Hybridoma cell strain, anti-human PTEN monoclonal antibody and application thereof
By constructing the hybridoma cell line OTI9B1 and preparing anti-human PTEN monoclonal antibody, the problem of insufficient specificity and sensitivity of PTEN protein detection in the existing technology has been solved, realizing highly specific and highly sensitive immunodetection, which is suitable for the differential diagnosis of endometrial cancer, colorectal cancer and pancreatic cancer.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- BEIJING ZHONGSHAN GOLDEN BRIDGE BIOTECHNOLOGY CO LTD
- Filing Date
- 2024-01-08
- Publication Date
- 2026-07-03
AI Technical Summary
Existing technologies struggle to provide highly specific and sensitive monoclonal antibodies to recognize PTEN proteins, impacting the differential diagnosis of tumors such as endometrial cancer.
The hybridoma cell line OTI9B1 was constructed, and recombinant PTEN protein was prepared by recombinant expression vector. The protein was purified and used to immunize mice. Anti-human PTEN monoclonal antibodies were screened and prepared, purified by affinity chromatography, and used in immunoassay tools such as kits, chips, or test strips.
It improves the specificity, sensitivity and accuracy of PTEN protein immunoassay, and is suitable for labeling PTEN protein in various tissues, especially for the differential diagnosis of endometrial cancer, colorectal cancer and pancreatic cancer.
Smart Images

Figure CN117821398B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, and in particular relates to a hybridoma cell line, an anti-human PTEN monoclonal antibody, and their applications. Background Technology
[0002] The PTEN gene (gene of phosphate and tension homology deleted on chromsometen) is a tumor suppressor gene first reported in 1997. It was the first tumor suppressor gene discovered in humans with bispecific phosphatase activity. Because of its phosphatase activity, the PTEN protein can modify other proteins by removing phosphate groups, preventing excessively rapid or uncontrolled cell growth and division, thus halting cell division and inducing apoptosis. This allows for the regulation of the cell cycle and ultimately inhibits tumor formation.
[0003] Deletion or mutation of the PTEN gene is highly associated with the development of various tumors. Homozygous deletion of the PTEN gene in mouse embryos is lethal, while heterozygous deletion of the PTEN gene in mice spontaneously develops various types of tumors, such as endometrial cancer, breast cancer, lung cancer, and glioma. The main function of cytoplasmic PTEN protein is to regulate the phosphorylation level of the second messenger PIP3 through its lipid phosphatase activity, blocking the Akt / PKB pathway. Inactivation of PTEN leads to a persistently activated PI3K / Akt pathway. Nuclear PTEN protein can form an intranuclear complex with p53, inhibiting p53 degradation and enhancing p53 transcriptional activity; the deletion of nuclear PTEN protein promotes tumor development and progression, indicating that nuclear PTEN also primarily plays a tumor-suppressive role.
[0004] Endometrial cancer is a common gynecological malignancy, and the loss of PTEN expression plays a crucial role in its pathogenesis. Studies have shown that PTEN expression loss is observed in 30-50% of endometrial cancer patients, and approximately 25% of endometrial tissues with atypical complex hyperplasia also exhibit PTEN expression loss. However, PTEN expression loss is not a specific marker of malignant transformation; it is also expressed in normally proliferating endometrial tissue. In normally proliferating endometrial tissue, PTEN is mainly expressed in the cytoplasm and nucleus of endometrial glandular epithelium and stroma, with expression levels showing weak and slightly varying intensity. However, when PTEN is mutated or lost, it leads to abnormal protein expression, characterized by the complete absence of nuclear and cytoplasmic expression in the glands, although leukocytes within the glands may still express it. This abnormal PTEN expression is closely related to the occurrence and development of endometrial cancer. Therefore, developing highly specific and sensitive monoclonal antibodies to recognize PTEN protein is crucial for the differential diagnosis of various tumor tissues, including endometrial cancer. Summary of the Invention
[0005] The present invention aims to provide a hybridoma cell line, an anti-human PTEN monoclonal antibody, and their applications, so as to provide a monoclonal antibody that specifically binds to the PTEN protein, thereby improving the specificity and sensitivity of PTEN protein immunoassay.
