Application of a SNP marker in assisting the diagnosis of prostate cancer

Abstract

The present application relates to the field of biomarkers, and in particular to an application of a SNP marker in the auxiliary diagnosis of prostate cancer; the SNP marker is located at a genetic variation SNP site in the enhancer region of the gene NCOA4, and the SNP marker is a combination of rs7077830; by screening the genetic variation SNP site in the enhancer region of the prostate gene NCOA4, it is determined that rs7077830 in the SNP site affects the enhancer-promoter interaction of NCOA4, thereby making the population carrying rs7077830 susceptible to prostate cancer, and further determining that early screening and detection of prostate cancer can be achieved by detecting rs7077830, thereby filling the gap of gene sites related to the enhancer region of prostate cancer genes as SNP markers for early screening and diagnosis of prostate cancer.

Description

Technical Field

[0001] The present application relates to the field of biomarkers, and in particular to the application of a SNP marker in assisting the diagnosis of prostate cancer. Background Art

[0002] Prostate cancer is one of the most common tumors in men worldwide, and ranks second in incidence among solid malignant tumors in men, with more than 1.41 million new cases and 375,000 new deaths each year. Due to the limitations of early screening and diagnostic technology, about 54% of prostate cancer patients are diagnosed with metastasis when diagnosed with prostate cancer. Compared with localized prostate cancer, the 5-year relative survival rate of metastatic prostate cancer drops from 97.5% to 30.6%. Therefore, if screening and early diagnosis can be carried out more accurately for high-risk individuals for prostate cancer, it can make patients more accepting and save a lot of medical expenses.

[0003] The relationship between epigenetic regulation and tumor occurrence and development has become a hot topic in the field of tumor research today. Among them, existing studies have shown that regulatory modes such as DNA methylation, histone modification, nucleosome remodeling and RNA-mediated targeted regulation constitute the basis of tumor epigenetic regulation, and enhancers, as one of the important components of epigenetic regulation, play an important role in tumor progression. Current studies have shown that there is an interaction between enhancers and target gene promoter regions, and they can activate promoters and then regulate target gene transcription. Therefore, when there are genetic variations in the DNA of the gene enhancer region, it will significantly change the enhancer-promoter interaction, regulate the expression of the target gene, and thus affect the occurrence and susceptibility of tumors.

[0004] Although there are many and diverse SNP markers for early screening and diagnosis of prostate cancer, there is still a gap in the direction of using gene loci related to the enhancer region of prostate cancer genes as SNP markers; therefore, how to provide a SNP marker to fill the gap in using gene loci related to the enhancer region of prostate cancer genes as SNP markers for early screening and diagnosis of prostate cancer. Summary of the invention

[0005] The present application provides an application of a SNP marker in assisting the diagnosis of prostate cancer, so as to fill the gap of gene loci associated with the enhancer region of prostate cancer genes as SNP markers for early screening and diagnosis of prostate cancer.

[0006] In a first aspect, the present application provides an application of a SNP marker in the preparation of a reagent for assisting the diagnosis of prostate cancer, wherein the SNP marker is located at a genetic variation SNP site in an enhancer region of the gene NCOA4, and the SNP marker is a combination of rs7077830.

[0007] Optionally, the reagent includes an amplification primer for amplifying the SNP marker.

[0008] Optionally, the amplification primers include a first amplification primer, and the nucleotide sequence of the first amplification primer is shown as SEQ ID NO:1.

[0009] Optionally, the amplification primers include a second amplification primer, and the nucleotide sequence of the second amplification primer is shown as SEQ ID NO:2.

[0010] Optionally, the reagent also includes a primer probe for detecting the SNP marker.

[0011] Optionally, the primer probe includes a first primer probe, and the nucleotide sequence of the first primer probe is shown in SEQ ID NO:3.

[0012] Optionally, the probe includes a second primer probe, and the nucleotide sequence of the second primer probe is shown in SEQ ID NO:4.

[0013] In a second aspect, the present application also provides a kit for assisting in the diagnosis of prostate cancer, the kit comprising SNP markers, wherein the SNP markers are a combination of rs7077830.

