The major gene GhFBA1 for cotton fruit branch angle and its application in regulating cotton plant architecture

Abstract

The present invention discloses a cotton fruit branch angle major gene GhFBA1 and its application in regulating cotton plant type. The present invention experimentally confirms that knocking out or overexpressing the GhFBA1 gene in cotton will significantly reduce or increase the growth angle of the cotton fruit branches, thereby changing the cotton plant type, indicating that the gene or the protein encoded by it plays an important role in controlling the cotton plant type. That is, GhFBA1 can be used as a molecular breeding tool to improve cotton germplasm, directionally reduce the angle of cotton fruit branches, and create cotton breeding materials with compact plant type and small fruit branch angle, which has important practical application significance for cotton breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and particularly relates to a cotton fruit branch angle major gene GhFBA1 and an application thereof in regulating cotton plant type. Background Art

[0002] Cotton is an important cash crop. It not only provides important natural fiber raw materials for the textile industry, but also has important uses in national defense, medicine, and the automotive industry. It has an irreplaceable position in the development of the national economy. Xinjiang has become my country's largest cotton production base, and the area of ​​machine-picked cotton in the region has achieved rapid growth. The rate of machine-picking cotton in the main production areas in northern Xinjiang has exceeded 90%.

[0003] For many years, "dense planting, early cultivation, and integration of agricultural machinery and agronomy" have been important technical approaches to high yield and high efficiency in Xinjiang's cotton-producing areas. Cultivating high-density, evenly distributed, and uniform high-yield populations and making full use of light energy in the early and middle stages of cotton growth is one of the important ways to promote early maturity and high yield of Xinjiang cotton. On the other hand, the implementation of cotton machine picking has become the only way for the sustainable development of the cotton planting industry. The breeding of new cotton varieties suitable for machine picking needs to focus on plant type breeding on the basis of taking into account yield, quality, early maturity, resistance, etc., and the breeding difficulty is relatively large.

[0004] The fruit branch angle is an important plant trait of cotton. It is an important factor affecting the light intensity and hull formation rate within the colony. The canopy with a smaller angle of the upper fruit branch can converge the light-receiving part of the upper cotton, so that the light reaches the middle and lower parts of the cotton canopy, thereby increasing the utilization rate of light energy and improving cotton yield. At the same time, the fruit branch angle is also one of the important traits required for machine-picked cotton breeding. Therefore, identifying the regulatory genes related to the cotton fruit branch angle is very important for the targeted improvement of cotton plant type. Summary of the invention

[0005] The purpose of the present invention is to provide an application of the cotton gene GhFBA1 in regulating cotton plant type, thereby solving the problems encountered in the prior art in cultivating cotton varieties with compact plant type and suitable mechanical harvesting characteristics.

[0006] One of the purposes of the present invention is to provide an application of the GhFBA1 gene in regulating cotton plant type traits and / or cotton breeding. The coding region sequence of the GhFBA1 gene is shown in SEQ ID NO.2.

[0007] Furthermore, the genomic nucleotide sequence of the GhFBA1 gene is shown as SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO.3.

[0008] Furthermore, the plant is cotton, and the plant traits include the growth angle of fruit branches.

[0009] The second object of the present invention is to provide a method for regulating cotton plant type by overexpressing or knocking down the GhFBA1 gene, and thereby regulating the cotton plant type. The nucleotide sequence of the GhFBA1 gene is shown in SE Q ID NO.1.

[0010] Furthermore, the knockdown is to knock out the GhFBA1 gene in cotton using CRISPR / Cas9-mediated gene editing technology or RNAi technology, thereby causing the cotton to exhibit a phenotype in which the growth angle of the fruit branches is significantly reduced.

[0011] Furthermore, the method includes: constructing a CRISPR / Cas9 gene editing vector or RNAi vector of the GhFBA1 gene, transforming it into cotton plants, and then obtaining cotton plants with stably inherited GhFBA1 gene deletion or reduced gene expression, which show a phenotype of significantly reduced fruit branch growth angle.

[0012] Furthermore, the sequences shown in SEQ ID NO.8 and SEQ ID NO.9 in the GhFBA1 gene were selected as targets for the construction of CRISPR / Cas9 gene editing vectors or RNAi vectors.

[0013] The third object of the present invention is to provide a method for breeding cotton varieties with compact plant type and small branch angle, comprising: constructing a CRISPR / Cas9 gene editing vector or RNAi vector of the GhFBA1 gene, transforming it into cotton plants, and obtaining cotton plants with stably inherited GhFBA1 gene deletion or reduced gene expression, which show a phenotype of significantly reduced fruit branch growth angle.

