A SNP locus associated with high yield and drought resistance in wheat and its application

Abstract

The present invention discloses a SNP site related to high yield and drought resistance of wheat and its application. The SNP site is located at the physical position 41,633,676 bp of wheat chromosome 3B, and its nucleotide polymorphism is C / T; its utility is to regulate the thousand-grain weight and / or grain length of wheat. The present invention has high practical value for high-yield and drought-resistant breeding of wheat, and lays a foundation for further cloning genes that control thousand-grain weight and grain length of wheat under multiple environments. At the same time, the present invention can be used to screen and identify drought-resistant and high-yield wheat varieties in the early stage of molecular marker-assisted selection breeding MAS, and has important scientific research and application value.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology and molecular marker-assisted breeding, and in particular to a SNP site associated with wheat thousand-grain weight and / or grain length under normal and drought environments and an application thereof. Background Art

[0002] Wheat is mainly grown in arid and semi-arid areas and is often affected by water shortages during its growing season. According to statistics, droughts cause a global wheat yield reduction of more than 10% each year, and more than millions of hectares of farmland are affected. With the intensification of global climate change, the reduction of available freshwater resources, and the impact of human activities, drought stress has become one of the important environmental factors affecting wheat production. Therefore, the development of drought-resistant related polymorphic molecular markers is of great scientific significance for the screening and identification of drought-resistant germplasm resources.

[0003] Correspondingly, thousand-grain weight and grain length are the morphological basis for wheat yield. The excellent allele types of thousand-grain weight and grain length of wheat under normal and drought environments and the development of polymorphic markers can be directly used for the creation of new drought-resistant wheat germplasm. With the development of wheat genome sequencing and assembly strategies, wheat genome sequencing has made a series of major progress, laying a good foundation for the development of wheat molecular markers. KASP (Kompetitive Allele-Specific PCR) markers, namely competitive allele-specific PCR, use FAM or HEX fluorescent groups to add to the ends of primers, and type the target sequence based on the reading judgment of the PCR terminal fluorescent signal to achieve the purpose of identifying the specific SNP (single base nucleotide polymorphism) or InDel (insertion / deletion) contained in the target allele. Compared with traditional detection technology, its operation process has the advantages of high flexibility, low cost, precision and high throughput, which can accelerate the process of molecular marker-assisted selection and realize efficient and accurate breeding of new crop varieties.

[0004] It can be seen that the development of KASP markers for identifying wheat grain weight and grain length under normal and drought environments is an important topic with both theoretical and applied value. Summary of the invention

[0005] The technical problem to be solved by the present invention is to develop a KASP marker for identifying increases in wheat grain weight and grain length under normal and drought environments in response to various deficiencies in the prior art, and based on this, to construct a series of products and technical systems for breeding high-yield, stable-yield, and drought-resistant wheat varieties.

[0006] In order to solve the above technical problems, the present invention adopts the technical solution shown below.

[0007] The invention includes a use of a wheat SNP site, wherein the SNP site is located at the physical position 41,633,676 bp of wheat chromosome 3B, and its nucleotide polymorphism is C / T; the use is to regulate the thousand-grain weight and / or grain length of wheat.

[0008] The present invention also includes another use of wheat SNP site, the SNP site is located at the physical position 41,633,676bp of wheat chromosome 3B, and its nucleotide polymorphism is C / T; the use is to develop molecular markers related to wheat thousand-grain weight and grain length.

[0009] The present invention also includes another use of wheat SNP site, the SNP site is located at the physical position 41,633,676bp of wheat chromosome 3B, and its nucleotide polymorphism is C / T; the use is to develop a KASP primer combination related to wheat thousand-grain weight and grain length.

[0010] Another use of wheat SNP loci is for breeding high-yield wheat, especially breeding drought-resistant and high-yield wheat.

[0011] The present invention also includes a gene detection kit, which includes a buffer, a template sequence, dNTPs and other necessary components for conventional gene detection, and is characterized in that the gene detection kit also includes primers or primer combinations for detecting SNP sites related to thousand-grain weight and / or grain length of wheat.

