions.

CN117512212BActive Publication Date: 2025-09-09THE FIRST AFFILIATED HOSPITAL ZHEJIANG UNIV COLLEGE OF MEDICINE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311479099.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-11-08
Publication Date
2025-09-09
Estimated Expiration
2043-11-08

AI Technical Summary

Technical Problem

The existing HTLV-1 proviral DNA detection method has the disadvantages of a long detection window, easy missed detection, high false positive rate, cumbersome operation, and the need for large and sophisticated equipment, making it difficult to promote and apply in primary medical institutions.

Method used

A lateral flow chromatography test strip method for detecting HTLV-1 proviral DNA was developed by combining multi-enzyme constant temperature amplification (MIRA) technology with colloidal gold lateral flow chromatography technology. This method simplifies the operation, reduces the requirements for the environment and equipment, and allows the results to be observed with the naked eye.

Benefits of technology

It achieves rapid and accurate HTLV-1 proviral DNA detection, reduces the requirements for operators and equipment, is suitable for on-site rapid testing in primary medical institutions, and improves detection efficiency and sensitivity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117512212B_ABST
    Figure CN117512212B_ABST
Patent Text Reader

Abstract

The present invention discloses a multi-enzyme constant temperature amplification kit and a detection method for detecting HTLV-1 proviral DNA. The multi-enzyme constant temperature amplification kit includes a primer-probe mixture, A buffer, lyophilized enzyme powder, B buffer, a lateral flow chromatography test strip, a positive control and a negative control. The primer-probe mixture includes a specific primer pair and a probe for detecting HTLV-1 proviral DNA; the primer pair and the probe sequence are shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3. The present invention combines the MIRA detection method with the colloidal gold lateral flow chromatography technology, and can visualize the detection results by observing the bands with the naked eye, can effectively detect HTLV-1 proviral DNA, and can be used for rapid in vitro diagnosis of HTLV-1 infection. The kit of the present invention has the advantages of high sensitivity, good specificity, simple and portable operation, and short time, and has high application value in primary medical institutions or blood centers (blood stations) with scarce laboratory resources.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular detection and relates to a kit for detecting HTLV-1 proviral DNA, and in particular to a multi-enzyme constant temperature amplification kit and a detection method for detecting HTLV-1 proviral DNA. Background Art

[0002] Human T-lymphotropic virus (HTLV) is one of the earliest human retroviruses discovered, with HTLV-1 being the most common. Human infection with HTLV-1 often presents asymptomatically, with an incubation period of over 20 years. Later, it can cause adult T-cell leukemia, HTLV-related myelopathy / tropical spastic paraplegia, and various neurological disorders, and in severe cases, death. HTLV is primarily transmitted through breastfeeding, sexual contact, and blood.

[0003] Currently, domestic blood collection and supply institutions primarily use the enzyme-linked immunosorbent assay (ELISA) method for HTLV antibody testing. However, antibody screening has some drawbacks, such as a long detection window, which can easily lead to missed detections, and the ELISA method is prone to more false-positive results. HTLV proviral DNA testing is a confirmatory method for specimens that test positive for HTLV antibodies. Compared with the ELISA method, proviral DNA testing has higher specificity, making the development of reagents for detecting HTLV proviral DNA highly desirable.

[0004] Molecular diagnostic techniques, such as real-time fluorescence quantitative PCR, are considered powerful tools for pathogen diagnosis due to their high sensitivity and specificity. However, they place stringent requirements on laboratory equipment, environment, and operator skill. Furthermore, the procedures are cumbersome and time-consuming, making them unsuitable for widespread application in primary care settings. Multienzyme isothermal rapid amplification (MIRA) is a novel rapid isothermal nucleic acid amplification technique. It utilizes four core proteins (recombinase, DNA helicase, single-strand binding protein, and DNA polymerase) to amplify target genes at a constant temperature of 25–42°C. This method, which can be completed in 5–20 minutes, is simple and rapid, requires minimal operator expertise, and requires no large, sophisticated instrumentation; a water bath or thermostat is sufficient. Furthermore, combining MIRA with colloidal gold lateral flow chromatography allows for visualization of detection results through visual observation of bands. Compared with PCR, MIRA offers advantages such as high sensitivity, high specificity, rapidity and portability, ease of operation, visualization of results, and suitability for rapid on-site testing. Summary of the Invention

[0005] To address the challenges presented in the prior art, the present invention provides a multi-enzyme isothermal amplification kit and method for detecting HTLV-1 proviral DNA. Based on MIRA technology, this method establishes a lateral flow chromatography test strip for rapid detection of HTLV-1 proviral DNA. While ensuring high sensitivity and specificity, it significantly reduces requirements for the environment, equipment, and operator. Furthermore, the method is simple and rapid to operate, making it highly applicable in primary healthcare institutions or blood centers (blood banks) with limited laboratory resources.