[0014] Optionally, the kit includes a first amplification primer and a second amplification primer, the nucleotide sequence of the first amplification primer is shown as SEQ ID NO:1, and the nucleotide sequence of the second amplification primer is shown as SEQ ID NO:2.

[0015] Optionally, the kit further comprises a first primer probe and a second primer probe, the nucleotide sequence of the first primer probe is shown in SEQ ID NO:3, and the nucleotide sequence of the second primer probe is shown in SEQ ID NO:4.

[0016] The above technical solution provided by the embodiment of the present application has the following advantages compared with the prior art:

[0017] An embodiment of the present application provides an application of a SNP marker in the preparation of a reagent for assisting the diagnosis of prostate cancer. By screening the genetic variation SNP sites in the enhancer region of the prostate gene NCOA4, it is determined that rs7077830 in the SNP site affects the enhancer-promoter interaction of NCOA4, thereby making the population carrying rs7077830 susceptible to prostate cancer, and further determining that early screening and detection of prostate cancer can be achieved through the detection of rs7077830, thereby filling the gap in the gene sites related to the enhancer region of the prostate cancer gene as SNP markers for early screening and diagnosis of prostate cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the present application and, together with the description, serve to explain the principles of the present application.

[0019] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.

[0020] Figure 1 This is a receiver operating characteristic curve diagram of the SNP markers provided in Example 3 of the present application. DETAILED DESCRIPTION

[0021] In order to make the purpose, technical solution and advantages of the embodiments of the present application clearer, the technical solution in the embodiments of the present application will be clearly and completely described below in conjunction with the drawings in the embodiments of the present application. Obviously, the described embodiments are part of the embodiments of the present application, not all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of this application.

[0022] It should be noted that, based on previous studies, there is a genetic variation SNP site in the enhancer region of the NCOA4 gene, namely rs7077830, which can regulate the expression of the NCOA4 gene by affecting the enhancer-promoter interaction of NCOA4, thereby affecting the susceptibility to prostate cancer. Compared with normal individuals, individuals carrying the rs7077830 risk genotype have a significantly increased risk of prostate cancer and can be considered a high-risk group for prostate cancer. Therefore, the detection of SNP sites related to the enhancer region of the NCOA4 gene can assist in the early screening and diagnosis of prostate cancer.

[0023] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in this application can be purchased from the market or prepared by existing methods.

[0024] The embodiment of the present application provides an application of a SNP marker in the preparation of a reagent for auxiliary diagnosis of prostate cancer, wherein the SNP marker is located at a genetic variation SNP site in an enhancer region of the gene NCOA4, and the SNP marker is a combination of rs7077830.

[0025] In some optional embodiments, the reagents include amplification primers for amplifying the SNP markers.

[0026] In the embodiment of the present application, by specifying that the reagent for auxiliary diagnosis of prostate cancer includes amplification primers for SNP markers, the amplification primers can be used to perform a large amount of amplification on rs7077830 where the SNP marker is located, thereby ensuring the accuracy of the reagent detection.

[0027] In some optional embodiments, the amplification primers include a first amplification primer, and the nucleotide sequence of the first amplification primer is shown in SEQ ID NO:1.

[0028] In the embodiment of the present application, by clarifying the specific nucleotide sequence of the first amplification primer, it is possible to ensure that the first amplification primer effectively amplifies the upstream nucleotide sequence of rs7077830, and ensure that the upstream nucleotide sequence of rs7077830 has a sufficient number, thereby ensuring the accuracy of the reagent detection.

[0029] In some optional embodiments, the amplification primers include a second amplification primer, and the nucleotide sequence of the second amplification primer is shown in SEQ ID NO:2.

[0030] In the embodiment of the present application, by clarifying the specific nucleotide sequence of the second amplification primer, it is possible to ensure that the second amplification primer effectively amplifies the downstream nucleotide sequence of rs7077830, and ensure that the downstream nucleotide sequence of rs7077830 has a sufficient number, thereby ensuring the accuracy of the reagent detection.

[0031] In some optional embodiments, the reagent also includes a primer probe for detecting the SNP marker.