[0012] As a preferred technical solution of the present invention, the primer or primer combination specifically includes: primer A, primer B, primer C; the nucleotide sequences of the three primers are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3 respectively.

[0013] The present invention also includes a primer combination, including: primer A, primer B, primer C; the nucleotide sequences of which are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively.

[0014] The present invention also includes the use of the primer combination for identifying or assisting in identifying the thousand-grain weight and / or grain length traits of wheat in the early stage of molecular marker-assisted selection breeding (MAS).

[0015] The present invention also includes a breeding method for regulating the thousand-grain weight and / or grain length traits of wheat. In the early stage of molecular marker-assisted selection breeding (MAS), based on the primer combination described in claim 6, the SNP site of wheat located at the 41,633,676 bp physical position of wheat chromosome 3B is identified, and wheat with a homozygous cc genotype is bred as a candidate variety with relatively high thousand-grain weight and / or grain length values, and wheat with a homozygous tt genotype is bred as a candidate variety with relatively low thousand-grain weight and / or grain length values.

[0016] The present invention also includes a method for increasing wheat yield. In the early stage of molecular marker-assisted selection breeding (MAS), based on the primer combination described in claim 6, the SNP site of wheat located at the physical position 41,633,676 bp of wheat chromosome 3B is identified, and wheat with a homozygous cc genotype is selected for breeding and planting, so as to increase the wheat yield by increasing the thousand-grain weight and / or grain length of wheat.

[0017] The present invention also includes a method for maintaining or increasing wheat yield under drought stress. For a planting environment where drought stress exists or potentially exists, in the early stage of molecular marker-assisted selection breeding (MAS), based on the primer combination described in claim 6, the SNP site of wheat located at the physical position 41,633,676 bp of wheat chromosome 3B is identified, and wheat with a homozygous cc genotype is selected for breeding and planting, so as to maintain or increase the thousand-grain weight and / or grain length of wheat under drought stress environment to achieve maintenance or improvement of wheat yield.

[0018] After adopting the above technical scheme, the technical effect achieved by the present invention is as follows: see the embodiments below and their associated drawings for details. The molecular markers related to wheat thousand-grain weight and grain length provided by the present invention based on the development of SNP sites can be used to detect whether wheat varieties or strains contain sites that increase thousand-grain weight or grain length, which is of great value for high-yield and drought-resistant breeding of wheat, and lays a foundation for further cloning genes that control wheat thousand-grain weight and grain length under multiple environments. At the same time, the developed KASP molecular markers can greatly accelerate the breeding process of high-yield and drought-resistant wheat varieties, and realize the screening and identification of drought-resistant and high-yield wheat varieties in the early stage of molecular marker-assisted selection breeding (MAS), which has important scientific research and application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1:The two alleles of the QTL qTGW_GL3B.1 for thousand-grain weight and grain length in common wheat are located at the KASP primer positions on chromosome 3B. The box represents the SNP at the physical position 41,633,676bp of chromosome 3B (chip site AX-111534973), and the positions of the primers upstream and downstream of the KASP marker are marked with double underlines; the sequence in the figure is the sequence of the physical position 41,633,617-41,633,776bp of wheat chromosome 3B.

[0020] Figure 2 :Wheat variety Kasp_TGW_GL3B.1 marker detection result diagram; Specifically, after the PCR reaction is completed, the fluorescence signal is converted into an analyzable value using a fluorescence signal reader (Omega, BMG LABTECH, Germany) and a fluorescence detection system (Araya) to read the fluorescence data of the reaction product. The fluorescence scanning results are graphically displayed using the R language "ggplot" package. The C base type has FAM fluorescence, which is distributed near the x-axis; the T base type has HEX fluorescence, which is distributed near the y-axis; and samples without detection signals are distributed near the origin. DETAILED DESCRIPTION

[0021] The present invention is described in detail in the following examples. All raw materials and equipment used in the present invention are conventional commercial products and can be directly obtained through market purchase.