[0006] The technical solutions of the present invention are as follows:

[0007] 1. A multi-enzyme isothermal amplification kit for detecting HTLV-1 proviral DNA

[0008] The multi-enzyme constant temperature amplification kit comprises a primer-probe mixture, A buffer, freeze-dried enzyme powder, B buffer, a lateral flow chromatography test strip, a positive control and a negative control.

[0009] The primer-probe mixture includes a specific primer pair and a probe for detecting HTLV-1 proviral DNA; the specific primer pair for detecting HTLV-1 proviral DNA consists of an upstream primer and a downstream primer for detecting HTLV-1 proviral DNA, wherein the sequence of the upstream primer for detecting HTLV-1 proviral DNA is shown in SEQ ID NO.1, the sequence of the downstream primer is shown in SEQ ID NO.2, and the sequence of the probe is shown in SEQ ID NO.3.

[0010] The 5' end of the primer shown in SEQ ID NO.2 is labeled with a biotin group; the 5' end of the probe shown in SEQ ID NO.3 is labeled with a FAM fluorescent group, a dSpacer (tetrahydrofuran, THF) is labeled at the sequence position 30 nt away from the 5' end, and the 3' end is labeled with a modification group C3-spacer.

[0011] The positive control is a plasmid containing an HTLV-1 specific amplified gene fragment, wherein the nucleotide sequence of the HTLV-1 specific amplified fragment is shown in SEQ ID NO.4.

[0012] The negative control is any one of DEPC (diethyl pyrocarbonate) treated water, deionized water and sterile water.

[0013] The freeze-dried enzyme powder comprises recombinase, DNA helicase, single-strand binding protein and DNA polymerase.

[0014] The A buffer includes a constant temperature amplification buffer and dNTPs; the B buffer includes a magnesium acetate solution.

[0015] 2. A MIRA-based method for detecting HTLV-1 proviral DNA

[0016] The HTLV-1 proviral DNA detection method uses the multi-enzyme constant temperature amplification kit for detecting HTLV-1 proviral DNA, and the method includes the following steps:

[0017] 1) Extracting genomic DNA from the blood sample to be tested using a genomic DNA extraction kit to obtain a sample genomic DNA extract;

[0018] 2) Prepare a MIRA reaction solution using the primer-probe mixture, buffer A, lyophilized enzyme powder, and buffer B in the multi-enzyme constant-temperature amplification kit. Place the sample genomic DNA extract, positive control, and negative control into the corresponding MIRA reaction solution to obtain a sample test solution, a positive test solution, and a negative test solution. Place the three test solutions in a water bath or thermostat for reaction.

[0019] 3) Using lateral flow chromatography test strips, the reacted sample test solution, positive test solution, and negative test solution are respectively tested. By visually observing the color development of the quality control line and the test line of the lateral flow chromatography test strips, the color development results of the three types of lateral flow chromatography test strips are obtained, and then the HTLV-1 proviral DNA detection results are obtained.

[0020] In the above 2), when the sample test solution, the positive test solution and the negative test solution are subjected to MIRA reaction in a water bath or a thermostat, the reaction temperature is 37-38° C. and the reaction time is 15-20 min.

[0021] In the above 2), the sample genomic DNA extract is at least one, and the positive control and the negative control are each one.

[0022] In the above 3), when the quality control line is blue and the test line is colorless in the color development result corresponding to the negative test solution, and the quality control line is blue and the test line is red in the color development result corresponding to the positive test solution, the experiment is valid; otherwise, the experiment is considered invalid and the experiment needs to be repeated; when the experiment is valid, in the color development result corresponding to the sample genomic DNA extract, when the quality control line is blue and the test line is red, it is judged as positive; when the quality control line is blue and the test line is colorless, it is judged as negative; when the quality control line and the test line are both colorless, it is judged as invalid and the experiment needs to be repeated.

