Use of xpo7 in the treatment of esophageal squamous cell carcinoma

Abstract

The application discloses application of XPO7 in treatment of esophageal squamous carcinoma, and the XPO7 is applied to treatment of the esophageal squamous carcinoma as a sensitization target of a CDK4 / 6 inhibitor, and after XPO7 knockdown, the growth inhibition of the esophageal squamous carcinoma to the CDK4 / 6 inhibitor can be significantly increased; meanwhile, after the XPO7 inhibitor is combined with the CDK4 / 6 inhibitor, the XPO7 inhibitor can down-regulate a cell cycle related pathway, further promote expression down-regulation of a cell cycle related gene and inhibition of the cell cycle, so that the sensitivity of the esophageal squamous carcinoma to palbociclib is increased; moreover, by combining the XPO7 inhibitor with the CDK4 / 6 inhibitor, the drug resistance of the esophageal squamous carcinoma to palbociclib can be effectively reduced, the growth of the esophageal squamous carcinoma can be continuously and effectively inhibited, the applicable patient population is wider, and the application has wide popularization value.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biological medicine, and particularly relates to application of XPO7 as a sensitizing gene in combination with CDK4 / 6 inhibitors in treatment of esophageal squamous cell carcinoma. BACKGROUND

[0002] Esophageal cancer is one of the common malignant tumors, and more than 90% of esophageal cancers in China are pathologically manifested as squamous cell carcinoma, i.e. esophageal squamous cell carcinoma. For early esophageal squamous cell carcinoma, surgical resection is the most effective treatment. However, esophageal squamous cell carcinoma has the characteristic of late symptom onset, and most patients lose the opportunity for surgical resection when they seek medical treatment. Therefore, exploring potential targets of esophageal squamous cell carcinoma is of great significance for improving the cure rate of esophageal squamous cell carcinoma and improving the quality of life of patients.

[0003] Cyclin-dependent kinase 4 / 6 (CDK4 / 6) is a class of serine / threonine protein kinases, which forms a complex with regulatory subunit-cyclin D1 and produces kinase activity, and then phosphorylates and changes the spatial conformation of retinoblastoma protein I (RB1), releases and activates E2F, and finally regulates the initiation and conversion of each period of the cell cycle. At present, CDK4 / 6 is being developed as an effective target for clinical application in various tumors.

[0004] According to the previous research of the inventors, it is found that esophageal squamous cell carcinoma cell lines are generally more sensitive to CDK4 / 6 inhibitors, such as palbociclib. However, the use of single drug soon produces drug resistance. The inventors can effectively inhibit the growth of esophageal squamous cell carcinoma by combining CDK4 / 6 inhibitors with epidermal growth factor family receptor inhibitors, such as afatinib. However, this combination drug strategy can only benefit part of the patients with "gene amplification" or "dependence" of the epidermal growth factor family. Therefore, it is necessary to design more effective combination drugs to enhance the growth inhibition of esophageal squamous cell carcinoma and improve the clinical efficacy.

[0005] XPO7 is a member of a broad-spectrum bidirectional transporter family, which transports functional molecules into the nuclear membrane of eukaryotic cells or out of the nucleus to the cytoplasm to achieve cellular homeostasis. At present, there is little research on XPO7, and there is no report on XPO7 sensitizing CDK4 / 6 inhibitors to inhibit the growth of esophageal squamous cell carcinoma. SUMMARY

[0006] In esophageal squamous cell carcinoma, CDK4 / 6 inhibitors promote cell cycle arrest, however, tumor cells may re-enter the proliferation cycle through feedback activation of bypass cell cycle factor CCNE1-CDK2 complex, or promote RB phosphorylation inactivation and other pathways.

[0007] The team of inventors found that exploring the key molecular target for the sensitization mechanism of CDK4 / 6 inhibitors in the treatment of esophageal squamous cell carcinoma, and designing effective combination drug is an effective way to overcome the drug resistance of esophageal squamous cell carcinoma to CDK4 / 6 inhibitors and improve the growth inhibition effect of CDK4 / 6 inhibitors on esophageal squamous cell carcinoma. XPO7 can be used as a sensitization target of CDK4 / 6 in the treatment of esophageal squamous cell carcinoma. In the experiment, by using sgRNA to knock down XPO7 in vivo and in vitro combined with CDK4 / 6 inhibitor to treat esophageal squamous cell carcinoma cells, XPO7 knockdown can significantly enhance the growth inhibition effect of CDK4 / 6 inhibitor on esophageal squamous cell carcinoma cell lines in vivo and in vitro.