[0006] To achieve the above objectives, the technical solution of the present invention is implemented as follows:
[0007] This invention provides a hybridoma cell line named OTI9B1, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 45714, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, on September 6, 2023.
[0008] The anti-human PTEN monoclonal antibody is secreted by the hybridoma cell line OTI9B1.
[0009] The method for screening hybridoma cell lines and preparing monoclonal antibodies described in this invention is as follows:
[0010] (1) Construction of recombinant expression vector: Based on the amino acid sequence characteristics of PTEN, the amino acid fragment of PTEN from position 250 to 403 was designed as an immunogen (the corresponding nucleotide sequence is shown in SEQ ID NO.1 and the amino acid sequence is shown in SEQ ID NO.2). Primers were designed, and restriction endonuclease sites SgfI and MluI were introduced on both sides of the gene, respectively. The gene was inserted into the expression vector pET23a-N-His to construct the recombinant expression plasmid pET23a-rPTEN.
[0011] (2) Expression and purification of recombinant PTEN protein: The constructed recombinant PTEN expression plasmid was transformed into E. coli cells, lysed and centrifuged to obtain the supernatant, and purified by nickel affinity chromatography to obtain purified recombinant PTEN protein.
[0012] (3) Screening of monoclonal antibody hybridoma cell lines and preparation of monoclonal antibodies secreted by them: BALB / c mice were immunized with the above recombinant PTEN protein, and mouse spleen cells were fused with sp2 / 0 cells respectively. Monoclonal antibodies were obtained by limiting dilution method, and positive hybridoma cells were screened by ELISA to obtain hybridoma cell lines that can secrete specific antibodies against human PTEN protein and subtype identification was performed. Antibodies were prepared by serum-free culture medium and purified by affinity chromatography column to obtain anti-human PTEN monoclonal antibodies.
[0013] Furthermore, the anti-human PTEN monoclonal antibody has a light chain variable region containing 111 amino acids, and its amino acid sequence is shown in SEQ ID NO.3; its heavy chain variable region contains 115 amino acids, and its amino acid sequence is shown in SEQ ID NO.7.
[0014] Furthermore, the anti-human PTEN monoclonal antibody includes CDR1, CDR2 and CDR3 in the light chain variable region, which are 27aa-38aa, 56aa-58aa and 95aa-100aa respectively, and their amino acid sequences are shown in SEQ ID NO.4-6 respectively.
[0015] Furthermore, the anti-human PTEN monoclonal antibody, wherein the heavy chain variable region includes CDR1, CDR2 and CDR3, which are 26aa-33aa, 51aa-58aa and 97aa-104aa respectively, and their amino acid sequences are shown in SEQ ID NO.8-10 respectively.
[0016] Furthermore, the anti-human PTEN monoclonal antibody can bind to the PTEN protein with high specificity. The sensitivity and specificity of the monoclonal antibody can be verified by immunoassay methods, such as immunohistochemistry (IHC).
[0017] Furthermore, the application of the anti-human PTEN monoclonal antibody in the preparation of immunoassay tools; preferably, the immunoassay tool is a reagent kit, chip, or test strip.
[0018] Furthermore, the anti-human PTEN monoclonal antibody is used in the preparation of an immunoassay tool; preferably, the immunoassay tool is used to detect PTEN protein.
[0019] Furthermore, the anti-human PTEN monoclonal antibody is used in the preparation of kits for labeling various tissues; preferably, the tissues include endometrial cancer, colorectal cancer, and pancreas.
[0020] An immunohistochemical assay kit, comprising the anti-human PTEN monoclonal antibody as described above, is used to detect the expression status of PTEN protein in various tissues.
