Polysaccharide haf2-1 derived from pathogenic bacteria cell wall and preparation and application thereof

Abstract

The application provides a polysaccharide HAF2-1 derived from a pathogenic bacterial cell wall and preparation and application thereof, monosaccharide composition includes fucose, galactose, glucose and mannose, preferably, the relative molar ratio of fucose, galactose, glucose and mannose is 1.43+ / -0.05:3.27+ / -0.19:83.93+ / -0.25:11.37+ / -0.85. The polysaccharide can be applied to inducing plants to produce disease resistance.

Description

Technical Field

[0001] This invention provides a cell wall polysaccharide extract derived from pathogens, specifically a hot alkali-extracted water-soluble cell wall polysaccharide HAF2-1 extracted from Rhizoctonia solani, which can be used to induce disease resistance in plants. Background Technology

[0002] Rice sheath blight is one of the most widespread rice diseases worldwide, and its incidence and severity are continuously increasing, causing serious yield losses. The pathogen causing rice sheath blight is *Rhizoctonia solani* AG1IA, a fungus belonging to the genus *Rhizoctonia*, which is a pathogenic agent for important crops such as rice, corn, and potatoes. Its cell wall is rich in polysaccharides, which are natural high-molecular-weight polymers composed of aldoses or ketoses linked by glycosidic bonds, playing an important role in metabolic regulation within organisms.

[0003] Typically, the cell wall serves as the first line of defense in the interaction between plants and pathogens. Changes in cell wall composition can often act as pathogen-associated molecular patterns (PAMPs) and damage-associated molecular patterns (DAMPs) to induce plant immunity and enhance resistance. There are reports that polysaccharides derived from plants or pathogens can act as potential inducers to stimulate plant immune resistance. For example, neutral galactomannan from the mycelium of *Penicillium chrysogenum* can protect *N. glutinosa* from tobacco mosaic virus, which induces the production of NO and H2O2 to initiate an early defense response (Fu et al., 2020). As a PAMP, β-1,3-glucan, present in the walls of fungi and oomycetes, can trigger the expression of immune-related genes in *Arabidopsis thaliana* (Melida et al., 2013, 2018). Therefore, understanding the major structures of cell wall polysaccharides in plant pathogenic fungi is crucial for pathogen infection and disease control.

[0004] Currently, the control of sheath blight is quite difficult. Immune induction is an important pathway for plant resistance in agricultural control; however, due to a lack of understanding of the pathogen's cell wall structure and efficient extraction technology, the types of inducers are limited, and their specificity to rice is weak. The Wolski team (2005, 2006) isolated α-1,3-glucan from a non-pathogenic Rhizoctonia solani strain, which can induce glucanase activity in potato. Fucomanganese extracted from Rhizoctonia solani isolated from melon has an inhibitory effect on the proliferation of colon cancer cells (Alexandree et al., 2018). However, cell wall polysaccharides from the pathogenic Rhizoctonia solani AG1IA strain of sheath blight have not been reported. This invention provides a cell wall polysaccharide from Rhizoctonia solani and its preparation method, which can be used to enhance the control of sheath blight through immune induction, and has certain application value. Summary of the Invention

[0005] The purpose of this invention is to provide Rhizoctonia solani cell wall polysaccharide, its preparation and its application in inducing plant resistance.

[0006] One of the technical solutions of the present invention is a polysaccharide HAF2-1 derived from the cell wall of pathogenic bacteria, characterized by:

[0007] 1) The monosaccharide composition is fucose, galactose, glucose, and mannose. Preferably, the relative molar ratio of fucose, galactose, glucose, and mannose is 1.43±0.05: 3.27±0.19: 83.93±0.25: 11.37±0.85.

[0008] 2) The weight-average molecular weight is approximately 3097 ± 50 kDa, preferably 3097 kDa;

[0009] 3) The main chain structure of the polysaccharide glycosidic bond is →4)-α-Glcp-(1→, and contains a certain degree of side chain substitution. Preferably, the connection mode of the polysaccharide glycosidic bond is as follows: →4)-Glcp-(1→ is the main chain, containing →4,6)-Glcp-(1→ and →3,4)-Glcp-(1→ branches, →6)-Glcp-(1→ side chain and a small amount of →3)-Glcp-(1→, and Manp-(1→ terminal). Among them, the relative molar ratio of Manp-(1→, →3)-Glcp-(1→, →4)-Glcp-(1→, →6)-Glcp-(1→, →3,4)-Glcp-(1→, →4,6)-Glcp-(1→) is 8.66:1.1:57.28:23.30:3.10:6.63.

[0010] The second technical solution of the present invention, the above-mentioned method for preparing the pathogenic bacterial cell wall polysaccharide HAF2-1, includes the following steps:

[0011] (1) Culture of strain; (2) Degreasing of cell wall; (3) Boiling water extraction and cold alkali extraction; (4) Hot alkali extraction; (5) Separation and purification. (1) Culture of Rhizoctonia solani: After Rhizoctonia solani is activated in PDB medium, the hyphae on the edge of the mycelium cake are picked up with an inoculation loop and inoculated into liquid medium, and statically cultured at 26-30℃ for 2-4 days.

