Biomarkers for assessing the risk of relapse after treatment of multiple myeloma and their applications

Abstract

The present invention discloses a biomarker for assessing the risk of relapse after treatment of multiple myeloma and its application. The biomarker is platelet activation factor. Through research, it is found that PAF in the blood of multiple myeloma patients is involved in the proliferation, adhesion, invasion and metastasis of tumor cells. Therefore, by detecting the expression level of PAF in the patient's blood, the relapse risk of multiple myeloma patients can be effectively assessed.

Description

Technical Field

[0001] The present invention relates to a biomarker for assessing the risk of relapse of multiple myeloma and its application, and in particular to a biomarker for assessing the risk of relapse of multiple myeloma after chimeric antigen receptor T cell therapy and the application of the biomarker in a detection product, belonging to the field of biomedicine. Background Art

[0002] Multiple myeloma (MM) is a malignant disease characterized by abnormal proliferation of clonal plasma cells. It is the second largest hematological malignancy after lymphoma, accounting for about 10% of hematological malignancies. In most cases, there is secretion of monoclonal immunoglobulin or its fragments (M protein), which leads to damage to related organ functions. Common symptoms include increased blood calcium, renal damage, anemia, bone disease, and secondary amyloidosis. In recent years, with the widespread use of new drugs such as proteasome inhibitors, immunomodulatory drugs, and monoclonal antibodies, the prognosis of MM patients has been greatly improved, and the median survival has been extended from 3-5 years to the current 8-10 years. However, multiple myeloma is still incurable; especially for refractory / relapsed MM (RRMM) and extramedullary lesions, the efficacy of patients is extremely poor.

[0003] Chimeric antigen receptor T cells (CAR-T) are a new treatment model, and many domestic centers are conducting clinical studies on CAR-T treatment for RRMM. CAR-T treatment for MM is highly effective in the early stages, but most patients still face the problem of relapse. Therefore, in-depth exploration of the causes of MM cell relapse after CAR-T treatment and finding the key factors for targeted intervention are expected to further improve the efficacy of CAR-T treatment for MM.

[0004] PAF, platelet activating factor, also known as PAF-acether or AGEPC (acetylglycerol ether-phosphorylcholine), is a potent phospholipid activator and mediator of many leukocyte functions, platelet aggregation and degranulation, inflammation, and anaphylactic shock. It is also involved in changes in vascular permeability, oxidative burst, chemotaxis of leukocytes, and enhancement of arachidonic acid metabolism in phagocytes. PAF is produced by a variety of cells, especially those involved in host defense, such as platelets, endothelial cells, neutrophils, monocytes, and macrophages. Summary of the invention

[0005] The technical problem to be solved by the present invention is to determine a marker that can evaluate the risk of relapse of multiple myeloma after treatment.

[0006] A biomarker for assessing the risk of relapse after treatment of multiple myeloma, wherein the biomarker is platelet activating factor.

[0007] In the above technical solution, the multiple myeloma is treated with chimeric antigen receptor T cells.

[0008] In the above technical solution, the biomarker uses blood as a biological sample. Platelet activating factor expression uses platelet activating factor receptor as an action pathway, and platelet activating factor receptor uses at least one of myeloma cells 8226 cells, H929 cells, U266 cells, and OPM-2 cells as a biological sample. U266 cells and OPM-2 cells are the best.

[0009] The invention discloses a reagent for detecting the expression of a biologically active molecule in preparing a product for assessing the risk of relapse of multiple myeloma, wherein the biologically active molecule is a platelet activating factor.

[0010] In the above technical solution, the reagent includes a reagent for detecting the expression level of platelet activating factor by enzyme-linked immunosorbent assay.

[0011] The use of a reagent for detecting the expression of a bioactive molecule receptor in the preparation of a product for assessing the risk of relapse of multiple myeloma, wherein the bioactive molecule receptor is a platelet activating factor receptor, and the reagent includes a reagent for detecting the expression level of the platelet activating factor receptor by fluorescent quantitative PCR. The reagent includes a reagent for detecting the expression level of the platelet activating factor receptor in 8226 cells and / or H929 cells and / or U266 cells and / or OPM-2 cells by fluorescent quantitative PCR. The reagent includes primers for H-GAPDH and H-PAFR. Among them, the forward sequence of the H-GAPDH primer is CATCATCCCTGCCTCTACTGG, and the reverse sequence is GTGGGTGTCGCTGTTGAAGTC; the forward sequence of the H-PAFR primer is ATTCCACCAGGCCATTAATG, and the reverse sequence is GGTTGAATGGCACAACCACTT.