[0014] Furthermore, the nucleotide sequence of the GhFBA1 gene is shown in SEQ ID NO.1.

[0015] Furthermore, the sequences shown in SEQ ID NO.8 and SEQ ID NO.9 in the GhFBA1 gene were selected as targets for the construction of CRISPR / Cas9 gene editing vectors or RNAi vectors.

[0016] Beneficial effects:

[0017] The present invention identifies the main effect gene GhFBA1 that controls the size of the fruit branch angle of cotton through the map-based cloning technology, and further confirms that the knockout or overexpression of the GhFBA1 gene in cotton can significantly reduce or increase the growth angle of the fruit branch of cotton, thereby changing the cotton plant type, indicating that the gene or the protein encoded by it plays an important role in controlling the cotton plant type. The gene is of great value for theoretical research such as analyzing the molecular mechanism of the formation of the cotton fruit branch angle. The present invention can directionally reduce the angle of the cotton fruit branch to create cotton breeding materials with compact plant type and small branch angle, which has important practical application significance for cotton breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0019] Figure 1 The positional cloning of GhFBA1. A, B: Comparison of fruit branch angle phenotypes between E-mian 22 (left) and EH21 (right); C: Yellow-brown cotton introduced fragment of EH21; D: Phenotypes of fruit branch angles of E-mian 22 and EH21 in four independent environments. E, F: Fine positioning of qFBA-A11.

[0020] Figure 2 The effect of GhFBA1 gene knockout on the angle of cotton fruit branches. A, B: The fruit branch angle phenotype of GhFBA1 gene knockout lines; C: Sequencing results of GhFBA1 gene knockout target sites.

[0021] Figure 3 This is the effect of GhFBA1 gene overexpression on the angle of cotton fruit branches.

[0022] Figure 4 This is the frequency distribution histogram of cotton fruit branch angle phenotype in F2 population. DETAILED DESCRIPTION

[0023] The following examples are only used to more clearly illustrate the technical solution of the present invention, and are therefore only used as examples, and cannot be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise specified, the technical terms or scientific terms used in this application should be the common meanings understood by those skilled in the art to which the present invention belongs.

[0024] Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise specified, the reagents and materials used in the following examples are commercially available. If no specific techniques or conditions are specified in the examples, they can be carried out according to the techniques or conditions described in the literature in this area or according to the product instructions.

[0025] Example 1 Localization and Map-Based Cloning of GhFBA1

[0026] (1) Initial localization of GhFBA1

[0027] The tetraploid wild cotton species yellow-brown cotton was used as the donor parent, and the loose upland cotton variety E-mian 22 was used as the recipient parent. First, E-mian 22 was used as the female parent to cross with yellow-brown cotton to obtain the F1 generation, and then E-mian 22 was used as the recurrent male parent for 4 consecutive backcrossings, and then for 5 consecutive self-pollinations, and finally a yellow-brown cotton introgression line population containing 264 strains was obtained. Using genome resequencing, the introgression fragments of these 264 yellow-brown cotton introgression lines were identified, and a total of 1,662 yellow-brown cotton chromosome introduction fragments were identified, separating the yellow-brown cotton genome into 2,341 recombinant modules.

[0028] The fruit branch angle traits of the yellow-brown cotton introgression line population were investigated in four independent environments (Wuhan in 2017, Wuhan in 2018, Shihezi in 2017, and Shihezi in 2018). Combined with the genotype of the introgression line population, an environmentally stable main effect locus of fruit branch angle, qFBA-A11, was detected. The allelic variation from yellow-brown cotton can reduce the fruit branch angle by 30%.

[0029] (2) Fine localization and map-based cloning of GhFBA1

[0030] The introgression line EH21 (fruit branch angle of about 45°) with the corresponding introduced fragment and the recurrent parent E-Mian 22 (fruit branch angle of about 63°) were crossed and selfed to obtain the F2 generation segregating population (1364 plants). The fruit branch angle of each plant was investigated and measured at maturity. The results showed that the fruit branch angle of each plant in the F2 population was between 30° and 80°, and showed a bimodal distribution ( Figure 4 ), of which 334 plants had small angles (less than 53°) and 943 plants had large angles (greater than 57°), which was consistent with the separation ratio of 3:1 (χ 2 =0.91, P>0.05)( Figure 1 ). This indicates that the branch angle trait of EH21 is controlled by a pair of dominant genes.