[0008] Through mechanism research, it is found that inhibiting XPO7 can down-regulate cell cycle-related pathways such as E2F pathway and G2M pathway, down-regulate the expression of cell cycle-related proteins, thereby increasing the sensitivity of esophageal squamous cell carcinoma to palbociclib, and significantly enhancing the growth inhibition effect of CDK4 / 6 inhibitor on esophageal squamous cell carcinoma.

[0009] Based on the experimental results and mechanism research, one object of the present application is to provide the application of XPO7 in the treatment of esophageal squamous cell carcinoma, and to apply XPO7 as a sensitization target of CDK4 / 6 inhibitor in the treatment of esophageal squamous cell carcinoma. XPO7 knockdown can significantly increase the growth inhibition of CDK4 / 6 inhibitor on esophageal squamous cell carcinoma.

[0010] The present application provides an application of XPO7, which is the application of XPO7 inhibitor in the preparation of a drug for treating esophageal squamous cell carcinoma. In this technical solution, the XPO7 inhibitor is an agent that can knock down the expression of XPO7, such as sgRNA that can knock down XPO7.

[0011] The present application provides another application of XPO7, which is the application of XPO7 inhibitor in the preparation of a drug for inhibiting the growth of esophageal squamous cell carcinoma.

[0012] Further, the XPO7 inhibitor is used in combination with the CDK4 / 6 inhibitor. In this technical solution, the CDK4 / 6 inhibitor can adopt any existing CDK4 / 6 inhibitor such as palbociclib, ribociclib, or other agents that can inhibit the physiological activity of CDK4 / 6 enzyme in the body.

[0013] Further, the XPO7 inhibitor is used to knock down XPO7, reduce the drug resistance of esophageal squamous cell carcinoma to the enhanced CDK4 / 6 inhibitor, and enhance the growth inhibition effect of CDK4 / 6 inhibitor on esophageal squamous cell carcinoma.

[0014] Further, the XPO7 inhibitor is used to down-regulate cell cycle related pathways to increase the sensitivity of esophageal squamous cell carcinoma to palbociclib. Through mechanism experiments, it is found that the XPO7 inhibitor can further down-regulate cell cycle related pathways such as E2F pathway, G2M pathway and MITOTIC pathway by knocking out XPO7, thereby increasing the sensitivity of esophageal squamous cell carcinoma to palbociclib.

[0015] Another object of the present application is to provide a combination drug composition based on the feature that XPO7 can be used as a sensitization target for CDK4 / 6 inhibitors for the treatment of esophageal squamous cell carcinoma, wherein the main active ingredients of the combination drug composition include an XPO7 inhibitor and a CDK4 / 6 inhibitor.

[0016] In some embodiments, the combination drug composition is a combination of two separate preparations, which can be administered simultaneously or sequentially.

[0017] In some preferred embodiments, the XPO7 inhibitor is an siRNA, sgRNA or small molecule inhibitor targeting XPO7. In one or more embodiments, the XPO7 is preferably an sgRNA, and the nucleotide sequence of the XPO7 can be sgXPO7#2: CGGTACCTAAATCCACCATG (SEQ ID NO. 1) or sgXPO7#3: GCTGGAAACTTACACTCCTG (SEQ ID NO. 2).

[0018] In some embodiments, the combination drug composition further includes a pharmaceutically acceptable excipient, wherein the pharmaceutically acceptable excipient includes a carrier, a diluent, a filler, a binder, a wetting agent, a disintegrant, an emulsifier, a co-solvent, a solubilizer, an osmotic pressure regulator, a surfactant, a coating material, a coloring agent, a pH regulator, an antioxidant, a bacteriostatic agent or a buffer.

[0019] Further, the XPO7 inhibitor is an sgRNA, and the nucleotide sequence of the sgRNA is shown in SEQ ID NO. 1 or SEQ ID NO. 2.

[0020] Further, the CDK4 / 6 inhibitor is at least one of palbociclib, ribociclib and abemaciclib. In some embodiments, the CDK4 / 6 inhibitor can also be at least one of a pharmaceutically acceptable salt, isomer, solvate or metabolite of palbociclib, ribociclib and abemaciclib.