[0012] In this protocol, PAF was detected by enzyme-linked immunosorbent assay (ELISA), PAF receptor (PAFR) expression level in cells was detected by real-time quantitative PCR, the effects of PAF on cell proliferation and cell adhesion were detected by CCK-8, and the effects of PAF on cell invasion and migration were detected by Transwell assay.

[0013] The expression of PAF in the plasma of patients with relapsed and remitted MM after CAR-T treatment was detected by enzyme-linked immunosorbent assay, and the expression levels of PAFR in normal human mononuclear cells (PBMC) and MM cell lines were compared by qPCR. For the cell function experiment, a PAF blank group and a PAF stimulation group were set up, and the PAF stimulation group was stimulated with 100 nmol of PAF for 48 hours. CCK-8 was used to detect cell proliferation and cell adhesion in the control group and the PAF stimulation group, and the Transwell method was used to detect the invasion and migration ability of the two groups of cells. The study found that the PAF level in patients with MM relapse after CAR-T treatment was significantly higher than that in patients with remission after CAR-T treatment; compared with PBMC, the relative expression level of PAFR gene in 8226, H929, U266, and OPM-2 cell lines was significantly increased (P < 0.05), among which U266 and OPM-2 increased more significantly. U266 and OPM-2 were selected for cell function experiments. CCK8 experiments showed that after 100 nmol PAF stimulation of U266 and OPM-2 cells for 48 hours, the proliferation and adhesion abilities of cells were significantly enhanced. Invasion and migration experiments showed that the number of cells penetrating the membrane in the PAF stimulation group gradually increased, which was significantly higher than that in the control group.

[0014] The increased PAF synthesis in the inflammatory microenvironment after CAR-T treatment of MM may have the effect of promoting MM recurrence, which can promote MM cell proliferation, adhesion, invasion and migration through the PAF / PAFR pathway. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The expression of PAF in the plasma of MM patients with relapse and remission after CAR-T treatment detected by enzyme-linked immunosorbent assay (ELISA) in the present invention is shown, wherein *** indicates P < 0.001.

[0016] Figure 2 The present invention shows the expression level of PAFR in normal human mononuclear cells (PBMC) and MM cell lines 8226, H929, U266, and OPM-2 by qPCR, wherein ** indicates P<0.01, and *** indicates P<0.001.

[0017] Figure 3 The results show that the present invention uses CCK-8 to detect cell proliferation and cell adhesion in the control group and the PAF stimulation group, wherein *** indicates P < 0.001.

[0018] Figure 4 The figure shows the changes in the counts of migrating cells detected by the Transwell method in the present invention after stimulation with 100 nmol PAF for 48 hours in U266 and OPM-2 cells, wherein *** indicates P < 0.001.

[0019] Figure 5 The present invention shows the changes in the migration ability of U266 and OPM-2 cells detected by the Transwell method after being stimulated with 100 nmol PAF for 48 hours, and the microscope magnification is ×100.

[0020] Figure 6 The figure shows the changes in the invasion cell counts of U266 and OPM-2 cells detected by the Transwell method after stimulation with 100 nmol PAF for 48 hours. *** indicates P < 0.001.

[0021] Figure 7 The present invention shows the changes in the invasive cell abilities of U266 and OPM-2 cells detected by the Transwell method after stimulation with 100 nmol PAF for 48 hours, with a microscope magnification of ×100. DETAILED DESCRIPTION

[0022] The present invention is described in detail below in conjunction with the accompanying drawings and specific embodiments. The test methods without specific conditions in the embodiments are processed according to conventional conditions.

[0023] The expression of PAF in the plasma of MM patients with relapse and remission after CAR-T treatment was detected by enzyme-linked immunosorbent assay, and it was found that the PAF level in MM patients with relapse after CAR-T treatment was significantly higher than that in patients with remission after CAR-T treatment.

[0024] The human platelet-activating factor enzyme-linked immunosorbent assay kit used in this protocol was purchased from Shanghai Jianglai Biotechnology Co., Ltd., catalog number: JL10406, specification: 96T / 48T.

[0025] A1: The plasma of 25 patients with multiple myeloma treated with CAR-T was collected, including 10 patients with relapse and 15 patients with remission. The plasma was centrifuged at 1000×g for 15 minutes at 2-8℃, and the supernatant was used for detection.

[0026] A2: After equilibration at room temperature for 10 minutes, take out the required strips from the aluminum foil bag and seal the remaining strips in a ziplock bag and place them back at 4°C.