[0012] (2) Extraction and defatting of Rhizoctonia solani cell walls: The Rhizoctonia solani from step (1) was filtered through a Buchner funnel to remove the fermentation broth and obtain mycelia. The mycelia were washed 3-4 times with PBS buffer (pH=7.0-7.4) to remove the culture medium. The mycelia were then sonicated and pulverized by liquid nitrogen and added to PBS buffer (pH=7.0-7.4). The mycelia were then washed 1-2 times with PBS buffer and 3-4 times with water. The supernatant was discarded by centrifugation, and the residue was freeze-dried to obtain the Rhizoctonia solani cell walls. Anhydrous ethanol was added at a material-to-liquid ratio of 1:10-20 (g / mL) and the mixture was incubated at 65-70℃.

[0013] Extract for 1-2 hours to remove lipid-soluble components. After evaporating the ethanol, defatted Rhizoctonia solani cell walls are obtained.

[0014] Furthermore, in step (2), ultrasonic pulverization requires an ice-water bath, 400W, 5s intervals, 40 cycles; centrifugation speed 4000g, time 5min, temperature 4℃. Furthermore, in step (2), when evaporating anhydrous ethanol, the water bath is heated to 75-82℃.

[0015] (3) Extraction of cell wall by boiling water and cold alkali: The defatted Rhizoctonia solani cell wall after step (2) is extracted with boiling water and cold alkali (15-20℃, 0.5-1M NaOH) 2-3 times at a material-to-liquid ratio of 1:10-20 (g / mL). After centrifugation, the supernatant is discarded and the component with weak binding to the cell wall is removed.

[0016] Furthermore, in step (3), the centrifugation speed is 4000g, the time is 5min, and the temperature is 4℃.

[0017] Furthermore, in step (3), the centrifugation speed is 4000g, the time is 5min, and the temperature is 4℃.

[0018] (4) Hot alkaline extraction: The cell wall residue from step (3) is subjected to hot alkaline extraction. The alkaline extraction solution is NaOH with a concentration of 1-2M, the extraction temperature is 70-90℃, and the extraction is performed 2-3 times. The supernatants are combined by centrifugation, neutralized with sodium acetate, dialyzed for 48-72 hours, concentrated by rotary evaporation, and then precipitated with 4 times the volume of anhydrous ethanol. The precipitate is collected by centrifugation, redissolved in water, and protein is removed using Sevage reagent (chloroform: n-butanol = 5:1, volume ratio).

[0019] Furthermore, in step (4), during dialysis, the water is changed every 12 hours, and the dialysis bag is 3500 Da.

[0020] Further, in step (4), the centrifugation speed is 8000-12000 rpm, and the time is 5-10 min. Further, in step (4), when removing protein, a polysaccharide solution of 5 mg / ml is prepared with water and Sevage reagent is added. The first addition is an amount of Sevage reagent equal to the polysaccharide concentration. In subsequent repeated operations, 1 / 5 of the volume of the polysaccharide solution is added. The mixture is shaken and centrifuged at 4000-8000 rpm for 5-10 min until there is no white turbid suspension between the two phases. The upper aqueous phase is collected and freeze-dried to obtain crude polysaccharide extracted from the cell wall of Rhizoctonia solani.

[0021] (5) Alkali extraction of water-soluble crude cell wall polysaccharides for separation and purification by ion exchange column chromatography.

[0022] The protein-free Rhizoctonia solani extract cell wall polysaccharide prepared in (4) above was prepared into an aqueous solution with a concentration of 10-20 mg / mL. After removing impurities with a 0.22 μm filter membrane, it was added to a DEAE-52 anion exchange column. It was first eluted with ultrapure water, and then eluted with 0.1-0.12 M, 0.3-0.35 M, and 0.5-0.8 M NaCl in successive isocratic steps. The sugar content of each tube was detected by the phenol-sulfuric acid method and the elution curve was plotted. The eluent of the 0.1 M NaCl elution was collected, concentrated and lyophilized. The fraction obtained after elution with 0.1 M NaCl was HAF2.

[0023] (6) Alkali extraction of water-soluble crude cell wall polysaccharides for separation and purification by gel filtration chromatography.

[0024] The HAF2 obtained in (5) was prepared into an aqueous solution with a concentration of 10-20 mg / mL. Impurities were removed by a 0.22 μm filter membrane. The solution was then added to a Sephacryl S-300HR gel chromatography column with ultrapure water as the mobile phase. The sugar content of each tube was detected by the phenol-sulfuric acid method, and an elution curve was plotted. The main peak was collected, concentrated, and freeze-dried to obtain the cell wall polysaccharide HAF2-1 extracted from Rhizoctonia solani.