[0021] Compared with existing technologies, the hybridoma cell line OTI9B1, the anti-human PTEN monoclonal antibody, and their applications described in this invention have the following advantages:
[0022] The hybridoma cell line OTI9B1 described in this invention can stably secrete anti-human PTEN monoclonal antibodies, which specifically bind to PTEN protein, significantly improving the specificity, sensitivity, accuracy, and reliability of PTEN protein immunoassay. It is applicable to the labeling of PTEN protein in various tissues. Attached Figure Description
[0023] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. In the drawings:
[0024] Figure 1 The image shows the Western blot results of the recombinant PTEN protein described in Example 2 of this invention. The expression of the recombinant PTEN protein in E. coli cells was detected using anti-HIS antibody. Lane L represents the detection results of E. coli cell lysate transfected with the empty vector as the antigen, and lane R represents the detection results of E. coli cell lysate transfected with pET23a-rPTEN plasmid as the antigen.
[0025] Figure 2 The image shows the SDS-PAGE results of the PTEN protein described in Example 2 of this invention. The recombinant PTEN protein was purified using a nickel affinity chromatography column, and the purified protein was subjected to SDS-PAGE electrophoresis and Coomassie brilliant blue staining.
[0026] Figure 3 This is a schematic diagram of the results of IHC detection of endometrial cancer using the anti-human PTEN monoclonal antibody described in Example 5 of the present invention;
[0027] Figure 4 This is a schematic diagram of the results of IHC detection of colorectal cancer using the anti-human PTEN monoclonal antibody described in Example 5 of the present invention;
[0028] Figure 5 This is a schematic diagram of the pancreas detection results using the anti-human PTEN monoclonal antibody IHC described in Example 5 of the present invention; Detailed Implementation
[0029] Unless otherwise defined, the technical terms used in the following embodiments have the same meanings as commonly understood by those skilled in the art. Unless otherwise specified, the experimental reagents used in the following embodiments are conventional biochemical reagents; and the experimental methods described are conventional methods.
[0030] The present invention will now be described in detail with reference to the embodiments and accompanying drawings.
[0031] Example 1: Construction of PTEN protein recombinant expression plasmid
[0032] The PTEN gene NM_000314 was selected from Genebank. Based on the amino acid sequence characteristics of PTEN, the amino acid fragment from PTEN to position 250-403 was designed as an immunogen (its corresponding nucleotide sequence is shown in SEQ ID NO.1, and its amino acid sequence is shown in SEQ ID NO.2). Primers were designed, and restriction endonuclease sites SgfI and MluI were introduced on both sides of the gene, respectively. The gene was inserted into the expression vector pET23a-N-His to construct the recombinant expression plasmid pET23a-rPTEN.
[0033] Example 2: Expression and purification of recombinant PTEN protein
[0034] 1. Experimental Methods
[0035] (1) Transformation of E. coli cells: After thawing 100 μl of competent cells on ice, add recombinant plasmid DNA and mix gently. Incubate on ice for 30 min, then heat shock at 42°C for 90 sec, and then continue to incubate on ice for 1-2 min. Add 500 μl of fresh antibiotic-free LB medium in a clean bench, incubate at 37°C on a shaker for 45 min, then take an appropriate amount of bacterial solution and spread it evenly on an antibiotic-containing plate. Invert the culture dish and incubate overnight in a 37°C constant temperature incubator.
[0036] (2) Cell lysis: Single clones were picked and cultured in fresh culture medium at 37°C and 200 rpm until the OD value reached 0.4–0.6. IPTG (final concentration 1 mM) was then added for induction culture for 7 hours. The cells were collected by centrifugation, resuspended in lysis buffer, sonicated for 20 min, and then centrifuged at 12000 rpm for 20 min at 4°C. The supernatant was collected. A small amount of supernatant protein was used for Western blotting with anti-His antibody. (See...) Figure 1 .
[0037] (3) Nickel affinity chromatography purification: The nickel column was equilibrated with buffer. The supernatant was filtered through a 0.45 μm filter membrane, loaded onto the column, and collected. Unbound proteins were washed with buffer to remove them. Finally, the column was eluted with elution buffer containing different concentrations of imidazole. The collected proteins were combined, and 10% glycerol was added. The purified recombinant PTEN protein was identified by SDS-PAGE electrophoresis. See [link to SDS-PAGE]. Figure 2 .