[0022] It should be understood that when used in the present specification and the appended claims, the term "comprising" indicates the presence of described features, wholes, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, wholes, steps, operations, elements, components and / or combinations thereof.

[0023] It should also be understood that the term “and / or” used in the specification and appended claims refers to any and all possible combinations of one or more of the associated listed items, and includes these combinations.

[0024] As used in the specification and appended claims of this application, the term "if" can be interpreted as "when" or "uponce" or "in response to determining" or "in response to detecting", depending on the context. Similarly, the phrase "if it is determined" or "if [described condition or event] is detected" can be interpreted as meaning "uponce it is determined" or "in response to determining" or "uponce [described condition or event] is detected" or "in response to detecting [described condition or event]", depending on the context.

[0025] In addition, in the description of the present application specification and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the descriptions and cannot be understood as indicating or implying relative importance.

[0026] References to "one embodiment" or "some embodiments" etc. described in the specification of this application mean that one or more embodiments of the present application include specific features, structures or characteristics described in conjunction with the embodiment. Therefore, the statements "in one embodiment", "in some embodiments", "in some other embodiments", "in some other embodiments", etc. that appear in different places in this specification do not necessarily refer to the same embodiment, but mean "one or more but not all embodiments", unless otherwise specifically emphasized in other ways. The terms "including", "comprising", "having" and their variations all mean "including but not limited to", unless otherwise specifically emphasized in other ways.

[0027] Example 1, Technical Overview

[0028] The present invention develops a KASP marker Kasp_TGW_GL3B.1 for detecting wheat grain weight and grain length (Table 1, Table 2) according to the SNP (C / T) difference sites contained in two allele types qTGW_GL3B.1a and qTGW_GL3B.1b of the common wheat thousand-grain weight and grain length related sites at the physical position 41,633,676bp of chromosome 3B (chip marker site AX-111534973, reference wheat variety Chinese Spring genome IWGSC_RefSeq_v1.0, http: / / 202.194.139.32 / jbrowse-1.12.3-release / ). Figure 1 ).

[0029] Among them, the nucleotide sequence at the physical position of chromosome 3B: 41633617-41633776 is shown in the sequence listing SEQ ID NO.4, specifically:

[0030] GGATCAAGTGGAGATGTCGGTGGCAGACTCGTGTCCTGGTCGTTGGT CGTATACTCGTC[C / T]GGATAGTAATTAACCCTCTACTTTGGGTATTTGTGC CCATCCAAACCATGTTACACCTTCAAATGATCTTTTAAAACTAGGAAATAC TCGGCAAAAAGTAG. (See SEQ ID NO. 4).

[0031] KASP markings are shown in the following table.

[0032] Table 1 Primer sequences of KASP marker Kasp_TGW_GL3B.1 for detecting wheat grain weight and grain length

[0033]

[0034] The types carrying FAM fluorescence and distributed near the x-axis are those that increase the thousand-grain weight and grain length of wheat (qTGW_GL3B.1a), while the types carrying HEX fluorescence and distributed near the y-axis are those that reduce the thousand-grain weight and grain length of wheat (qTGW_GL3B.1b).

[0035] By using 311 Chinese wheat variety resources to verify the marker under multiple years and multiple environments, it was shown that the marker can accurately type the two allele types qTGW_GL3B.1a and qTGW_GL3B.1b.

[0036] The molecular markers related to wheat thousand-grain weight and grain length provided by the present invention can be used to detect whether wheat varieties or strains contain sites that increase thousand-grain weight or grain length, which is of great value for high-yield and drought-resistant breeding of wheat, and lays a foundation for further cloning genes that control wheat thousand-grain weight and grain length under multiple environments. At the same time, the use of the developed KASP molecular markers can greatly accelerate the breeding process of high-yield and drought-resistant wheat varieties.

[0037] Example 2. Materials and methods

[0038] The following test examples of the present invention adopt conventional test methods and data statistical methods in the field of molecular biology.