[0031] Using the resequencing data of EH21, 40 InDel markers (marker names GhA11-1-GhA11-40) were developed in the candidate interval of qFBA-A11, corresponding to the reference genome A11 chromosome 9.57Mb to 10.84Mb. These markers were used to identify the genotypes of 1623 individuals in the F2 population, and 68 different heterozygous recombinant individuals were obtained. The F2 derived from these recombinant individuals was further characterized. 2:3 The fruit branch angle phenotype of the family was identified, and the candidate gene of qFBA-A11 was further located between the two markers GhA11-34 and GhA11-40 ( Figure 1 ), corresponding to chromosome A11 9.95Mb to 10.12Mb. At the same time, markers GhA11-34 and GhA11-40 can be used as tightly linked molecular markers of the lateral branch angle gene for molecular marker-assisted selection breeding. GhA11-34 and GhA11-40 marker sequences:

[0032] GhA11-34F:5'ATGCCTTTCTTTTGTCTCTATGGT 3'(SEQ ID NO.4)

[0033] GhA11-34R: 5'TGATGAAAGAATGGAGACATACAC 3' (SEQ ID NO.5)

[0034] GhA11-40F:5'GAAGCAATAAAAGCATAGGAAAG 3'(SEQ ID NO.6)

[0035] GhA11-40R:5'AAAATCAATGCTGGCACTATGTA 3'(SEQ ID NO.7)

[0036] By analyzing the variation of candidate genes in the interval, it was found that EH21 had only one transposon insertion in the Ghir_A11G010710 gene in the candidate interval, which resulted in the deletion of the Ghir_A11G010710 gene in yellow-brown cotton and its corresponding introduction line, named GhFBA1. The corresponding genomic sequence of GhFBA1 is SEQ ID NO.1, the corresponding CDS sequence is SEQ ID NO.2, and the corresponding protein sequence is SEQ ID NO.3.

[0037] Example 2 Knockout experiment of GhFBA1 in cotton

[0038] (1) Vector construction

[0039] According to the genomic sequence (SEQ ID NO.1) and CDS sequence (SEQ ID NO.2) of GhFBA1, two CRISPR / Cas9 target sites were designed at its first exon, with the sequences: TTGCAATTGACTC CAATACA (SEQ ID NO.8) and GCACTGGTTGACATGCTGGA (SEQ ID NO.9). According to the target sequence, corresponding primers were designed to construct the CRISPR vector of the GhFBA1 gene, specifically:

[0040] cFBA1-1as: 5'TGTATTGGAGTCAATTGCAAtgcaccagccgggaat3' (SEQ ID NO. 10);

[0041] cFBA1-1s: 5'TTGCAATTGACTCCAATACAgttttagagctagaaata 3' (SEQ ID NO. 11);

[0042] cFBA1-2as: 5'TCCAGCATGTCAACCAGTGCtgcaccagccgggaat3' (SEQ ID NO. 12);

[0043] inf cFBA1-2as: 5'ttctagctctaaaacTCCAGCATGTCAACCAGTGC3' (SEQ ID NO. 13).

[0044] First, the GhFBA1-gRNA sequence (SEQ ID NO.14) driven by the GhU6.7 promoter was obtained by the Overlapping PCR method (see Zhang, Jun et al. "High efficient multisites genome editing in allotetraploid cotton (Gossypium hirsutum) using CRISPR / Cas9 system." Plant Biotechnology Journal 16.1 (2018): 137-150.) and ligated to the pRGEB32-GhU6.7 vector using T4 DNA ligase (see Zhang, Jun et al. "High efficient multisites genome editing in allotetraploid cotton (Gossypium hirsutum) using CRISPR / Cas9 system." Plant Biotechnology Journal 16.1 (2018): 137-150.) to obtain the knockout vector of the Gh FBA1 gene.

[0045] (2) Agrobacterium-mediated genetic transformation of cotton

[0046] A. Sterile seedling culture: Select seeds with full grains and normal development (variety Jin668), peel off the cottonseed seed coat, soak in 2% sodium hypochlorite solution for 10 minutes, then rinse with sterile water for more than 3 times, inoculate on sterile seedling culture medium, and insert the roots into the culture medium for support after the seeds turn white. Seal the culture medium and culture it in a dark incubator at 28℃ for 5-6 days.