[0025] The third technical solution of the present invention is the application of the above-mentioned alkali-extracted water-soluble Rhizoctonia solani cell wall polysaccharide HAF2-1 in inducing plant resistance.

[0026] The alkaline-extracted water-soluble cell wall polysaccharide HAF2-1 derived from Rhizoctonia solani can activate the salicylic acid signaling pathway to induce resistance to rice sheath blight, and the concentration used is 2-3 mg / mL.

[0027] The beneficial effects of this invention are:

[0028] This invention provides a novel cell wall polysaccharide derived from Rhizoctonia solani AGLIA, along with a method for its preparation and its application in activating plant immunity. This cell wall polysaccharide is readily soluble in water and can effectively activate salicylic acid signaling and its downstream signaling pathways in rice, inducing systemic resistance to fungal diseases in rice, especially showing good control effects against sheath blight, with promising application prospects. Attached Figure Description

[0029] Figure 1 Image showing the elution of cell wall polysaccharides extracted from Rhizoctonia solani AG1IA using a DEAE-52 anion exchange column.

[0030] Figure 2 Elution curve of Sephacryl S-300HR gel column purification of cell wall polysaccharide from Rhizoctonia solani AG1IA.

[0031] Figure 3 Gel chromatogram of HAF2-1GPC cell wall polysaccharide from Rhizoctonia solani AG1IA.

[0032] Figure 4 High-performance liquid chromatography (HPLC) chromatogram of the monosaccharide composition of HAF2-1, a polysaccharide in the cell wall of Rhizoctonia solani AG1IA.

[0033] Figure 5 Infrared spectrum of HAF2-1, a cell wall polysaccharide of Rhizoctonia solani AG1IA.

[0034] Figure 6 NMR spectrum of HAF2-1 cell wall polysaccharide from Rhizoctonia solani AG1IA 1 H(A), 13 C(B), 1 H- 1 HCOSY(C), HSQC(D), and HMBC(E) speculative structural diagram (F).

[0035] Figure 7 After treatment with HAF2-1, an alkaline extract of cell wall polysaccharide from Rhizoctonia solani AG1IA, the disease index of rice leaves was analyzed: (A) disease incidence, (B) lesion length.

[0036] Figure 8 The expression level of resistance genes in rice leaves after treatment with HAF2-1, an alkaline extract of cell wall polysaccharide from Rhizoctonia solani AG1IA; in the figure, * indicates P<0.05.

[0037] Figure 9Hormone levels in rice leaves after treatment with HAF2-1, an alkaline extract of cell wall polysaccharide from Rhizoctonia solani AG1IA; * indicates P<0.05 in the figure. Detailed Implementation

[0038] Example 1: Culture of Rhizoctonia solani AG1IA

[0039] (1) Preparation of PDA liquid culture medium:

[0040] Weigh 4g of potato flour (source: Yuanye Biotechnology; batch number: G18J12Q137577), 20g of anhydrous glucose (source: Xilong Science; batch number: 1906201), and measure 1000ml of deionized water. After ultrasonic dissolution, evenly dispense the contents into 10 250ml Erlenmeyer flasks, seal with sealing film, and autoclave at 121℃ for 20min.

[0041] (2) R. solani activation and culture: Take out the Rhizoctonia solani AG1IA sclerotia frozen at -80℃, place them in PDA liquid medium, activate them in an incubator at 28℃ for 5 days, and after maturation, use an inoculation loop to pick the mycelium on the edge of the mycelium cake and transfer it into 30 bottles of 100ml PDA liquid medium, and incubate them in 250ml Erlenmeyer flasks at 28℃ for 3 days.

[0042] Example 2: Extraction of the cell wall of Rhizoctonia solani AG1IA, the method is as follows:

[0043] (1) Collect the mycelium of Rhizoctonia solani cultured in Example 1, filter it through a Buchner funnel to remove excess fermentation broth, line the funnel with two layers of qualitative filter paper, wash it three times with PBS buffer (pH=7.4) to remove the culture medium, put it in a mortar, and grind it several times with liquid nitrogen until the mycelium turns white and becomes powdery.

[0044] (2) Add PBS buffer (pH=7.4) to the mycelium ground in step 1) and sonicate the cells (ice water bath, 400W, 5s, 5s interval, 40 times). After pulverization, wash once with PBS buffer (pH=7.4) and three times with water to remove cell contents. Centrifuge at 4000g for 5min each time at 4℃ and discard the supernatant. Freeze-dry the residue to obtain the cell wall of Rhizoctonia solani.

[0045] Example 3: Preparation and extraction of water-soluble cell walls from Rhizoctonia solani AG1IA using alkaline extract, the method is as follows:

[0046] (1) To extract the cell wall of Rhizoctonia solani, first add anhydrous ethanol to the residue at a material-to-liquid ratio of 1:20 (g / mL) and extract at 70℃ for 2 hours to remove lipid-soluble components. Centrifuge at 4000g for 10 minutes, discard the supernatant, and evaporate the anhydrous ethanol by heating in a water bath at 82℃ to obtain the defatted Rhizoctonia solani cell wall.