[0038] 2. Experimental Results
[0039] (1) By Figure 1 The results showed that the lysate of E. coli cells transfected with the pET23a-rPTEN plasmid exhibited a distinct specific band at 25 kDa in lane R, while the lysate of the control transfected with the empty vector did not show a band of the corresponding size in lane L. This indicates that the cells specifically expressed the recombinant PTEN protein.
[0040] (2) By Figure 2 The results showed that the purified protein had a distinct specific band at 25kD on the SDS-PAGE gel image, indicating that the recombinant PTEN protein with good purity had been obtained.
[0041] Example 3: Preparation and screening of anti-human PTEN monoclonal antibodies secreted by hybridoma cell line OTI9B1
[0042] BALB / c mice (Beijing Vital River Laboratory Animal Technology Co., Ltd.) were immunized using purified recombinant PTEN protein (hereinafter referred to as PTEN antigen) according to standard methods. The specific methods are as follows:
[0043] (1) Animal immunization: Purified PTEN antigen was emulsified with complete Freund's adjuvant and immunized 6-8 week old BALB / c mice by subcutaneous or intraperitoneal injection at a dose of 60 μg / mouse. A second immunization was performed two weeks later with incomplete Freund's adjuvant emulsification at a dose of 30 μg / mouse. After two immunizations, tail blood was collected and serum titers were determined by serial dilution using ELISA. Based on the results, it was determined whether booster immunization was necessary, and mice with the highest antibody titers were selected for cell fusion.
[0044] (2) Cell fusion: Myeloma cells were sp2 / 0 derived from BALB / c and were in the logarithmic growth phase at the time of fusion. Spleens of immunized mice were taken and lymphocyte single-cell suspensions were prepared. Mouse spleen lymphocytes and myeloma cells were mixed at a ratio of 1:5 to 1:10. 1 mL of 50% PEG (pH 8.0) preheated at 37°C was added, along with incomplete culture medium and the remaining stop solution. After centrifugation and discarding the supernatant, HAT culture medium was added to suspend and mix well. The volume was adjusted to 50 mL by MC, dispensed into 3.5 cm culture dishes, placed in a humidified box, and cultured in a 37°C, 5% CO2 incubator.
[0045] (3) Screening and Cloning: Hybridoma cell clones were selected within 7-10 days of fusion and tested using purified recombinant PTEN protein via ELISA. Cell line numbers were labeled. Positive wells were subjected to limiting dilutions, with ELISA values measured 5-6 days after each dilution. Wells with high OD280 positive values were selected for further limiting dilutions until the entire 96-well plate tested positive via ELISA. High-positive-value clones were selected for identification; their corresponding fusion plate cell line was OTI9B1.
[0046] (4) Preparation and purification of monoclonal antibodies on cells: The hybridoma cell line OTI9B1 was cultured in DMEM medium containing 15% serum in 10cm culture dishes and expanded to approximately 4×10⁻⁶ cells / year. 7 Centrifuge at 800 rpm for 5 min, discard the supernatant and transfer the cells to a 2 L roller flask. Add serum-free culture medium to bring the cell density to approximately 3 × 10⁶ cells / min.5 Cells / ml. Continue culturing for 1-2 weeks, until the cell death rate reaches 60%-70% (at which point the cell density is approximately 1-2 × 10⁶ cells / ml). 6 Cell suspension was collected (cells / ml), centrifuged at 6000 rpm for 20 min, and the supernatant was collected and purified by affinity chromatography. The appropriate column material was selected according to the antibody subtype (for IgG1, protein G column material was used for purification). The concentration of the purified monoclonal antibody was determined, lyophilized, and aliquoted (100 μg / tube), and finally stored at -20℃.
[0047] Example 4: Variable region gene and amino acid sequence analysis of anti-human PTEN monoclonal antibody
[0048] Purchased from Takara Bio USA The RACE 5' / 3' kit uses 5'RACE (Rapid Amplification of cDNA Ends) technology to amplify the variable region light and heavy chain gene sequences of hybridoma cell functional antibodies. For detailed experimental procedures, please refer to Takara Bio USA. RACE 5' / 3' Kit User Manual.