[0023] The method specifically comprises the following steps:

[0024] (1) The kit of the present invention does not contain a genomic DNA extraction reagent. A commercially available genomic DNA extraction kit can be used for blood samples, such as the Blood Genomic DNA Extraction Kit (Tiangen Biochemical Technology Co., Ltd., Beijing, China). For specific extraction steps, please refer to the instructions of the extraction kit to obtain n-3 sample genomic DNA extracts.

[0025] (2) The total volume of each reaction is 50 μl. Prepare 50 μl × n MIRA reaction solution according to the number of reaction samples n (number of reaction samples = number of samples to be tested + 1 negative control + 1 positive control + 1): Specifically, take n × 29.4 μl of A buffer, n × 4.6 μl of primer-probe mixture, and n × 8.5 μl of sterile ddH2O in a centrifuge tube, mix them evenly, centrifuge at low speed for a few seconds, and dispense 42.5 μl / tube into freeze-dried enzyme powder reaction tubes.

[0026] (3) Take 5 μL of each of n-3 sample genomic DNA extracts, 1 negative control, and 1 positive control and add them to the corresponding freeze-dried enzyme powder reaction tubes, shake and mix them, centrifuge at low speed for a few seconds, then add 2.5 μL of Bbuffer to each reaction tube, mix thoroughly by inverting, and immediately place in a water bath or thermostat and incubate at 37-38℃ for 15-20 minutes.

[0027] (4) After the reaction is completed, the sample test solution, positive test solution, and negative test solution are diluted 10-20 times, and then the sample end of the lateral flow chromatography test strip is inserted into a centrifuge tube for equilibrium at room temperature. The quality control line and the test line are observed within 10 minutes to obtain the corresponding color development results.

[0028] (5) When the quality control line is blue and the test line is colorless in the color development result corresponding to the negative test solution, and the quality control line is blue and the test line is red in the color development result corresponding to the positive test solution, the experiment is valid; otherwise, the experiment is considered invalid and the experiment needs to be repeated; when the quality control line is blue and the test line is red in the color development result corresponding to the sample genomic DNA extract, the experiment is judged to be positive; when the quality control line is blue and the test line is colorless, the experiment is judged to be negative; when both the quality control line and the test line are colorless, the experiment is judged to be invalid and the experiment needs to be repeated.

[0029] The present invention is particularly suitable for rapid on-site screening of pathogenic microorganisms, providing diagnostic evidence immediately and improving detection efficiency. The multi-enzyme isothermal amplification kit and detection method for detecting HTLV-1 proviral DNA provided by the present invention enable rapid and accurate identification of HTLV-1 in blood, improving the efficiency of HTLV-1 detection. The simple, rapid, and portable method addresses the problems of existing technologies, such as cumbersome operational procedures, reliance on large, precision equipment (such as PCR instruments), low detection efficiency, and time consumption. The kit is particularly suitable for grassroots and on-site testing and has broad application prospects.

[0030] The beneficial effects of the present invention are:

[0031] (1) Can improve detection efficiency: The entire MIRA test process only takes 15-20 minutes, which is much shorter than the 60 minutes of qPCR, greatly shortening the amplification time and improving detection efficiency.

[0032] (2) Ability to lower reaction temperature: MIRA only needs a constant temperature of 37-38°C to complete the experiment, which is much lower than the 60°C-95°C of qPCR.

[0033] (3) Simple operation and visualization: It does not require high requirements on operators and does not require large-scale precision instruments and equipment. A water bath or thermostat can be used to conduct experiments. It is suitable for on-site rapid screening of pathogenic microorganisms. Lateral flow chromatography test strips are used to detect amplification products, making the results visual.

[0034] (4) High sensitivity and strong specificity: The sensitivity and specificity of the detection method can be improved by optimizing the reaction time and temperature. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is a graph showing the optimal reaction temperature for detecting HTLV-1 according to the present invention;

[0036] Figure 2 This is a graph showing the optimal reaction time for detecting HTLV-1 according to the present invention;

[0037] Figure 3 This is a graph showing the sensitivity of the kit of the present invention in detecting HTLV-1 standards;

[0038] Figure 4 Graph showing the specificity of the test kit of the present invention: 1: HTLV-1; 2: HBV; 3: HCV; 4: HEV; 5: CMV; 6: HSV; 7: B19; 8: EBV; 9: negative control; 10: positive control. DETAILED DESCRIPTION

[0039] The embodiments of the present invention will be described in detail below with reference to examples.