[0047] (2) The defatted Rhizoctonia solani cell wall from step (1) was extracted twice with boiling water at a material-to-liquid ratio of 1:20 (g / mL), each time for 1 hour, and twice with cold alkali (15℃, 1M NaOH), each time for 1 hour. After centrifugation at 4000g for 10 minutes, the supernatant was discarded to remove the components that were weakly bound to the cell wall. The residue was extracted twice with 1M NaOH at 80℃. After centrifugation, the supernatants were combined and neutralized with sodium acetate to pH 7.0-7.4. The mixture was dialyzed with a 3500Da dialysis bag for 48 hours, with the water changed every 12 hours. Then, the mixture was concentrated to 1 / 20 of the original volume by rotary evaporation. Four times the volume of anhydrous ethanol was added, and the mixture was allowed to stand overnight. The supernatant was then discarded and the precipitate was collected. The precipitate was centrifuged at 8000-12000 rpm for 5-10 minutes, and the supernatant was discarded. The precipitate was evaporated to dryness in an 80℃ water bath to remove the ethanol. After redissolving in water, the precipitate was freeze-dried to obtain the crude polysaccharide of Rhizoctonia solani cell wall.

[0048] (3) Prepare a 5 mg / ml polysaccharide solution from the polysaccharide obtained in step (2) using water and add it to Sevage reagent (chloroform: n-butanol).

[0049] =5:1 (volume ratio), add Sevage reagent of equal volume to the polysaccharide concentration for the first time, and add 1 / 5 of the volume of polysaccharide solution in subsequent repeated operations. Shake and centrifuge at 4000-8000 rpm for 5-10 min until there is no white turbid suspension between the two phases. Collect the upper aqueous phase and freeze-dry to obtain crude polysaccharide of Rhizoctonia solani alkali extract cell wall.

[0050] Example 4: Purification of water-soluble cell wall polysaccharides from Rhizoctonia solani AG1IA using alkaline extraction, the method is as follows:

[0051] (1) DEAE-52 cellulose chromatography column

[0052] Weigh 40 mg of the water-soluble cell wall polysaccharide from R. solani AG1IA prepared in Example 3, dissolve it in 2 ml of ultrapure water, centrifuge at 12000 rpm for 2 min, collect the supernatant and remove impurities using a 0.22 μm filter membrane, then add it to a DEAE-52 anion exchange column (1.6 × 20 cm). Elute first with ultrapure water, then with 0.1 M, 0.3 M, and 0.5 M NaCl at successive isocratic elutions, using 2.5 column volumes of each eluent. Detect the sugar content in each tube using the phenol-sulfuric acid method and plot the elution curve. Collect the main peak of the 0.1 M NaCl elution, rotary evaporate to a certain volume, and then freeze-dry to obtain HAF2 ( Figure 1 ).

[0053] (2) Sephacryl S-300HR gel chromatography

[0054] Weigh 20 mg of HAF2 eluted by DEAE in step (1), dissolve it in 2 ml of ultrapure water, centrifuge at 12000 rpm for 2 min, remove the supernatant by filtering with a 0.22 μm filter membrane, add it to a Sephacryl S-300HR column (1.6 × 30 cm), use ultrapure water as the mobile phase, elute with 4.5 column volumes, collect the main peak, rotary evaporate to a certain volume, and then freeze-dry to obtain HAF2-1. Figure 2 ).

[0055] Example 5: Basic physicochemical property analysis of HAF2-1 (molecular weight determination and monosaccharide composition), the method is as follows:

[0056] (1) Detection of HAF2-1 molecular weight

[0057] The molecular weight of HAF2-1 was determined by size exclusion chromatography (GPC). 1 mg of HAF2-1 purified using a Sephacryl S-300HR column in Example 4 was dissolved in 200 μL of ultrapure water to a concentration of 5 mg / mL. The solution was filtered through a 0.22 μm membrane to remove impurities. The sample loading volume was 20 μL. The mobile phase was ultrapure water, the flow rate was 0.7 mL / min, and a differential detector was used. Pullulan reagent (Shodex STP Pseries) was used as a standard, and a standard curve was plotted as LogMw = -0.349T + 9.0506R. 2 =0.9924 (T = retention time), showing good linearity. Based on the retention time, the molecular weight of HAF2-1 was calculated using the extrapolation method, yielding a weight-average molecular weight of approximately 3097 kDa. Figure 3 ).

[0058] (2) Determination of HAF2-1 monosaccharide composition

[0059] Mixed standard sugars: fucose, rhamnose, glucosamine, galactose, mannose, and glucose. Weigh 1 mg of each and dissolve in 1 ml of ultrapure water. Remove impurities using a 0.22 μm filter membrane. Take 100 μl of each and shake to mix thoroughly.