[0049] Based on the fact that the anti-human PTEN monoclonal antibody is of the IgG1 subtype, specific gene primers pRace-H-GSP and pRace-K-GSP targeting the 3' end of its Ig and Kappa constant regions were designed. The primer sequences are as follows:
[0050] pRace-H-GSP:CATCDGTCTATCCACTGGCCCCTG
[0051] pRace-K-GSP:CTTCCCACCATCCAGTGAGCAGTT
[0052] mRNA was extracted from the hybridoma cell line OTI9B1 and reverse transcribed into cDNA. DNA fragments of the antibody heavy and light chains were amplified using RACE. The amplified light and heavy chains were ligated into the cloning vector PUC119 by enzyme digestion. Positive clones were selected using blue-white screening, and the positive plasmids were purified and sequenced using an ABI 3730 sequencer with universal primers M13f and M13r.
[0053] Using the internet and the IMGT / V-QUEST analysis software at http: / / www.imgt.org, the nucleotide sequences of the light and heavy chains were sequenced and analyzed. The amino acid sequence of the variable region of the light chain of the anti-human PTEN monoclonal antibody is shown in SEQ ID NO.3, and the amino acid sequence of the variable region of the heavy chain is shown in SEQ ID NO.7. The total length of the light chain variable region is 111 amino acids. The number of amino acids in the four domains of FR are 26, 17, 36, and 11, respectively, and the number of amino acids in the three domains of CDR are 12, 3, and 6, respectively. The regions of CDR1, CDR2, and CDR3 are 27aa-38aa, 56aa-58aa, and 95aa-100aa, respectively, and their amino acid sequences are: HSLLNRSNQKNY, LAS, and LQHYST. Analysis revealed that the full-length variable region of the heavy chain of the anti-human PTEN monoclonal antibody is 115 amino acids. The number of amino acids in the four domains of its FR is 25, 17, 38, and 11, respectively. The number of amino acids in the three domains of its CDR is 8, 8, and 8, respectively. CDR1, CDR2, and CDR3 are 26aa-33aa, 51aa-58aa, and 97aa-104aa, respectively. Their amino acid sequences are GYSFTDYH, FYPYNGSI, and ARGGGLRG, respectively.
[0054] Example 5: Immunohistochemical detection using anti-human PTEN monoclonal antibody as primary antibody
[0055] 1. Experimental Methods:
[0056] (1) Formalin-fixed endometrial cancer, colon cancer and pancreatic tissue blocks were embedded in paraffin and sectioned using a Leica tissue slicer with a tissue thickness of 4 μm.
[0057] (2) Dewaxing and hydration: analytical grade xylene for 10 min × 3 times, anhydrous ethanol for 1 min × 3 times, 95% ethanol for 1 min, 85% ethanol for 1 min, 75% ethanol for 1 min, and deionized water for 2 min × 3 times.
[0058] (3) Antigen retrieval: Add antigen retrieval solution [1mM EDTA, 10mM Tris buffer (pH 8.0)] and pressure cook for 3 minutes. When the pressure cooker temperature drops to about 90℃, open the pressure cooker, remove the slices, and then allow them to cool naturally to room temperature. Soak in deionized water for 2 minutes × 3 times.
[0059] (4) Inactivation: Use 3% hydrogen peroxide to inactivate endogenous peroxidase in tissues, let stand at room temperature for 15 min, and soak in deionized water for 2 min × 3 times.
[0060] (5) Draw a border around the tissue with an immunohistochemical pen, and wash with 0.1% PBST for 2 min × 1 time.
[0061] (6) Incubation with primary antibody: Add 200 μl of diluted monoclonal antibody (0.35 μg / mL) secreted by hybridoma cell line OTI9B1 and place in a humidified chamber. Incubate at 37°C for 60 min. Wash with 0.1% PBST for 2 min × 3 times.
[0062] (7) Incubation with secondary antibody: Add 100 μl of secondary antibody PV-8000 and incubate at 37℃ for 30 min. Wash with 0.1% PBST for 2 min × 3 times.