[0032] In the embodiment of the present application, the control reagent also includes a primer probe, which can effectively ensure the accuracy of the detection of the amplified SNP marker, thereby ensuring the accurate detection of rs7077830 where the SNP marker is located.

[0033] In some optional embodiments, the primer probe includes a first primer probe, and the nucleotide sequence of the first primer probe is shown in SEQ ID NO:3.

[0034] In the embodiment of the present application, the control primer probe includes a first primer probe, and the upstream primer of the amplified SNP marker is detected by the first primer probe, thereby ensuring the accuracy of the primer probe in detecting the SNP marker.

[0035] In some optional embodiments, the probe includes a second primer probe, and the nucleotide sequence of the second primer probe is shown in SEQ ID NO:4.

[0036] In the embodiment of the present application, the control primer probe includes a second primer probe, and the downstream primer of the amplified SNP marker is detected by the second primer probe, thereby ensuring the accuracy of the primer probe in detecting the SNP marker.

[0037] Based on a general inventive concept, the present application also provides a kit for assisting in the diagnosis of prostate cancer, wherein the kit comprises SNP markers, and the SNP markers are a combination of rs7077830.

[0038] The kit is implemented based on the above application. The specific detection principle of the kit can refer to the above embodiment. Since the kit adopts part or all of the technical solutions of the above embodiment, it has at least all the beneficial effects brought by the technical solutions of the above embodiment, which will not be repeated here.

[0039] In the examples of the present application, the specific application form of the SNP marker is further clarified, and it is clarified that the SNP marker can be used as a specific application form of a detection kit.

[0040] In some optional embodiments, the kit includes a first amplification primer and a second amplification primer, the nucleotide sequence of the first amplification primer is shown as SEQ ID NO:1, and the nucleotide sequence of the second amplification primer is shown as SEQ ID NO:2.

[0041] In the embodiment of the present application, by introducing the designed first amplification primer and second amplification primer into the kit, the upstream nucleotide sequence of the SNP marker is amplified by the first amplification primer, and the downstream nucleotide sequence of the SNP marker is amplified by the second amplification primer, thereby fully amplifying the SNP marker by the first amplification primer and the second amplification primer.

[0042] In some optional embodiments, the kit further comprises a first primer probe and a second primer probe, the nucleotide sequence of the first primer probe is shown in SEQ ID NO:3, and the nucleotide sequence of the second primer probe is shown in SEQ ID NO:4.

[0043] In the embodiment of the present application, by introducing the first primer probe and the second primer probe, the first primer is used to specifically detect the upstream primer of the SNP marker, and then the second primer is used to specifically detect the downstream primer of the SNP marker, so that the SNP marker is detected by the designed first primer probe and the second primer probe.

[0044] The present application will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are intended only to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are usually measured according to national standards. If there is no corresponding national standard, then the conditions recommended by the manufacturer are followed.

[0045] Example 1

[0046] DNA extraction from subject's venous blood samples:

[0047] Before the blood samples were drawn, the patients and healthy volunteers were informed of the relevant matters. Then, 9,900 blood samples were drawn from Tongji Hospital affiliated to Tongji Medical College of Huazhong University of Science and Technology. After the blood samples were drawn, the DNA of these blood samples was extracted using the kit (DC111) of Nanjing Novozymes. The specific steps are as follows:

[0048] 1. Take about 2 mL of anticoagulated blood, centrifuge at 5000×g for 15 minutes at room temperature, discard the upper layer, and keep about 0.2 mL of blood cells. Add 800 μL of ACK Lysis Buffer, mix by inversion, lyse at room temperature for 10 minutes, centrifuge at 1000 rpm for 5 minutes, and discard the supernatant;

[0049] 2. Add 200 μL of PBS, 200 μL of Buffer BCL and 20 μL of Proteinase K to the above precipitate, shake and mix, and incubate in a shaking metal bath at 56°C and 1200 rpm for 45 min;

[0050] 3. Add 200 μL of anhydrous ethanol to the above liquid and mix thoroughly by turning it upside down;

[0051] 4. Transfer the mixture to the FastPure gDNA Mini Columns adsorption column, centrifuge at 12000rpm for 1min, discard the filtrate, and place the adsorption column in a collection tube;