[0060] HAF2-1 acid hydrolysis reaction: Dissolve 2 mg of HAF2-1 in 2 ml of 2M trifluoroacetic acid, and react in a muffle furnace at 120 °C for 3 h. After hydrolysis, place the solution in an evaporating dish and heat in a water bath at 70 °C to evaporate to dryness. Repeat the process of adding methanol 3-5 times to evaporate to dryness. Finally, redissolve the solution in 1.5 ml of ultrapure water and remove impurities using a 0.22 μm filter membrane. See the liquid chromatogram below. Figure 4 .

[0061] The monosaccharide composition of HAF2-1 was analyzed using high-performance anion exchange chromatography with a pulsed amperometric detector (HPAEC-PAD). The mobile phases were: A: ultrapure water, B: 100 mM NaOH, and C: 500 mM NaAc. A PA-10 column was used at 30 °C, and the sample loading volume was 10 μL. The elution conditions (volume ratio, the remainder being A) were: 0–25 min, 15% B; 25–30 min, 15% B, 0–20% C; flow rate: 0.8 mL / min. The retention times of HAF2-1 were compared with those of standard monosaccharides to determine the monosaccharide composition of HAF2-1. The experiment was repeated three times.

[0062] Table 1. Composition and molar ratio of HAF2-1 monosaccharides

[0063]

[0064] Example 6: Structural characterization of HAF2-1 (infrared spectroscopy, methylation, and NMR analysis), as detailed below:

[0065] (1) Infrared spectroscopy analysis: Weigh 2 mg of Rhizoctonia solani cell wall polysaccharide sample, grind it evenly with 100 mg of dry KBr powder, compress it into a tablet, and incubate it at 4000-4000 cm⁻¹. -1 Infrared spectral analysis was performed within the range using a Fourier transform infrared spectrometer (results are shown in...). Figure 5 ). At 3406cm -1 A broad and strong absorption peak was observed in the infrared spectrum around 2930 cm⁻¹, which is caused by the OH stretching vibration of the glucose skeleton. -1 The absorption bands observed at 1423 and 1368 cm⁻¹ correspond to the CH stretching vibrations in the polysaccharide structure. Furthermore, absorption bands at 1423 and 1368 cm⁻¹ also correspond to these bands. -1 The two weak peaks at 1740 cm⁻¹ are caused by the deformation absorption of the methylene and methyl groups, respectively. -1 The absence of absorption peaks on either side indicates that the polysaccharide chain does not contain uronic acid. (1157 cm⁻¹) -1The absorption at this point is attributed to the COC stretching vibration of the glycoside linkage. An 851 cm⁻¹ region representing the α configuration was observed. -1 Absorption. In summary, the main chain of polysaccharides is composed of glucose, linked by α-glycosidic bonds.

[0066] (2) HAF2-1 methylation and GC-MS analysis:

[0067] HAF2-1 Methylation: Dissolve 2 mg of HAF2-1 in 0.5 ml of anhydrous DMSO using sonication. The entire methylation reaction must be sealed under nitrogen purging. Add 20 mg of dry NaOH and sonicate until most of it dissolves. Under nitrogen protection, add 0.3 ml of iodomethane and stir for 2.5 h in the dark. Add 0.3 ml of ultrapure water and stir for 0.5 h to stop the reaction. Wash the reaction tube with 1 ml of dichloromethane and transfer the entire solution to a clean glass tube. Add 3 ml of ultrapure water for extraction. Collect the lower organic phase and repeat the extraction three times with ultrapure water. Add excess NaSO4 to the lower layer to remove moisture, transfer to a clean reaction tube, and dry with nitrogen. Repeat the above reaction three times.

[0068] HAF2-1 methylation followed by hydrolysis and acetylation: The sample treated above was redissolved in 1 ml of 2M trifluoroacetic acid and reacted in a muffle furnace at 110°C for 2 h. After hydrolysis, the sample was placed in an evaporating dish and repeatedly added methanol 3-5 times to evaporate to dryness. Then, 0.3 ml of ultrapure water was added, and 1 drop of 1% ammonia was added to adjust the pH to alkaline. 5 mg of NaBD4 was added and mixed well. The mixture was stirred at room temperature for 12 h. After the reaction was completed, the pH was adjusted to neutral with acetic acid, the reaction solution was evaporated to dryness, and methanol was added to wash and evaporate to dryness repeatedly.

[0069] Add 1 ml of acetic anhydride:pyridine (1:1 = v / v) to the above sample and react at 90 °C for 2 h. Stop the reaction by adding 1 ml of ultrapure water. Extract twice with 1 ml of dichloromethane, shake thoroughly, collect the dichloromethane phase and evaporate to dryness. Finally, add 0.6 ml of dichloromethane to redissolve the sample and remove impurities using a 0.22 μm organic filter membrane.