[0039] The wheat variety used in the present invention is a well-known variety, which is recorded in the following reference: "Zhao Jie, Sun Lijing, Gao Huimin, Hu Mengyun, Mu Liming, Cheng Xiaohu, Wang Jianbing, Zhao Yun, Li Qianying, Wang Peinan, Li Hui, Zhang Yingjun. Genome-wide association study of yield-related traits in common wheat (Triticum aestivum L.) under normal and drought treatment conditions, Frontiers in Plant Science, 2023, 13: 1098560".

[0040] All common wheat varieties are preserved in the Wheat Research Center of the Institute of Cereals and Oils Crops, Hebei Academy of Agricultural and Forestry Sciences.

[0041] Example 3: Using KASP marker Kasp_TGW_GL3B.1 to detect different alleles of QTLqTGW_GL3B.1 regulating wheat thousand-grain weight and grain length

[0042] The KASP marker Kasp_TGW_GL3B.1 was used to detect the different allele types of the QTL qTGW_GL3B.1 regulating wheat thousand-grain weight and grain length at the physical position 41,633,676bp on chromosome 3B (chip site AX-111534973). The method was divided into the following two steps: (1) PCR amplification and (2) genotyping.

[0043] (1) PCR amplification system and procedure. Wheat leaf genomic DNA was extracted using TPS solution and dissolved in 200ul TE. DNA quality was tested using 1% agarose gel electrophoresis. The extracted DNA was required to be free of obvious impurities, with clear bands and no degradation. After the DNA concentration was measured, it was uniformly diluted to 28.3ng / μl, and PCR amplification was performed using the diluted wheat genomic DNA as a template.

[0044] Preparation of KASP marker primer working solution: KASP primers were designed based on the SNP at the chip site AX-111534973 of wheat thousand-grain weight and grain length QTL qTGW_GL3B.1. The polymorphism of this SNP site is a C / T base difference. The primer sequences are shown in Table 1. 12 μl of each of the two upstream primers (100 μM) and 30 μl of the downstream primer (100 μM) were taken, and supplemented to 100 μl with sterile ultrapure water as the primer working solution of KASP markers, and stored at 4°C for later use.

[0045] The PCR amplification system was as follows: 1.5 μl of template DNA, 0.0417 μl of primer working solution, 0.75 μl of 2×KASP Master Mix (LGC, product number: KBS-1050-112), and the reaction system was supplemented to 3 μl with sterile ultrapure water.

[0046] The PCR reaction program was as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing for 20 s (the first annealing temperature was 61°C, and the temperature was lowered by 0.6°C each cycle) for a total of 10 cycles; denaturation at 94°C for 20 s, annealing at 55°C for 1 min for a total of 26 cycles; extension at 72°C for 3 min, and storage at 4°C.

[0047] (2) Genotyping. See Appendix Figure 2After the PCR reaction was completed, the fluorescence signal was converted into an analyzable value using a fluorescence signal reader (Omega, BMGLABTECH, Germany) and a fluorescence detection system (Araya) to read the fluorescence data of the reaction product. The fluorescence scanning results were graphically displayed using the R language "ggplot" package. The C base type had FAM fluorescence, which was distributed near the x-axis; the T base type had HEX fluorescence, which was distributed near the y-axis; and samples with no detected signal were distributed near the origin.

[0048] Example 4: Using KASP marker Kasp_TGW_GL3B.1 to detect grain weight and grain length of common wheat varieties under normal and drought conditions

[0049] Among the 311 Chinese wheat varieties, 270 varieties were of the allele type qTGW_GL3B.1a and 41 varieties were of the allele type qTGW_GL3B.1b. These 311 varieties were sown in normal environment (sowing in full moisture, watering once each in the jointing stage and filling stage) and drought environment (sowing in full moisture, no watering during the entire growth period) in 2018-2019, 2019-2020, and 2020-2021, respectively, with a row length of 3m and a randomized block design. The length and thousand-grain weight of wheat grains were tested using the Wanshen SC-G automatic seed test analyzer (Wanshen Testing Technology). The results showed that the mean thousand-grain weight and grain length of wheat varieties carrying the allele qTGW_GL3B.1a in two environments in different years were higher than those of wheat varieties carrying the allele qTGW_GL3B.1b, and there was a very significant difference between the two (P<0.01) (Table 2).