[0027] A3: Sample addition: Add 50 μl of sample or standard of different concentrations to the corresponding wells, add 50 μl of universal diluent to the blank wells, and then add 50 μl of HRP-antigen working solution to each well. Cover with sealing film and incubate at 37℃ for 1 hour.

[0028] A4: Wash the plate: discard the liquid, add 300μL 1x washing solution to each well, let it stand for 1 minute, shake off the washing solution, pat dry on absorbent paper, and repeat this washing process 5 times.

[0029] A5: Add substrate: Add 90 μL of substrate (TMB) to each well, cover with sealing film, and incubate at 37°C in the dark for 15 minutes.

[0030] A6: Add stop solution: Add 50 μL of stop solution to each well and immediately measure the OD value of each well at a wavelength of 450 nm.

[0031] A7: Result judgment: 1. Calculate the average OD value of the standard and sample duplicate wells. Use concentration as the horizontal axis and OD value as the vertical axis to draw the standard curve of the four-parameter logistic function on the double logarithmic coordinate paper (remove the value of the blank group when drawing the graph). 2. If the sample OD value is higher than the upper limit of the standard curve, it should be appropriately diluted and re-measured and multiplied by the corresponding dilution factor when calculating the sample concentration.

[0032] A8: Statistical analysis: SPSS26.0 and Graphpad Prism5 software were used for statistical analysis and drawing. The two groups of independent data met the normality test and variance homogeneity test, and the independent sample T test was used to compare the PAF levels in the relapse and remission groups.

[0033] A9: ELISA test found that the PAF level in 10 patients with MM relapse after CAR-T treatment was significantly higher than that in 15 patients with MM remission after CAR-T treatment. Figure 1 , ***P<0.001.

[0034] The expression levels of PAFR in normal human mononuclear cells (PBMC) and MM cell lines were compared by fluorescence quantitative PCR (qPCR). The qPCR results showed that compared with PBMC, the expression levels of PAFR gene in 8226, H929, U266, and OPM-2 cell lines were significantly increased (P < 0.05), among which the increases in U266 and OPM-2 were more significant.

[0035] TRIpure Total RNA Extraction Reagent, EntiLink TM 1st StrandcDNA Synthesis Super Mix, EnTurbo TM SYBR Green PCR SuperMix was purchased from ELKBiotechnology.

[0036] B1: PBMC extraction:

[0037] 1. Add an appropriate amount of Ficoll to a 15ml centrifuge tube; 2. Invert several times to mix the blood sample, keep the 15ml centrifuge tube slightly tilted, and gently add the blood sample to it with a pipette. The sample is divided into two clear layers, the upper layer is the blood sample, and the lower layer is Ficoll; 3. Centrifuge at 2000rpm for 20min, and the liquid in the tube is divided into three obvious layers; 4. Absorb the middle mist layer and transfer it to a 2ml Free-RNAse centrifuge tube; 5. Centrifuge at 1000rpm for 5min and pour out the liquid in the tube; 6. Add 1ml PBS to the centrifuge tube, blow and mix, centrifuge at 1000rpm for 5min, discard the supernatant, and repeat washing once; 7. Absorb 1ml Trizol, blow and mix, place the centrifuge tube on ice for 5min, and prepare for RNA extraction or store in a -80℃ refrigerator for later use. PBMC is extracted from normal human blood.

[0038] B2: RNA extraction (PBMC and MM cells): 1. Collect cells by low-speed centrifugation, add an appropriate volume of cooled PBS buffer to resuspend, centrifuge at 300g for 10 minutes, and remove the supernatant. Repeat the above operation twice to collect the cell pellet. Add 1mL TRIpure solution, repeatedly blow the cells into TRIpure, add 250μL chloroform, mix well, and let stand on ice for 5 minutes. 2. Centrifuge the mixture at 4℃, 10000g, and 10 minutes. Carefully aspirate 500μL of supernatant into a 1.5mL EP tube in the clean bench, add an equal volume of 4℃ pre-cooled isopropanol, invert to mix, and let stand at -20℃ for 15 minutes. 3. Centrifuge the solution at 4°C, 10,000 g, for 10 min, carefully discard the liquid, add 1 mL of 75% ethanol precooled at 4°C, invert several times to wash the RNA precipitate, centrifuge at 4°C, 10,000 g, for 5 min, discard the liquid, dry in a clean bench for several minutes to evaporate the ethanol, add 100 μL RNase-Free Water to fully dissolve the RNA.