[0040] Example 1

[0041] Preparation of a multi-enzyme isothermal amplification kit for detecting HTLV-1 proviral DNA

[0042] 1. Design and Synthesis of Primer Probes

[0043] The HTLV-1 gene sequence was downloaded from the NCBI gene library. After downloading, multiple sequence alignment was performed using DNAMAN software to screen for conserved gene regions. Primer probes were designed using Primer Premier 5.0 according to the MIRA primer probe design principles. The designed primer probe sequences were then input into NCBI BLAST for specific alignment to screen for primer probes that could amplify HTLV-1 and did not specifically amplify other pathogens. The upstream primer sequence for detecting HTLV-1 proviral DNA is shown in SEQ ID NO.1, the downstream primer sequence is shown in SEQ ID NO.2, and the probe sequence is shown in SEQ ID NO.3.

[0044] The 5' end of the primer shown in SEQ ID NO.2 is labeled with a biotin group; the 5' end of the probe shown in SEQ ID NO.3 is labeled with a FAM fluorescent group, a dSpacer (tetrahydrofuran, THF) is labeled at the sequence position 30 nt away from the 5' end, and the 3' end is labeled with a modified group C3-spacer.

[0045] The above primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0046] 2. Positive Plasmid Preparation

[0047] The HTLV-1 specific amplified gene fragment was connected to the plasmid vector pUC57 (Shanghai Sangon Biotechnology Co., Ltd.) by molecular cloning technology. After transformation, culture, and identification, plasmid DNA was extracted and the concentration of plasmid DNA was determined using a NanoDrop2000 ultramicro spectrophotometer. The concentration of the plasmid DNA was calculated based on the value of copies / μl = (6.02 × 10 23 )×(ng / μL×10 -9 ) / (DNA length × 660) to determine the copy number of the plasmid DNA, and then dilute it to 10 7 copies / μl.

[0048] The nucleotide sequence of the HTLV-1 specific amplified fragment is shown in SEQ ID NO.4.

[0049] 3. Establishment of MIRA reaction system and determination of reaction temperature and reaction time

[0050] The MIRA reaction was performed using a DNA Constant Temperature Rapid Amplification Kit (Colloidal Gold) (Weifang Anpu Future Biotechnology Co., Ltd.), including a reaction tube containing lyophilized enzyme powder, A buffer, and B buffer.

[0051] The MIRA system was as follows: the total reaction volume was 50 μl, including 29.4 μl of A buffer, 4.6 μl of primer-probe mixture, 5 μl each of extracted genomic DNA template, negative control, and positive control, 8.5 μl of sterile ddH2O, and 2.5 μl of B buffer.

[0052] In order to screen the best reaction conditions, 10 3 -10 1 The MIRA system was evaluated at different temperatures (35, 37, and 39°C) and reaction times (10, 15, 20, 25, and 30 min) using 100 copies / μl plasmid as template and sterile ddH2O as negative control. Figure 1 As shown, at 35℃, the concentration is 10 3 -10 1 The plasmid with 10 copies / μl and negative control showed only the quality control line; at 37℃, the concentration was 10 3 When the plasmid with 100 copies / μl was used as the amplification template, both the quality control line and the detection line showed color; at 39℃, 10 3 -10 1 The quality control line and the detection line appeared at the same time for the plasmid and negative control, so 37℃ was selected as the temperature for subsequent experiments. Figure 2 As shown in the figure, the detection line of MIRA amplification for 15 minutes can be clearly colored, and the detection line of the negative control appears when the amplification time is 25 minutes or more. Therefore, 15 minutes is selected as the optimal amplification time.

[0053] The optimized reaction conditions were: incubation at 37°C for 15 minutes. After the reaction, 8 μL of the solution was added to a centrifuge tube containing 152 μL of sterile ddH2O. After mixing, the sample end of the lateral flow chromatography strip was inserted into the centrifuge tube and allowed to equilibrate at room temperature. The control and test lines were observed within 5 minutes to interpret the results.