[0070] The GC-MS detection results are as follows:

[0071] Table 2. Results of HAF2-1 methylation

[0072]

[0073] →4)-Glcp-(1→ represents a glucose unit connected by 1 and 4.

[0074] (3) Nuclear magnetic resonance analysis

[0075] HAF2-1 sample (30 mg) was dissolved in D2O and subjected to one-dimensional... 1 H NMR, 13C1NMR and two-dimensional NMR spectra ( 1 H- 1 HCOSY,

[0076] HSQC and HMBC spectral tests Figure 6 The results are as follows:

[0077] Table 3 Analysis of HAF2-1 NMR Results

[0078]

[0079]

[0080] From HAF2-1 1 H(6A), 13 C(6B), 1 H- 1 The H and C signals attributable to each glycosidic bond of the polysaccharide were obtained from the H COSY (6C), HSQC (6D), and HMBC (6E) information (Table 3). Among them, the HMBC spectrum contains coupling signals between isomeric hydrogens and carbons on other sugar residues, and coupling signals between isomeric carbons and hydrogens on other sugar residues. Figure 6 E). Based on these signals (A H1-CC4, B H1-AC6, CH4-DC1, DC1-EC4, CH1-EC3) and combined with the methylation results of the polysaccharide (Table 2), we inferred the relationship information between the various sugar residues in the polysaccharide. Figure 6 F).

[0081] Example 7: Application of HAF2-1 in inducing plant resistance

[0082] (1) Sample preparation: 6 mg of HAF2-1 was dissolved in 3 ml of ultrapure water (containing 0.04% (v / v) Tween 20), with a HAF2-1 concentration of 2 mg / ml. Ultrapure water containing 0.04% Tween 20 was used as the control group. Rhizoctonia solani culture: Rhizoctonia solani was placed on PDA solid medium and cultured at 28℃ for 48 h. Rice leaf treatment: Two leaves from each of 60 rice plants (one month after germination) were taken. The leaves were pretreated with HAF2-1 for 6 hours. Then, Rhizoctonia solani was punched with a 5 mm punch, and one mycelial cake was inoculated on each leaf. The disease incidence on the leaves was observed after 24 h.

[0083] Subsequent observations and calculations showed that the incidence of sheath blight on rice leaves treated with HAF2-1 was significantly reduced compared to the control (CK) level, with the disease index decreasing by approximately 40%. Figure 7 ).

[0084] (2) Evaluation of the expression of resistance genes in rice leaves after HAF2-1 treatment:

[0085] First, the specific steps for RNA extraction are as follows:

[0086] 1) Pre-cool the mortar with liquid nitrogen, add a small amount of liquid nitrogen to grind the leaves into powder. Use a pre-cooled spatula to transfer an appropriate amount of powder into a 1.5 mL EP tube containing 500 μL of Trizol reagent, mix thoroughly, and let stand at room temperature for 5 min. Centrifuge at 13000 g for 5 min at 4 °C.

[0087] 2) Transfer the supernatant to a new 1.5 mL centrifuge tube.

[0088] 3) Transfer the above solution to a gDNA Eraser Mini Column and centrifuge at 13000g at room temperature for 1 minute.

[0089] 4) Discard the gDNA Eraser Mini Column and transfer the filtrate from the column tube to a new 1.5 mL centrifuge tube.

[0090] 5) Add an equal volume of 70% ethanol and mix thoroughly by pipetting.

[0091] 6) Immediately transfer the entire mixture to an Unversal RNA Mini Column, centrifuge at 12000g at room temperature for 1 minute, and discard the filtrate.

[0092] 7) Add 600uL of Buffer RWA to the Unversal RNA Mini Column, centrifuge at 12000g at room temperature for 1 minute, and discard the filtrate.

[0093] 8) Add 650uL of Buffer RWB to the Unversal RNA Mini Column (make sure to add the specified volume of 100% ethanol), centrifuge at 12000g at room temperature for 1 minute, discard the filtrate, and repeat twice.

[0094] 9) Place the Unversal RNA Mini Column onto a new 2ml collection tube and centrifuge at 12000g at room temperature for 2 minutes.

[0095] 10) Place the Unversal RNA Mini Column onto a new RNase-free tube, add 80 μL of RNase-free water to the center of the membrane of the adsorption column, let stand at room temperature for 5 minutes, and then centrifuge at 12000g at room temperature for 2 minutes to elute the RNA.

[0096] After thawing, the RNA was placed on ice. Once it passed electrophoresis and micro-quantitative nucleic acid analysis, the resulting RNA was immediately aliquoted into tubes of 1 μg. One tube of RNA was immediately used for reverse transcription, while the remainder was stored at -80°C to avoid repeated freeze-thaw cycles.

[0097] Next, the mRNA that passed the test in step 10) was reverse transcribed.