[0021] The present application also provides the use of any of the aforementioned combination drug compositions in the preparation of a medicament for treating esophageal squamous cell carcinoma, or the use of any of the aforementioned combination drug compositions in the preparation of a medicament for inhibiting the growth of esophageal squamous cell carcinoma.

[0022] Compared with the prior art, the present application has the following advantages and beneficial effects:

[0023] 1、The present application applies XPO7 as a sensitization target of CDK4 / 6 inhibitor to the treatment of esophageal squamous carcinoma, and after XPO7 knockdown, the growth inhibition of CDK4 / 6 inhibitor on esophageal squamous carcinoma can be significantly increased;

[0024] 2、After the combination of XPO7 inhibitor and CDK4 / 6 inhibitor, the XPO7 inhibitor can down-regulate the cell cycle related pathway, further promote the down-regulation of cell cycle related gene expression and cell cycle inhibition, thereby increasing the sensitivity of esophageal squamous carcinoma to palbociclib;

[0025] 3、By combining XPO7 inhibitor and CDK4 / 6 inhibitor, the present application can effectively reduce the drug resistance of esophageal squamous carcinoma to palbociclib, continuously and effectively inhibit the growth of esophageal squamous carcinoma, and is suitable for a wider patient population, and has wide popularization value. BRIEF DESCRIPTION OF DRAWINGS

[0026] The accompanying drawings, which are included to provide a further understanding of the embodiments of the application and constitute a part of this application, illustrate embodiments of the application and do not limit the embodiments of the application. In the drawings:

[0027] Figure 1 The electropherograms after transfection of four sgRNAs for knocking down XPO7 in esophageal squamous carcinoma cell lines (TE11, KYSE140) in the specific embodiments of the present application are shown;

[0028] Figure 2 The comparison chart of competitive growth experiments of different esophageal squamous carcinoma cell lines (TT, TE10, TE11, KYSE140) in the specific embodiments of the present application is shown;

[0029] Figure 3 The comparison chart of clonogenic assays of each experimental group in the specific embodiments of the present application is shown;

[0030] Figure 4 The tumor volume change trend of each nude mouse subcutaneous tumor model experimental group in the process of continuous treatment for 35 days in the specific embodiments of the present application is shown;

[0031] Figure 5 The comparison chart of the influence of XPO7 knockout combined with palbociclib on the expression of cell cycle pathway in the specific embodiments of the present application is shown;

[0032] Figure 6The influence of knocking out XPO7 to down-regulate cell cycle related pathways in the specific embodiments of the present application is shown, wherein the abscissa is the negative logarithm of FDR, the ordinate is the pathway name, the bubble size represents the credibility of the statistical enrichment result of ES (enrichment score), the larger the bubble, the more credible the result; the bubble color represents the normalized enrichment analysis, the larger the NES (normalized ES), the more significant the statistical significance of the enrichment trend. DETAILED DESCRIPTION

[0033] In order to make the objectives, technical solutions and advantages of the present application clearer, further detailed description of the present application is made below in combination with examples and drawings, the schematic embodiments of the present application and the description thereof are only used to explain the present application, and do not limit the present application.

[0034] All raw materials of the present application are not particularly limited in source, and can be purchased on the market or prepared according to the conventional method well known to those skilled in the art. All raw materials of the present application are not particularly limited in purity, and the present application preferably adopts analytical purity or the purity requirement conventional in the field of biological medicine. The trade name and abbreviation of all raw materials of the present application belong to the conventional trade name and abbreviation in the art, and each trade name and abbreviation is clear and explicit in the field of its relevant use. Those skilled in the art can purchase from the market or prepare by the conventional method according to the trade name, abbreviation and corresponding use.

[0035] Example 1

[0036] In this embodiment, four sgRNAs are designed for different sites of XPO7, and the esophageal squamous cell carcinoma cell line with stably knocked out XPO7 is established by transfecting the esophageal squamous cell carcinoma cells with the four sgRNAs.

[0037] Subsequently, the sgRNA capable of effectively knocking down XPO7 is screened by immunoblotting experiment. The cells are lysed in RIPA buffer containing protease inhibitor cocktail (Roche) and phosphatase inhibitor cocktail (BD). The cell lysate is dissolved on a 4-12% or 8-16% tricine SDS-polyacrylamide gel before being transferred to a PVDF membrane (Invitrogen). Then the membrane is probed with the first antibody at 4°C overnight, followed by incubation with the appropriate HRP-conjugated secondary antibody at room temperature for 1 hour.