[0039] B3: First-strand cDNA synthesis (PBMC and MM cells):

[0040] First-strand cDNA synthesis was performed using EntiLink TM 1st Strand cDNA Synthesis Super Mix (ELK Biotechnology, EQ031) was used. The main steps are as follows:

[0041] 1. Prepare the following reaction mixture on ice.

[0042]

[0043] 2. Reverse Transcription Procedure

[0044]

[0045] B4: Real-time fluorescence quantitative PCR was performed on the QuantStudio 6Flex System PCR instrument from Life Technologies. Each sample was replicated in triplicate using EnTurbo TM SYBR Green PCR SuperMix Kit (ELK Biotechnology, EQ001):

[0046] 1. The reaction procedure is:

[0047] Pre-denaturation: 95°C, 30s;

[0048] Cycle 40 times: 95°C, 10 s → 58°C, 30 s → 72°C, 30 s;

[0049] Melting curve: Instrument default settings.

[0050] 2. The reaction system is:

[0051]

[0052] B5: Data Analysis Methods

[0053] ΔΔCT method:

[0054] A = CT (target gene, experimental sample) - CT (internal standard gene, experimental sample)

[0055] B = CT (target gene, control sample) - CT (internal standard gene, control sample)

[0056] K=AB

[0057] Expression multiple = 2 -K

[0058] B6: qPCR primer pair expression levels were determined using a standard curve, and all readings were within the standard curve range. To confirm the specificity of the PCR product, melting curve analysis and subsequent PCR product cloning and sequencing were performed. All reactions were performed in triplicate. The primer sequences used are as follows:

[0059]

[0060]

[0061] B7: Statistical analysis: SPSS26.0 and Graphpad Prism5 software were used for statistical analysis and drawing.

[0062] If the quantitative data are normally distributed, they are expressed as mean ± standard error. If they are non-normally distributed, they are expressed as median (quartile) [M (P25, P75)]. When P < 0.05, the results are considered to be statistically significant.

[0063] B8: qPCR results showed that compared with PBMC, the expression level of PAFR gene in 8226, H929, U266 and OPM-2 cell lines was significantly increased (P < 0.05), among which U266 and OPM-2 increased more significantly. Figure 2 .

[0064] U266 and OPM-2 were selected for cell function experiments. PAF blank group and PAF stimulation group were set up. The PAF stimulation group was stimulated with 100 nmol PAF for 48 hours. CCK-8 was used to detect cell proliferation and cell adhesion in the control group and PAF stimulation group. The CCK8 experiment showed that after 100 nmol PAF stimulation of U266 and OPM-2 cells for 48 hours, the proliferation and adhesion of cells were significantly enhanced.

[0065] The fetal bovine serum used in this protocol was purchased from Hangzhou Tianhang Biotechnology Co., Ltd.; 1640 culture medium was purchased from HyClone; PBS was purchased from Jinuo Biopharmaceutical Technology Co., Ltd.; and CCK-8 detection kit was purchased from Beyotime Biotechnology Co., Ltd.

[0066] The specific steps of the cell proliferation experiment are as follows:

[0067] 1. Replace the culture medium of each group of U266 or OPM-2 cells with serum-free basal culture medium containing 1% BSA, and starve for 12 hours. 2. Collect the suspended cells by centrifugation. Resuspend the cells in culture medium containing a certain concentration of drug PAF 100nM) to prepare a cell suspension of 2×105 cells / mL. Add 100μL of cell suspension to each well, replace the control group with a culture medium containing solvent, and set the cell-free wells with only the corresponding culture medium as the blank group. 3. Culture in a 37℃, 5% CO2 incubator for 48 hours. 4. Add 10μL of CCK-8 solution to all wells and incubate in the incubator for 1-4 hours. 5. Use an enzyme reader to measure the absorbance at 450nm.

[0068] The specific steps of the cell adhesion experiment are as follows:

[0069] 1. Use a 96-well plate, add 50uL of 30mg / L fibronectin to each well and air-dry overnight to make an FN bag. Liquefy with 20uL of 3% PBS and seal at 37 degrees for 2h. 2. Replace the culture medium of each group of U266 or OPM-2 cells with a serum-free basal culture medium containing 1% BSA, and starve for 12h. 3. Collect suspended cells by centrifugation. Resuspend the cells in a culture medium containing a certain concentration of drug PAF (100nM) to prepare a cell suspension of 2×105 cells / mL. Add 100μL of cell suspension to each well, replace the control group with a culture medium containing solvent, and set the wells without cells with only the corresponding culture medium as the blank group. 4. Incubate in a 37℃, 5% CO2 incubator for 48h. 5. Wash twice with PBS to wash away non-adherent cells. 6. Add 10μL of CCK-8 solution to all wells and incubate in the incubator for 1-4h. 7. Use an ELISA reader to measure the absorbance at 450 nm.