[0098] The reversal process is as follows:

[0099] Pre-denaturation process:

[0100] Reaction Buffer oligo(dT) 4μL Enzyne Mix 2μL template RNA 1μg Rnase-Free dH2O 13uL

[0101] Mix well, incubate at 70°C for 5 minutes, then incubate on ice for 5 minutes.

[0102] Reverse transcription process:

[0103] 25℃ 5min 42℃ 60min 70℃ 15min 4℃ ∞

[0104] Dilute the cDNA 10-fold with DEPC water and use it as a template for q-PCR. The q-PCR system is as follows:

[0105]

[0106] The primers used in the experiment are as follows:

[0107] Table 4 Primers used for RT-qPCR

[0108] OsActin TTATGGTTGGGATGGGACA AGCACGGCTTGAATAGCG OsPAL TGAATAACAGTGGAGTGTGGAG AACCTGCCACTCGTACCAAG OsPBZ1 GGTGTGGGAAGCACATACAA GTCTCCGTCGAGTGTGACTTG OsPR3 GTCACCGAGGCGTTCTTCA GCTTGGAGTCGTCGTTGGT OsPR10 CCTCAGCCATGCCATTCAG CTTGTCCACGTCCAGGAACTC OsRbohA GAGCGCGTCTGCCAATAAAC TCAATGTAGCCGAGCCCTTC

[0109] Based on the number of samples to be tested, first prepare the q-PCR reaction mixture, including fluorescent dye (from the PrimeScript™ II 1st Strand cDNA Synthesis Kit), primers, and sterile distilled water, mix well, and centrifuge. Add the 10-fold diluted c-DNA to three parallel wells, 2.5 μL per well, for each sample. Then add 7.5 μL of the mixture, centrifuge, and bring the liquid to the bottom of the tube.

[0110] PCR conditions: 95℃ for 2 min; 95℃ for 5 s, 58℃ for 10 s, 72℃ for 15 s, 40 cycles.

[0111] Melting curve: initial temperature 60℃; final temperature 95℃; heating rate 5℃ / s; equilibrium time 6s.

[0112] Detection conditions: Blue channel, excitation wavelength 470nm, detection wavelength 520nm, dye FAM.

[0113] Exploit 2 -ΔΔCt The method can calculate the relative change in the expression level of the target gene. The calculation process is as follows: (1) Calculate the ΔCt value: ΔCt = Ct value of the target gene - Ct value of the internal reference gene; (2) Calculate 2-ΔCt, which represents the relative expression level of the target gene within the group; (3) Calculate the 2-ΔΔCt value, which is the relative ratio of 2-ΔCt between the treatment group and the control group, representing the fold change in gene expression in the treatment group relative to the control group. The results of the RT-qPCR experiment are as follows: Figure 8 The results showed that HAF2-1 treatment significantly upregulated the expression of the Rboh A, PR3, PR10, and PBZ1 resistance genes.

[0114] (3) Changes in hormone levels in rice leaves: Rice leaves from the diseased areas after the above treatment were taken. For overall evaluation, the inoculated parts of the leaves that were not diseased were taken. The leaves were ground into powder with liquid nitrogen and hormone extract was added at a ratio of 1:10. The mixture was rotated and shaken overnight at 4°C. Dichloromethane was added at a ratio of 1:2 for extraction. After rotating at 4°C for 2 hours, the mixture was centrifuged at 13,000 rpm for 5 minutes. The lower layer of liquid was placed in a 45°C water bath and evaporated to dryness. After redissolving in 0.6 ml of dichloromethane, the mixture was filtered through a 0.22 μm organic filter membrane before detection.

[0115] Detection method:

[0116] 1) Instruments used for liquid chromatography: LC-MS (Qtrap5500), Hypersil BDS C18 column (250mm×4.6mm, 5μm).

[0117] Mobile phase A is a 0.1% formic acid aqueous solution, and mobile phase B is acetonitrile.

[0118] The gradient was set as follows: 0 min 90% A + 10% B; 25 min 20% A + 80% B; 26 min 90% A + 10% B; 35 min 90% A + 10% B, with a flow rate of 1 mL / min. The sample injection volume was 10 μL.

[0119] 2) Mass spectrometry conditions

[0120] Using MRM mode, the mass spectrometer settings are as follows:

[0121] Parent ion (m / z) 137 Daughter ions (m / z) 93,65 Broken energy (ev) 21

[0122] Plotting the standard curve: Salicylic acid was injected at volumes of 3, 6, and 10 μL, and linear fitting was performed based on the peak area and the injection volume of the standard. The injection volume of all samples was 10 μL.

[0123] Test results as follows Figure 9After treatment with HAF2-1, the content of salicylic acid was higher than that in the control group, indicating that when HAF2-1 is applied to rice, it enhances the resistance to sheath blight by activating the salicylic acid signaling pathway.