[0038] The experimental results are shown in Table 1 and FIG. 1. Figure 1 As shown in Table 1 and FIG. 1, sgXPO7#2, sgXPO7#3 and sgXPO7#4 can effectively knock out XPO7, and sgXPO7#2 and sgXPO7#3 can more significantly reduce the expression of XPO7. In the subsequent experiments, sgXPO7#2 and sgXPO7#3 are used to knock down XPO7. The sequences of sgXPO7#2 and sgXPO7#3 are shown in Table 1.

[0039] Table 1:

[0040] SEQ ID NO Sequence sgXPO7#2 CGGTACCTAAATCCACCATG sgXPO7#3 GCTGGAAACTTACACTCCTG

[0041] Example 2

[0042] In this example, the inhibitory effect of CDK4 / 6 inhibitor such as palbociclib on the growth of esophageal squamous cell carcinoma after knocking out XPO7 was studied by competitive growth experiment.

[0043] The esophageal squamous cell carcinoma parent cells with fluorescent label were mixed with the esophageal squamous cell carcinoma cells with XPO7 knocked out without fluorescent label at a ratio of 1:1, and 2x10 4 ~ 1x10 5 The cells were plated in 6-well plates, incubated at room temperature in RPMI-1640 medium containing 10% FBS and 1% penicillin / streptomycin, and then treated with DMSO and palbociclib, respectively, for 2 weeks, with the treatment being replaced every 3-4 days, and the fluorescent intensity was detected by flow cytometry after 2 weeks.

[0044] The experimental results are shown in Table 2. Figure 2 For each esophageal squamous cell line, the fluorescence ratio (fluorescently labeled esophageal squamous cell carcinoma cells / knockout XPO7 esophageal squamous cell carcinoma cells) of the experimental group of knocking out XPO7 combined with palbociclib (Palbociclib_sgNXPO7#2, Palbociclib_sgNXPO7#3) was significantly lower than that of the experimental group of knocking out XPO7 only (DMSO_sgNXPO7#2, DMSO_sgNXPO7#3), the experimental group of using palbociclib only (Palbociclib_sgNT), and the control group (DMSO_sgNT). Thus, knocking out XPO7 significantly sensitizes the growth inhibition of palbociclib on cells.

[0045] Example 3

[0046] In this example, the effect of knocking out XPO7 in vitro combined with palbociclib on the proliferation ability and invasiveness of esophageal squamous cell carcinoma cells was further studied by colony formation experiment.

[0047] Specifically, 2x10 4 ~ 1x10 5 The cells were plated in 6-well plates, and then treated with DMSO, knocking out XPO7 only, palbociclib, or knocking out XPO7 combined with palbociclib, with the treatment being replaced every 3-4 days. After 7-10 days, the cells were fixed in 1% paraformaldehyde at room temperature for 15 minutes, washed twice with PBS, and stained with crystal violet solution at room temperature for 15 minutes.

[0048] The experimental results are shown in Table 3. Figure 3As shown, for esophageal squamous cell carcinoma cell line T10, KYSE410, the use of palbociclib can effectively inhibit the growth of esophageal squamous cell carcinoma, and after knocking down XPO7 using sgRNA (sgXPO7-2 / sgXPO7-3, Palbociclib 200nM), the growth inhibition of palbociclib on esophageal squamous cell carcinoma can be significantly increased.

[0049] In combination with competitive growth experiments and colony formation experiments, it can be seen that XPO7 can be used as a sensitization target of CDK4 / 6 for the treatment of esophageal squamous cell carcinoma.

[0050]

Example 4

[0051] In this embodiment, to study the effect of knocking down XPO7 on the CDK4 / 6 inhibitor palbociclib in vivo, a nude mouse subcutaneous tumor model was constructed, sgXPO7 in KYSE410 cells was established by lentiviral transfection, and the effect of XPO7 combined with palbociclib on the proliferation of esophageal squamous cell carcinoma cells in nude mice was tested.

[0052] In this embodiment, the in vivo animal experiment was approved by the Animal Ethics Committee of West China Hospital of Sichuan University, and 6-8 week old BALB / c nude mice were used.