[0047] B. Cut the hypocotyls into small pieces, infect with activated Agrobacterium containing the GhFBA1 knockout vector, discard the bacterial solution, and blow dry; spread the hypocotyls flat on co-culture medium (MS medium + 2,4-D 0.1 mg / L + KT 0.1 mg / L + 30 g / L glucose + 2.6 g / L Phytagel, pH: 5.85-5.95) with filter paper, and culture in the dark in a constant temperature incubator at 20°C for 36-48 hours;

[0048] C. Obtaining regenerated materials: The infected hypocotyls were inoculated into DK callus induction medium (MS medium + 2,4-D 0.1 mg / L + KT 0.1 mg / L + 30 g / L glucose + 2.6 g / L Phytagel + kanamycin 50 mg / L + cephalosporin 400 mg / L, pH: 5.85-5.95). Cultured in a light culture room at 28°C (16 h of light + 8 h of darkness), subcultured with fresh callus induction medium every 20-30 days.

[0049] D. When the callus tissue grows into rice-like particles, it is transferred to differentiation medium (MS medium + IBA 0.5 mg / L + KT0.1 mg / L + glutamine 1.0 g / L + asparagine 0.5 g / L + 30 g / L glucose + 2.6 g / L Phytagel, pH: 6.1-6.2) and further differentiated into embryoids.

[0050] E. The differentiated seedlings were subcultured to rooting medium (1 / 2MS medium + 15 g / L glucose + 2.6 g / L Hytagel, pH: 6.1-6.2) until they grew into well-rooted seedlings.

[0051] (3) Identification and phenotype of GhFBA1 knockout offspring

[0052] For the 15 independently transformed transgenic positive cotton lines obtained, DNA was extracted from the leaves of the T0 and T1 transgenic positive plants, and primers (SEQ ID NO.15: F: 5'-GAAAAGACTTGTGCT TTATGTGCAG-3'; SEQ ID NO.16: R: 5'-AGGATCGAAACCGAAGGTGC-3') were designed to PCR amplify the gene sequence of GhFBA1. By Sanger sequencing, homozygous mutants of GhFBA1 gene knockout GhFBA1_KO-1 to KO-9 were screened for field phenotypic identification. After cotton was harvested, the fruit branch angle, leaf branch angle and leaf angle of the above GhFBA1 gene knockout lines GhFBA1_KO-1 to KO-9 and wild-type Jin668 plants were measured and counted. The results are shown in Figure 2 .

[0053] Depend on Figure 2 It can be seen that the fruit branch angle of the GhFBA1 knockout line is significantly lower than that of the wild-type control plant. The main agronomic phenotypes of the five high-generation knockout lines were further investigated in the field. The results are shown in Table 1. The three yield traits (effective boll number, single boll weight, lint percentage) and five fiber quality traits investigated were not significantly different from those of the transgenic recipients, indicating that the knockout of GhFBA1 can reduce the angle of cotton fruit branches in a targeted manner.

[0054] Table 1 Main agronomic phenotypes of GhFBA1 gene knockout plants

[0055]

[0056]

[0057] Example 3: Overexpression experiment of GhFBA1 in cotton

[0058] (1) Construction of overexpression vector

[0059] A pair of primers was designed based on the coding sequence of GhFBA1. The primers were used to amplify the GhF BA1 sequence in E-cotton No. 22, and the product was detected by agarose gel electrophoresis. The recovered target product was connected to the overexpression vector pK2GW7, and the recombinant plasmid with correct sequencing was named pK2GW7-FBA1. The recombinant plasmid was transformed into Agrobacterium competent cells and used to transform the cotton transgenic receptor Jin668.

[0060] (2) Genetic transformation

[0061] The genetic transformation method is the same as in Example 2.

[0062] (3) Identification and phenotype of GhFBA1 overexpressing offspring

[0063] For the 8 independently transformed transgenic positive cotton lines obtained, DNA was extracted from the leaves of T0 and T1 transgenic positive plants, and primers (SEQ ID NO.17: 5'-TCCCACTATCCTTCGCA AGAC-3'; SEQ ID NO.18: 5'-TCAAACCTCAGCAAGATCTGGCGAT-3') were designed to PCR amplify the 35S promoter and GhFBA1 gene sequence. By Sanger sequencing, homozygous mutants GhFBA1_OE-1 to 5 containing GhFBA1 overexpression elements were screened for field phenotypic identification. After cotton was harvested, the fruit branch angles of GhFBA1_OE-1 to 5 and wild-type Jin668 plants were measured and counted. The results are shown in Table 1. Figure 3 .Depend on Figure 3 It can be seen that the fruit branch angle of the strain overexpressing the GhFBA1 gene is significantly larger than that of the wild-type control plant.