[0054] Test 1: Sensitivity evaluation of the kit of the present invention

[0055] The sensitivity of the multi-enzyme constant temperature amplification kit for detecting HTLV-1 proviral DNA described in Example 1 was evaluated by: 7 The HTLV-1 positive plasmid at 10 copies / μl was diluted 10-fold with sterile ddH2O to obtain 10 7 -10 1 The positive plasmid solutions with a total of 7 dilutions of 100 copies / μl were used as templates respectively. The 7 dilutions of the positive plasmid solutions were amplified according to the isothermal amplification detection method optimized in Example 1, and then the amplification products were detected using lateral flow chromatography test strips.

[0056] The results are as follows Figure 3 As shown, 10 7 -10 3 The amplification product with the plasmid as template appears both the quality control line and the detection line at the same time, and the concentration is 10 2 -10 1 The plasmid with 10 copies / μl and the negative control only showed the quality control line, so the sensitivity of the kit for detecting HTLV-1 proviral DNA was 10 3 copies / μl.

[0057] Experiment 2: Specificity evaluation of the kit of the present invention

[0058] The specificity of the multi-enzyme isothermal amplification kit for detecting HTLV-1 proviral DNA described in Example 1 was evaluated. Specifically, the isothermal amplification detection method optimized in Example 1 was used to detect HTLV-1-positive specimens and other virus-positive specimens, such as hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis E virus (HEV), human cytomegalovirus (CMV), herpes simplex virus (HSV), human parvovirus (B19), and Epstein-Barr virus (EBV), and negative and positive controls were set up.

[0059] The results are as follows Figure 4 As shown, only the amplified products of the HTLV-1 positive specimens and the positive control showed both the quality control line and the detection line, while the other 7 viruses and the negative control only showed the quality control line, indicating that the kit of the present invention has good specificity, can specifically detect HTLV-1, and has no cross-reaction with the other pathogens mentioned above.

[0060] Experiment 3: Detection of clinical samples using the kit of the present invention

[0061] 500 clinical blood samples were collected, and genomic DNA from the samples was extracted using a commercially available genomic DNA extraction kit. The genomic DNA extracted from the 500 clinical samples was then tested using the isothermal amplification kit described in the present invention according to the isothermal amplification detection method described in Example 1. The results are as follows: Of the 500 clinical blood samples, one HTLV-1-positive specimen was screened, which was consistent with the fluorescent quantitative PCR test results, verifying the accuracy of the kit of the present invention.

[0062] The above embodiments are only used to illustrate the principles and applications of the present invention, and the protection scope of the present invention is not limited to the above embodiments.

[0063] The gene sequences involved in the present invention are as follows:

[0064] SEQ ID No. 1;

[0065] Name: Upstream Primer

[0066] Source: synthetic construct

[0067] Type: other DNA

[0068] 5'-AGACCCCGGACTCCGGCCCCAAAACCTG-3'

[0069] SEQ ID No. 2;

[0070] Name: Downstream Primer

[0071] Source: synthetic construct

[0072] Type: other DNA

[0073] 5'-Biotin-GGCGTGCCATCGGTAAATGTCCAAATAA-3'

[0074] SEQ ID No. 3;

[0075] Name: Probe

[0076] Source: synthetic construct

[0077] Type: other DNA

[0078] 5'-FAM-GCCAGCTCGGGGCCTTCCTCACCAATGTTC / THF /

[0079] CTACAAGCGAATAGA-3'C3spacer

[0080] SEQ ID No.4;

[0081] Name: HTLV-1 specific amplified fragment

[0082] Source: synthetic construct

[0083] Type: other DNA

[0084] AGACCCCGGACTCCGGCCCCAAAACCTGTACACCCTCTGGGGAGGCTCCGTTGTCTGCATGTACCTCTACCAGCTTTTCCCCCCCCATCACCTGGCCCCTCCTGCCCCACGTGATTTTTTGCCACCCCGGCCAGCTCGGGGCCTTCCTCACCAATGTTCCCTACAAGCGAATAGAAGAACTC CTCTATAAAATTTCCCTCACCACAGGGGCCCTAATAATTCTACCCGAAGACTGTTTGCCCACCACCCTTTTCCAGCCTGCTAGGGCACCCGTCACGCTAACAGCCTGGCAAAACGGCCTCCTTCCGTTCCACTCAACCCTCACCACTCCAGGCCTTATTTGGACATTTACCGATGGCACGCC