[0052] 5. Add 500 μL of Buffer WA (with anhydrous ethanol added) to the adsorption column, centrifuge at 12000 rpm for 1 min, discard the filtrate, and place the adsorption column in a collection tube;

[0053] 6. Add 700 μL of Buffer WB (with anhydrous ethanol added) to the adsorption column, centrifuge at 12000 rpm for 1 min, discard the filtrate, and place the adsorption column in a collection tube;

[0054] 7. Repeat step 6 once, then place the adsorption column into the collection tube, centrifuge the empty column at 12000 rpm for 2 min, and leave the tube cap open at room temperature for 2 min to 5 min to ensure that the residual ethanol is completely removed;

[0055] 8. Place the adsorption column in a new 1.5 mL EP tube, add 50 μL of 56°C preheated Elution Buffer to the center of the adsorption column, centrifuge at 12000 rpm for 1 min to elute the DNA, discard the adsorption column, and store the DNA product at -20°C.

[0056] Example 2

[0057] Comparing Example 2 with Example 1, the difference between Example 2 and Example 1 is:

[0058] The obtained DNA product is subjected to genotyping, and the specific steps are as follows:

[0059] The typing platform used was TaqMan genotyping technology (ABI 7900HT Real Time PCR system, Applied Biosystems), and the 5 μL PCR reaction system was shown in Table 1:

[0060] Table 1 PCR reaction system

[0061]

[0062]

[0063] The reaction conditions were: pre-denaturation at 95 °C for 10 min, followed by 95 °C for 15 s and 60 °C for 1 min, for a total of 40 cycles.

[0064] The primers and probes used in the reaction are as follows:

[0065] rs7077830 amplification primers:

[0066] First amplification primer: AAAGTAGATTAGTGGTTGCTTGGAGAT (SEQ ID NO: 1)

[0067] Second amplification primer: CATCATCACAACCAATGTTTGAACT (SEQ ID NO: 2)

[0068] rs7077830 Primer Probe:

[0069] First primer probe: FAM-TTATGGAGTGACTTTTTCAA-MGB (SEQ ID NO: 3)

[0070] Second primer probe: HEX-TATGGAGTGACTTTTTGAA-MGB (SEQ ID NO: 4)

[0071] Example 3

[0072] Based on the genotyping of Example 2, the combination of rs7077830 was further analyzed:

[0073] Figure 1 The receiver operating characteristic curve diagram of the SNP markers provided in the examples of the present application is exemplarily shown;

[0074] In the above test results, the area under the receiver operating characteristic curve (ROC) (AUC) was used to evaluate the diagnostic value of potential SNP markers in distinguishing prostate cancer patients from healthy subjects. Figure 1 As shown in the figure. Since the receiver operating characteristic curve (ROC) is a tool used to evaluate the performance of a classifier at different thresholds, when evaluating the predictive ability of SNP markers, the receiver operating characteristic curve can be used to measure the trade-off between the true positive rate (also called sensitivity) and the false positive rate of the classifier. The closer the area under the ROC curve AUC (Area Under the Curve) is to 1, the more accurate the classification result is. When the AUC is between 0.5 and 1, it indicates that the classification result has a certain degree of accuracy.

[0075] And by Figure 1 It can be seen that the area under the curve of the receiver operating characteristic curve of rs7077830 is above 0.528, which clearly shows that rs7077830 is a conservative SNP marker with potential screening ability.

[0076] One or more technical solutions in the embodiments of the present application also have at least the following technical effects or advantages:

[0077] (1) The present invention provides an embodiment of a SNP marker for use in the preparation of a reagent for assisting the diagnosis of prostate cancer. By screening the genetic variation SNP sites in the enhancer region of the prostate gene NCOA4, it is determined that rs7077830 in the SNP site affects the enhancer-promoter interaction of NCOA4, thereby making the population carrying rs7077830 susceptible to prostate cancer. It is further determined that early screening and detection of prostate cancer can be achieved by detecting rs7077830, thereby filling the gap in the use of gene sites related to the enhancer region of the prostate cancer gene as SNP markers for early screening and diagnosis of prostate cancer.