[0070] CCK8 experiments showed that after stimulating U266 and OPM-2 cells with 100 nmol PAF for 48 hours, the proliferation and adhesion abilities of cells were significantly enhanced. Figure 3 *** indicates P < 0.001.

[0071] U266 and OPM-2 were selected for cell function experiments. PAF blank group and PAF stimulation group were set up. The PAF stimulation group was stimulated with 100 nmol PAF for 48 hours, and the invasion and migration abilities of the two groups of cells were detected by Transwell method.

[0072] The fetal bovine serum used in this protocol was purchased from Hangzhou Tianhang Biotechnology Co., Ltd.; 1640 culture medium was purchased from HyClone; PBS was purchased from Jinuo Biopharmaceutical Technology Co., Ltd.; and crystal violet stain was purchased from Wuhan Aspen Biotechnology Co., Ltd.

[0073] The specific steps of the migration experiment are as follows:

[0074] 1. Prepare a 105 / mL suspension of U266 or OPM-2 cells treated with or without PAF (100nM, 48h), centrifuge 1mL of the cell suspension at 4℃1500rpm for 5min, and discard the supernatant. 2. Add 1mL of serum-free culture medium, pipette evenly, and then take 200μL of the cell suspension and place it in the upper chamber of the transwell. 3. Add 500μL of complete culture medium containing 10% FBS to a 24-well plate, and place the upper chamber into the plate. 4. Culture in a CO2 (5%) incubator at 37℃ for 48h. 5. Take out the upper chamber, collect the cell suspension in the lower chamber separately, centrifuge at 4℃1500rpm for 5min, and discard the supernatant. 6. Prepare the dye solution: 0.5% crystal violet solution, dilute it with PBS solution 1:4 to 0.1% crystal violet dye solution when using. 7. Staining: The cells collected in step 5 were fixed with paraformaldehyde for 20 minutes, washed twice with PBS, stained with crystal violet staining solution for 10 minutes, and washed three times with PBS. 8. Centrifuge at 4℃ and 1500rpm for 5 minutes, discard the supernatant, resuspend the cells with an appropriate amount of PBS, smear, and then take pictures and record under an inverted microscope.

[0075] The specific steps of the invasion experiment are as follows:

[0076] 1. Dilute matrigel and culture medium at a ratio of 1:3, take 50μL and add it to the transwell chamber, dry it in the incubator for later use. 2. Prepare a 105 / mL suspension of U266 or OPM-2 cells treated with or without PAF (100nM, 48h), take 1mL of cell suspension and centrifuge at 4℃1500rpm for 5min, and discard the supernatant. 3. Add 1mL of serum-free culture medium, blow evenly, take 200μL of cell suspension and put it into the upper chamber of the transwell. 4. Add 500μL of complete culture medium containing 10% FBS to the 24-well plate, and put the upper chamber into the plate. 5. Culture in a CO2 (5%) incubator at 37℃ for 48h). 6. Take out the upper chamber, collect the cell suspension in the lower chamber, centrifuge at 4℃1500rpm for 5min, and discard the supernatant. 7. Prepare staining solution: 0.5% crystal violet solution, dilute with PBS solution 1:4 to 0.1% crystal violet staining solution. 8. Staining: Fix the cells collected in step 5 with paraformaldehyde for 20 minutes, wash twice with PBS, stain with crystal violet staining solution for 10 minutes, and wash three times with PBS. 9) Centrifuge at 4℃ 1500rpm for 5 minutes, discard the supernatant, resuspend the cells with an appropriate amount of PBS, smear, and then take pictures and record under an inverted microscope.

[0077] Transwell migration and invasion experiments showed that the number of transmembrane cells in the PAF stimulation group gradually increased and was significantly higher than that in the control group. Figure 4 , Figure 5 and Figure 6 , Figure 7*** indicates P < 0.001.

Claims

1. Use of a reagent for detecting the expression of a biologically active molecule in the preparation of a product for assessing the risk of relapse of multiple myeloma, characterized in that: The bioactive molecule is platelet activating factor.

2. Use of the reagent for detecting the expression of biologically active molecules as claimed in claim 1 in the preparation of a product for assessing the risk of relapse of multiple myeloma, characterized in that: The reagents include reagents for detecting the expression level of platelet activating factor by enzyme-linked immunosorbent assay.

Images