Claims

1. A polysaccharide HAF2-1 derived from the cell wall of a pathogenic bacterium, with the following structural characteristics: 1) The monosaccharide composition includes fucose, galactose, glucose, and mannose, and the relative molar ratio of fucose, galactose, glucose, and mannose is 1.43±0.05: 3.27±0.19: 83.93±0.25: 11.37±0.85; 2) The weight-average molecular weight is 3097±50 kDa. 3) The main chain structure of the polysaccharide glycosidic bond is →4)-α-Glcp-(1→, and it contains side chain substitutions. The connection mode of the polysaccharide glycosidic bond is as follows: →4)-Glc p -(1→ is the main chain, containing →4,6)-Glc p -(1→and→3,4)-Glc p -(1→branch,→6)-Glc p -(1→sidechain and a small amount of→3)-Glc p -(1→, and Man) p -(1→end, where, Man p -(1→,→3)-Glc p -(1→,→4)-Glc p -(1→,→6)-Glc p -(1→,→3,4)-Glc p -(1→,→4,6)-Glc p The relative molar ratio of -(1→ is 8.66:1.1:57.28:23.30:3.10:6.63; The pathogen mentioned is Rhizoctonia solani AG1IA.

2. A method for preparing the cell wall polysaccharide HAF2-1 according to claim 1, characterized in that, The pathogen mentioned is *Rhizoctonia solani* AG1IA, and the preparation process is as follows: (1) Strain culture; (2) Cell wall extraction and defatting; (3) Boiling water extraction and cold alkali extraction: The defatted Rhizoctonia solani cell wall was extracted with boiling water 2-3 times and cold alkali extraction with 0.5-1M NaOH at 15-20℃ 2-3 times in a material-to-liquid ratio of 1:10-20 (g / mL). After centrifugation, the supernatant was discarded and the weakly bound components were removed. (4) Hot alkaline extraction; the alkaline extraction solution is NaOH, the concentration is 1-2M, the extraction temperature is 70-90℃, and the extraction is performed 2-3 times to obtain crude cell wall polysaccharide; (5) Separation and purification.

3. The method for preparing cell wall polysaccharide HAF2-1 according to claim 2, characterized in that: The strain was cultured using static culture, with PDB medium, at a temperature of 26-30℃ for 2-4 days.

4. The method for preparing cell wall polysaccharide HAF2-1 according to claim 2, characterized in that: The cell wall was extracted and defatted, and the fermentation broth was removed by filtration to obtain mycelium. The mycelium was washed 3-4 times with PBS buffer (pH=7.0-7.4) to remove the culture medium. After grinding with liquid nitrogen, the cell wall was ultrasonically pulverized in PBS buffer (pH=7.0-7.4). The cell wall was then washed 1-2 times with PBS buffer and 3-4 times with water. The supernatant was discarded by centrifugation, and the residue was freeze-dried to obtain the cell wall of Rhizoctonia solani. Anhydrous ethanol was added at a material-to-liquid ratio of 1:10-20 (g / mL), and the cell wall was extracted at 65-70℃ for 1-2 hours to remove lipid-soluble components. After evaporating the ethanol, the defatted Rhizoctonia solani cell wall was obtained.

5. The method for preparing cell wall polysaccharide HAF2-1 according to claim 2, characterized in that: The separation and purification process involved sequential ion exchange column chromatography and gel filtration chromatography. Ion exchange column chromatography: The crude polysaccharide extracted from the cell wall of Rhizoctonia solani was prepared into an aqueous solution with a concentration of 10-20 mg / mL. After impurity removal through a 0.22 µm filter membrane, the solution was added to a DEAE-52 anion exchange column. Elution was first performed with ultrapure water, followed by isocratic elution with 0.1-0.12 M, 0.3-0.35 M, and 0.5-0.8 M NaCl. The sugar content of each tube was determined by the phenol-sulfuric acid method, and elution curves were plotted. The eluent eluted with 0.1-0.12 M NaCl was collected, concentrated, and lyophilized. The fraction obtained after elution with 0.1-0.12 M NaCl was HAF2. Gel filtration chromatography: The sample purified by ion exchange column was prepared into an aqueous solution with a concentration of 10-20 mg / mL. Impurities were removed by a 0.22 µm filter membrane. The solution was then added to a Sephacryl S-300HR gel column with water as the mobile phase. The sugar content of each tube was detected by the phenol-sulfuric acid method, and elution curves were plotted. The main peak was collected, concentrated, and lyophilized to obtain the alkali-extracted cell wall polysaccharide HAF2-1 from Rhizoctonia solani.

6. The application of the cell wall polysaccharide HAF2-1 extracted from Rhizoctonia solani according to claim 1 or prepared by the method described in any one of claims 2-5, characterized in that, The cell wall polysaccharide HAF2-1 extracted from Rhizoctonia solani is used as a drug for the prevention and control of rice sheath blight or to induce rice to develop resistance to sheath blight.

7. The application according to claim 6, characterized in that, The concentration of the cell wall polysaccharide HAF2-1 used is 2-3 mg / mL.

Images