[0085] <110> The First Affiliated Hospital of Zhejiang University School of Medicine

[0086] <120> Multi-enzyme constant temperature amplification kit and detection method for detecting HTLV-1 proviral DNA

[0087] <160> 4

[0088] <170> SIPOSequenceListing 1.0

[0089] <210> 1

[0090] <211> 28

[0091] <212> DNA

[0092] <213> Artificial Sequence

[0093] <400> 1

[0094] agaccccgga ctccggcccc aaaacctg 28

[0095] <210> 2

[0096] <211> 28

[0097] <212> DNA

[0098] <213> Artificial Sequence

[0099] <400> 2

[0100] ggcgtgccat cggtaaatgt ccaaataa 28

[0101] <210> 3

[0102] <211> 45

[0103] <212> DNA

[0104] <213> Artificial Sequence

[0105] <400> 3

[0106] gccagctcgg ggccttcctc accaatgttc ctacaagcga ataga 45

[0107] <210> 4

[0108] <211> 363

[0109] <212> DNA

[0110] <213> Artificial Sequence

[0111] <400> 4

[0112]

[0113]

Claims

1. A multi-enzyme isothermal amplification kit for detecting HTLV-1 proviral DNA, characterized in that: The multi-enzyme constant temperature amplification kit includes a primer-probe mixture, A buffer, lyophilized enzyme powder, B buffer, lateral flow chromatography test strips, positive control substances and negative control substances; The primer-probe mixture comprises a specific primer pair and a probe for detecting HTLV-1 proviral DNA; the specific primer pair for detecting HTLV-1 proviral DNA comprises an upstream primer and a downstream primer for detecting HTLV-1 proviral DNA, wherein the sequence of the upstream primer for detecting HTLV-1 proviral DNA is shown in SEQ ID NO.1, the sequence of the downstream primer is shown in SEQ ID NO.2, and the sequence of the probe is shown in SEQ ID NO.3; The positive control is a plasmid containing an HTLV-1 specific amplified gene fragment, wherein the nucleotide sequence of the HTLV-1 specific amplified fragment is shown in SEQ ID NO.

4.

2. A multi-enzyme isothermal amplification kit for detecting HTLV-1 proviral DNA according to claim 1, characterized in that: The negative control is any one of DEPC-treated water, deionized water and sterile water.

3. A multi-enzyme isothermal amplification kit for detecting HTLV-1 proviral DNA according to claim 1, characterized in that: The freeze-dried enzyme powder comprises recombinase, DNA helicase, single-strand binding protein and DNA polymerase.

4. A multi-enzyme isothermal amplification kit for detecting HTLV-1 proviral DNA according to claim 1, characterized in that: The A buffer includes a constant temperature amplification buffer and dNTPs; the B buffer includes a magnesium acetate solution.

5. A method for using a multi-enzyme constant temperature amplification kit for detecting HTLV-1 proviral DNA according to any one of claims 1 to 4, characterized in that: The method of use is not a method for diagnosing a disease, and the method of use comprises the following steps: 1) Prepare the MIRA reaction solution using the primer-probe mixture, buffer A, lyophilized enzyme powder, and buffer B in the multi-enzyme constant-temperature amplification kit. Place the extracted sample genomic DNA extract, positive control, and negative control into the corresponding MIRA reaction solution to obtain the sample test solution, positive test solution, and negative test solution. Then place the above three test solutions in a water bath or thermostat for reaction. 2) The reacted sample test solution, positive test solution, and negative test solution are tested using lateral flow chromatography test strips to obtain color development results of the three types of lateral flow chromatography test strips.

6. The method for using the multi-enzyme constant temperature amplification kit for detecting HTLV-1 proviral DNA according to claim 5, characterized in that: In the above 1), when the sample test solution, the positive test solution and the negative test solution are subjected to MIRA reaction in a water bath or a thermostat, the reaction temperature is 37-38° C. and the reaction time is 15-20 min.

7. The method for using the multi-enzyme constant temperature amplification kit for detecting HTLV-1 proviral DNA according to claim 5, characterized in that: In the above 1), the sample genomic DNA extract is at least one, and the positive control and the negative control are each one.