[0064] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, the technical solution of the present invention can be modified and changed in many simple ways, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. A method for reducing the angle of fruit branches of upland cotton Jin668, characterized in that: The CRISPR / Cas9-mediated gene editing technology is used to inhibit the expression of the GhFBA1 gene in upland cotton Jin668, thereby reducing the angle of the fruit branches of upland cotton Jin668, wherein the nucleotide sequence of the GhFBA1 gene is shown in SEQ ID NO.1, and the method comprises: (1) Vector construction According to the genomic sequence and CDS sequence of GhFBA1, two CRISPR / Cas9 target sites were designed at its first exon, with the sequences: TTGCAATTGACTC CAATACA and GCACTGGTTGACATGCTGGA. According to the target sequence, corresponding primers were designed to construct the CRISPR vector of the GhFBA1 gene, including: cFBA1-1as: 5'-TGTATTGGAGTCAATTGCAAtgcaccagccgggaat-3'; cFBA1-1s: 5'-TTGCAATTGACTCCAATACAgttttagagctagaaata-3'; cFBA1-2as: 5'-TCCAGCATGTCAACCAGTGCtgcaccagccgggaat-3'; inf cFBA1-2as:5'-ttctagctctaaaacTCCAGCATGTCAACCAGTGC-3'; The GhFBA1-gRNA sequence driven by the GhU6.7 promoter as shown in SEQ ID NO.14 was obtained, and connected to the pRGEB32-GhU6.7 vector using T4 DNA ligase to obtain a knockout vector for the Gh FBA1 gene; (2) Agrobacterium-mediated genetic transformation of cotton A. Aseptic seedling culture: Select seeds with full grains and normal development, peel off the seed coat, soak in 2% sodium hypochlorite solution for 10 minutes, then rinse with sterile water for more than 3 times, inoculate on sterile seedling culture medium, and insert the roots into the culture medium to support the seedlings after the seeds turn white. Seal the culture medium and culture it in a dark incubator at 28℃ for 5-6 days; B. Cut the hypocotyl into small pieces, infect with activated Agrobacterium containing the GhFBA1 knockout vector, discard the bacterial solution, and blow dry; spread the hypocotyl on a co-cultivation medium with filter paper, wherein the co-cultivation medium consists of MS medium, 2,4-D 0.1 mg / L, KT 0.1 mg / L, glucose 30 g / L, Phytagel 2.6 g / L, pH: 5.85-5.95, and culture in a constant temperature incubator at 20°C for 36-48 hours in the dark; C. Obtaining regenerated materials: The infected hypocotyls were inoculated into DK callus induction medium, which consisted of MS medium, 0.1 mg / L 2,4-D, 0.1 mg / L KT, 30 g / L glucose, 2.6 g / L Phytagel, 50 mg / L kanamycin, and 400 mg / L cephalosporin, with a pH of 5.85-5.

95. The culture was carried out in a light culture room at 28°C, with 16 hours of light and 8 hours of darkness, and subcultured with fresh callus induction medium every 20-30 days; D. When the callus tissue grows into rice-like particles, it is transferred to a differentiation medium, wherein the differentiation medium consists of MS medium, 0.5 mg / L IBA, 0.1 mg / L KT, 1.0 g / L glutamine, 0.5 g / L asparagine, 30 g / L glucose, and 2.6 g / L Phytagel, with a pH of 6.1 to 6.2, and further differentiated into embryoids; E. The differentiated seedlings are subcultured to a rooting medium, wherein the rooting medium is composed of 1 / 2MS medium, 15 g / L glucose, and 2.6 g / L Phytagel, with a pH of 6.1 to 6.2, until they grow into seedlings with good rooting; (3) Identification and phenotype of GhFBA1 knockout offspring For the 15 independently transformed transgenic positive cotton lines obtained, DNA was extracted from the leaves of T0 and T1 transgenic positive plants, and primers were designed: F: 5'-GAAAAGACTTGTGCT TTATGTGCAG-3'; R: 5'-AGGATCGAAACCGAAGGTGC-3', PCR amplification of the GhFBA1 gene sequence, and Sanger sequencing was used to screen out homozygous mutants of the GhFBA1 gene knockout for field phenotypic identification.

Images