[0053] Specifically, for the nude mouse subcutaneous tumor model, 2.5x10 6 KYSE410sgNT, sgXPO7#2, sgXPO7#3 three lentivirus knockout cell lines were suspended in 100 μl of culture medium and 100 μl of Matrigel at a volume ratio of 1:1 and implanted subcutaneously into the dorsal of female nude mice (6-8 weeks old, Nu / Nu). Then the tumor growth of the mice was checked every 5-7 days. The size of the tumor was measured using a caliper, and the tumor volume was calculated using the following formula: (length x width 2 ) x 0.5. When the subcutaneous tumor volume reached 100-130 mm 3 , the mice were randomly divided into six groups and received control (vehicle) or palbociclib treatment. The mice were orally administered palbociclib once a day at a dose of 50 mg / kg, and the treatment was continued for 35 days. The tumor volume was measured every 7 days.

[0054] The experimental results are as follows Figure 4As shown, the experimental groups treated with palbociclib in combination with XPO7 knockout (sgXPO7#2_Palbociclib, sgXPO7#3_Palbociclib) exhibited stronger tumor suppression during a treatment period of up to 35 days compared to palbociclib alone or XPO7 knockout alone. This indicates that XPO7 knockout can effectively overcome the resistance of esophageal squamous cell carcinoma to palbociclib and significantly enhance the inhibitory effect of palbociclib on the growth of esophageal squamous cell carcinoma.

[0055]

Example 5

[0056] In this embodiment, the cell cycle changes of esophageal cancer cells KYSE140 were measured to verify the effect of knocking out XPO7 combined with palbociclib on the expression of the cell cycle pathway.

[0057] Specifically, cells were collected after treatment with DMSO or palbociclib for 24 or 48 hours, and then fixed with 70% ethanol at 4°C for 30 minutes. Fixed cells were washed with PBS containing 1% FBS and stained with PI / RNase staining solution (CST4087) at room temperature for 30 minutes. DNA content was measured by LSR II flow cytometry and analyzed using ModFIT LT software.

[0058] Experimental results are as follows Figure 5 As shown in the figure, NT-PALBOCICLIB-200nM and NT-PALBOCICLIB-500nM represent the experimental groups using only 200nM and 500nM palbociclib, respectively; SGXPO7-2-200nM and SGXPO7-2-500nM represent the experimental groups using sgXPO7#2 to knock down XPO7 in combination with 200nM or 500nM palbociclib, respectively; SGXPO7-3-200nM and SGXPO7-3-500nM represent the experimental groups using sgXPO7#3 to knock down XPO7 in combination with 200nM or 500nM palbociclib, respectively. As the figure shows, knocking out XPO7 in combination with palbociclib significantly increased cell G1 phase arrest.

[0059]

Example 6

[0060] In this example, the specific mechanism of inhibiting XPO7 to participate in the growth inhibition of esophageal squamous carcinoma by palbociclib was further verified. Specifically, esophageal cancer cell lines were treated with XPO7 knockdown or palbociclib 500nM and their combination for 72 hours, total RNA was extracted using Qiagen RNeasy kit and treated with DNase I. RNA-seq library was prepared using NEBNet ultra directional RNA library preparation kit (NEB, E7420S) and sequenced on Illumina next generation sequencing instrument (150-bp single-end reads for mRNA sequencing).

[0061] Read alignment, quality control and data analysis were performed using VIPER. STAR alinger was used for alignment and counting of sequencing reads, and expression matrix was generated by Cufflinks. DESeq2 was used for differential gene expression analysis, and pre-ranked gene set enrichment analysis was performed. The expression matrix is shown as Figure 6 Pathway analysis suggested that knockdown of XPO7 increased the sensitivity of esophageal squamous carcinoma to palbociclib by further down-regulating cell cycle-related pathways such as E2F pathway, G2M pathway and MITOTIC pathway.

[0062] The above specific embodiments further illustrate the purpose, technical solutions and beneficial effects of the present application. It should be understood that the above description is only a specific embodiment of the present application and is not intended to limit the protection scope of the present application. Any modification, equivalent replacement, improvement, etc. within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. A combination pharmaceutical composition, characterized by comprising: The XPO7 inhibitor is an sgRNA, the nucleotide sequence of the sgRNA is shown as SEQ ID NO. 1 or SEQ ID NO. 2; and the CDK4 / 6 inhibitor is palbociclib.

2. The use of a combined pharmaceutical composition according to claim 1 in the preparation of a medicament for treating esophageal squamous cell carcinoma.

Images