[0078] (2) The use of a SNP marker provided in an embodiment of the present application in the preparation of a reagent for assisting the diagnosis of prostate cancer can be simple and feasible through reasonable design based on the principle of application. It only requires taking a venous blood sample from the patient for detection, without the need for invasive operations such as tissue biopsy.

[0079] (3) The embodiment of the present application provides a kit for assisting in the diagnosis of prostate cancer. By designing specific primers and probes for the rs7077830 site, it is possible to detect genetic variations at the rs7077830 site in normal people by relying solely on fluorescent quantitative PCR, thereby identifying high-risk groups for prostate cancer and assisting in the early screening and diagnosis of prostate cancer patients.

[0080] (4) The present application provides a kit for assisting in the diagnosis of prostate cancer, which has accurate and reliable results and can be promoted in hospitals at all levels, and is of great help in assessing the risk of prostate cancer.

[0081] Various embodiments of the present application may be presented in the form of a range; it should be understood that the description in the form of a range is only for convenience and brevity, and should not be understood as a rigid limitation on the scope of the present application; therefore, the range description should be considered to have specifically disclosed all possible sub-ranges and single numerical values ​​within the range. For example, the range description from 1 to 6 should be considered to have specifically disclosed sub-ranges, such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as single numbers within the range, such as 1, 2, 3, 4, 5 and 6, which apply regardless of the range. In addition, whenever a numerical range is indicated herein, it is meant to include any cited number (fractional or integer) within the indicated range.

[0082] In this application, unless otherwise specified, directional words such as "upper" and "lower" used refer specifically to the directions of the drawings in the accompanying drawings. In addition, in the description of the specification of this application, the terms "include", "comprise", etc. mean "including but not limited to".

[0083] In this article, relational terms such as "first" and "second" are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply that there is any such actual relationship or order between these entities or operations. In this article, "and / or" describes the association relationship of associated objects, indicating that there can be three relationships, for example, A and / or B, which can represent: A exists alone, A and B exist at the same time, and B exists alone. Wherein A, B can be singular or plural. In this article, "at least one" refers to one or more, and "multiple" refers to two or more. "At least one", "the following at least one (individual)" or similar expressions refer to any combination of these items, including any combination of single (individual) or plural (individual). For example, "at least one (individual) of a, b, or c", or "at least one (individual) of a, b, and c", can all represent: a, b, c, ab (i.e. a and b), ac, bc, or abc, wherein a, b, c can be single or multiple respectively.

[0084] The above description is only a specific implementation of the present application, so that those skilled in the art can understand or implement the present application. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present application. Therefore, the present application will not be limited to the embodiments shown herein, but will conform to the widest range consistent with the principles and novel features applied for herein.

Claims

1. Use of a SNP marker in the preparation of a reagent for assisting the diagnosis of prostate cancer, characterized in that: The SNP marker is located at a genetic variation SNP site in the enhancer region of the gene NCOA4, and the SNP marker is a combination of rs7077830; The reagent includes amplification primers for amplifying the SNP marker; the amplification primers include a first amplification primer and a second amplification primer, the nucleotide sequence of the first amplification primer is shown in SEQ ID NO: 1; the nucleotide sequence of the second amplification primer is shown in SEQ ID NO: 2; The reagent also includes a primer probe for detecting the SNP marker, the primer probe includes a first primer probe and a second primer probe, the nucleotide sequence of the first primer probe is shown in SEQ ID NO:3, and the nucleotide sequence of the second primer probe is shown in SEQ ID NO:

4.

2. A kit for assisting in the diagnosis of prostate cancer, characterized in that: The kit includes a SNP marker, which is a combination of rs7077830. The kit includes a first amplification primer and a second amplification primer, the nucleotide sequence of the first amplification primer is shown in SEQ ID NO: 1, and the nucleotide sequence of the second amplification primer is shown in SEQ ID NO:

2. The kit also includes a first primer probe and a second primer probe, the nucleotide sequence of the first primer probe is shown in SEQ ID NO: 3, and the nucleotide sequence of the second primer probe is shown in SEQ ID NO: 4.

Images