[0050] Table 2 Statistical analysis results of the relationship between allele variation types of QTLqTGW_GL3B.1 in common wheat and thousand-grain weight and grain length

[0051]

[0052]

[0053] Note: Statistical analysis was performed using a two-tailed t-test; ** indicates that the difference reached an extremely significant level.

[0054] The allele types, thousand-grain weight and grain length of wheat germplasm under normal environment in different years are shown in Table 3. The allele types, thousand-grain weight and grain length of wheat germplasm under drought environment in different years are shown in Table 4.

[0055] Table 3 Wheat germplasm Kasp_TGW_GL3B.1 marker detection results and thousand-grain weight and grain length data under normal conditions

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064] Note: NA represents missing data. Statistics of thousand-grain weight and grain length are not performed for wheat varieties with missing data.

[0065] Table 4 Marker detection results and 1000-grain weight and grain length data of wheat germplasm Kasp_TGW_GL3B.1 under drought conditions

[0066]

[0067]

[0068]

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078]

[0079] Note: NA represents missing data. Statistics of thousand-grain weight and grain length are not performed for wheat varieties with missing data.

[0080] From the above examples, it can be seen that the present invention discloses a new KASP marker for detecting wheat grain weight and grain length in normal and drought environments. The specific primer pair provided by the present invention is composed of the single-stranded DNA fragments shown in Table 1. The present invention provides a KASP marker Kasp_TGW_GL3B.1 for identifying qTGW_GL3B.1a and qTGW_GL3B.1b allelic variations and its correlation with wheat grain weight and grain length. The KASP marker in the present invention is applied to molecular marker-assisted selection of wheat grain weight and grain length, which can quickly screen out wheat varieties (germplasm) with higher grain weight and grain length under multiple environments, thereby accelerating the process of breeding new high-yield and drought-resistant wheat varieties. The present invention has important theoretical significance and economic value for the use of molecular markers to assist in the selection of wheat varieties with higher grain weight and longer grains under normal and drought environments.

[0081] In the above embodiments, the description of each embodiment has its own emphasis. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0082] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. Such modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included in the protection scope of the present invention.

Claims

1. A use of a primer combination, the primer combination comprising: Primer A, Primer B, Primer C; The nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 respectively; the characteristics are as follows: the use is to identify or assist in identifying the grain length trait of wheat planted in arid areas in the early stage of molecular marker-assisted selection breeding (MAS); wherein the specific variety of wheat is: 。 2. The use according to claim 1, characterized in that: There are two steps involved: (1) PCR amplification: performing PCR amplification on the wheat to be tested using the primer combination; (2) Genotyping: After the PCR reaction is completed, the fluorescence signal is converted into an analyzable value using a fluorescence signal reader and a fluorescence detection system to read the fluorescence data of the reaction product; the fluorescence scanning results are graphically displayed using the R language "ggplot" package. The C base type carries FAM fluorescence and is distributed near the x-axis; the T base type carries HEX fluorescence and is distributed near the y-axis; samples with no detected signal are distributed near the origin; wheat with a homozygous cc genotype is selected as a candidate variety with a relatively high grain length value, and wheat with a homozygous tt genotype is selected as a candidate variety with a relatively low grain length value.

3. A breeding method for regulating wheat grain length traits in arid areas, characterized in that: For the wheat described in claim 1, in the early stage of molecular marker-assisted selection breeding (MAS), based on the primer combination described in claim 1, the genotype of the SNP site located at the physical position 41,633,676 bp of wheat chromosome 3B is identified, and wheat with a homozygous cc genotype is bred as a candidate variety with a relatively high grain length value, and wheat with a homozygous tt genotype is bred as a candidate variety with a relatively low grain length value.

Images