[0063] (8) DAB color development: Add 120 μl of DAB color development solution, let stand at room temperature for 5 min, rinse with tap water to stop the color development, and rinse 3 times with tap water.
[0064] (9) Hematoxylin counterstaining, differentiation, and blueing: Let the stain stand in the hematoxylin solution for 10-120 seconds, rinse three times with tap water to stop the color development, differentiate in 1% hydrochloric acid-ethanol solution, rinse three times with tap water to stop the differentiation, then place in freshly boiled pH 8.0 Tris-EDTA disodium solution for blueing, and then place in room temperature pH 9.0 Tris-EDTA disodium solution for a few seconds, rinsing three times with tap water. Observe the staining under a microscope. If normal, the process is complete and the hematoxylin staining solution is recovered; if differentiation is excessive, the above steps must be repeated until the staining is satisfactory.
[0065] (10) Dehydration and clearing: 75% ethanol for 1 min, 85% ethanol for 1 min, 95% ethanol for 1 min, 100% ethanol for 1 min × 3 times, xylene for 1 min × 3 times, and neutral resin for mounting.
[0066] (11) Microscopic examination, such as Figures 3-5 As shown.
[0067] 2. Experimental Results:
[0068] The anti-human PTEN monoclonal antibody secreted by the hybridoma cell line OTI9B1 was used to detect endometrial cancer, colorectal cancer, and pancreatic tissues by IHC method. Results on endometrial cancer tissue are as follows... Figure 3 As shown in the figure, the nuclei of tumor cells marked with triangles showed no signal staining, indicating a negative result, suggesting that the tumor cells do not express PTEN protein; the nuclei and cytoplasm of vascular endothelial cells and infiltrating inflammatory cells, which can be used as internal controls, showed positive staining, indicating that this case of endometrial cancer is a PTEN-deficient expression case; the results on colorectal cancer tissue are as follows. Figure 4As shown, the tumor cells marked with triangles are negative, while those marked with arrows 1 and 2, representing glandular epithelial cells and stromal cells, are positive. The staining results indicate a lack of PTEN protein expression in this colorectal cancer case. The results in the pancreatic tissue are as follows... Figure 5 As shown, pancreatic acinar epithelium and islet cells all showed positive expression, consistent with the expression pattern of PTEN. The monoclonal antibody exhibited good staining effect at a concentration of 0.35 μg / mL. The experimental results indicate that the anti-human PTEN monoclonal antibody of the present invention has good specificity and sensitivity.
[0069] The above results indicate that the anti-human PTEN monoclonal antibody secreted by the hybridoma cell line OTI9B1 described in this invention has high specificity and sensitivity: in PTEN-deficient endometrial cancer, tumor cells show negative expression, while stromal cells, serving as an internal control, show positive expression; in PTEN-deficient colorectal cancer, tumor cells show negative expression, while glandular epithelial cells and stromal cells both show positive expression; in pancreatic tissue, pancreatic acinar epithelium, islet cells, etc., all show positive expression, consistent with the PTEN expression pattern. Therefore, the anti-human PTEN monoclonal antibody secreted by the hybridoma cell line OTI9B1 can be used for immunohistochemical detection to identify various tissues related to PTEN protein expression.
[0070] The above specific embodiments are used to explain and illustrate the present invention, and are only preferred embodiments of the present invention, and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made to the present invention within the spirit and principles of the present invention shall fall within the protection scope of the present invention.
[0071]
Claims
1. A hybridoma cell line, characterized in that, The hybridoma cell line was named OTI9B1 and is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 45714.
2. An anti-human PTEN monoclonal antibody, characterized in that, Produced by the hybridoma cell line OTI9B1 as described in claim 1.
3. The use of the anti-human PTEN monoclonal antibody according to claim 2 in the preparation of an immunoassay tool for detecting PTEN protein.
4. The application according to claim 3, characterized in that, The immunoassay tool is a reagent kit, chip, or test strip.
5. An immunohistochemical detection kit for detecting PTEN protein, characterized in that, Including the anti-human PTEN monoclonal antibody as described in claim 2.