DNA-based nanomachine-based electrochemical sensor for serotonin

Abstract

This invention discloses the construction method, structure, and application of a serotonin electrochemical sensor based on a DNA framework nanomachine. The method involves preparing a DNA triangular prism structure, electrochemically converting the metal framework material, constructing an electrochemical sensing interface for serotonin detection, and quantitatively detecting serotonin in serum samples. The electrochemical sensor for serotonin detection utilizes DNA self-assembly technology to fabricate nanotriangular prisms (DTPs), introduces an entropy-driven loop reaction for cyclic amplification, and electrochemically converts the metal framework material (MOF) to produce efficient signal output, enabling sensitive detection of serotonin in serum samples with a detection limit as low as 0.4 pM. This research has important applications in the prevention, diagnosis, and treatment of diseases such as depression and carcinoid syndrome.

Description

Technical Field

[0001] The present invention relates to the field of electrochemical biosensors, and in particular to a construction method, construction structure and application of a serotonin electrochemical sensor based on a DNA framework nanomachine. Background Art

[0002] Serotonin is an important signaling molecule, acting as a neurotransmitter in the brain and crucially regulating various human activities and emotions. Imbalances in serotonin levels are associated with depression, addiction, and the development of various tumors. Therefore, detecting changes in serotonin levels is crucial for clinical diagnosis and medical research. Traditional methods for measuring serotonin often rely on its chemical structure, redox activity, and optical properties. These methods require specialized and expensive instrumentation and suffer from low specificity. In recent years, the development of molecular probes, including aptamers, genetically encoded proteins, and organic molecules, has made it possible to detect serotonin by exploiting its interaction with serotonin. Aptamers are oligonucleotides synthesized through in vitro screening experiments and possess advantages such as high affinity, strong selectivity, and ease of synthesis. Therefore, aptamer sensors are effective tools for detecting serotonin.

[0003] As a simple and effective amplification strategy, entropy-driven DNA circuits have the advantages of efficient catalytic ability, signal amplification ability and easy programming, and have been widely used in the research of molecular detection and logic gate construction. Compared with other amplification methods, entropy-driven DNA circuits effectively reduce the probability of nonspecific reactions and have a higher signal-to-noise ratio. However, most entropy-driven DNA circuits are composed of several freely diffusing DNA components in solution, with a low probability of molecular collisions and reduced reaction efficiency. To solve this problem, the invention prepares nano-triangular prisms (DTP) through DNA self-assembly, loads the reactants of the entropy-driven circuit with DTP, improves the reaction efficiency, constructs an aptamer sensor, and performs cyclic amplification detection of serotonin. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a construction method, construction structure and application of a serotonin electrochemical sensor based on a DNA framework nanomachine. Nanotriangular prisms (DTP) are prepared using DNA self-assembly technology, an entropy-driven loop reaction is introduced for cyclic amplification, and efficient signal output is achieved through electrochemical conversion of metal framework materials (MOFs), thereby realizing sensitive detection of serotonin in serum samples.

[0005] To solve the above technical problems, the technical solution of the present invention is: a serotonin electrochemical sensor based on a DNA framework nanomachine, the innovation of which is that the serotonin electrochemical sensor based on a DNA framework nanomachine includes the following steps:

[0006] Step S1: First, the gold electrode is polished and electrochemically treated, and the fixed probe IP is modified onto the surface of the gold electrode AuE, and then blocked with mercaptohexanol MCH to obtain MCH / IP / AuE;

[0007] Wherein, the sequence of the IP is 5'-CGCTCTTCTATATTGTTTTTT-SH-(CH2)6-3';

[0008] Step S2: preparing MOF material by hydrothermal method, and modifying the signal probe SP on the MOF surface to obtain SP-MOF;

[0009] Wherein, the sequence of the SP is 5'-CCCTACGCATCGAATCTTTTTTTTT-COOH-3';

[0010] Step S3: DNA single strands S1, S2, and S3 were mixed and annealed to obtain DTP, and then Aptamer / BP, SP-MOF, AP, FP, S1D, S3U, and S3D were self-assembled into the DTP structure to obtain DTP / (Aptamer / BP+(SP-MOF)-AP+FP);

[0011] Wherein, the sequence of S1 is 5'-CTCTATTCACGTCTATTTTTTCATGAGTCAGGGCGACGACATGAGTCAGGGCTTTTGAGATACACAAGGTGAGCACGAGATACACAAGGTTTTTGTTTAGAGCCAATGTCCAGTTTAGAGCCAATTTTTTGAGTCCCTCTGAGTCC-3'; The sequence of S2 is 5'-GAAGCTGATTCGATGCGTAGGGCGCTCTTCTATATTGTTTTAATAGACGTGAATAGAGGGACTCAGAGGGACTCATTTTAAAGCCGTAGAACGAACGAAAGCCGTAGAACTTTTAGTCTTCTGTTTGGACTGGTGACTAGTCGTTTGG-3'; the S3 The sequence is 5'-CTCACCTTGTGTATCTCTTTTACGAAGCATACGAATCTCACGAAGCATACGATTTTCCAAACGACTAGTCACCAGTCCAAACAGAAGACTTTTTCTCCTAAGATGCCGTGTCCTCCTAAGATGCCTTTTACCTTGTGTATCTCGTG-3'; the sequence of the Aptamer is 5'-CGACTGGTAGGCAGATAGGGGAAGCTGATTCGATGCGTGGGTCGGCCCTGACTCATGTCGTCGCCCTGACTCATG-3'; the sequence of the BP is 5'-ACGCATCGAATCAGCTTC-3'; the sequence of the AP is 5'-CAATATAGAAGAGCG-3'; the sequence of the FP is 5'-GTTCTAC GGCTTTCGTTCGTTCTACGGCTTTTTTTTTCAATATAGAAGAGCGCCCTACGCATCGAATC-3'; the sequence of the S1D is 5'-ATTGGCTCTAAACTGGACATTGGCTCTAAAC-3'; the sequence of the S3U is 5'-TCGTATGCTTCGTGAGATTCGTATGCTTCGT-3'; the sequence of the S3D is 5'-GGCATCTTAGGAGGACACGGCATCTTAGGAG-3';

[0012] Step S4: Serotonin at different concentrations was mixed with DTP / (Aptamer / BP+(SP-MOF)-AP+FP), transferred to the MCH / IP / AuE surface for reaction, and then electrochemical conversion of MOF was performed.

[0013] Preferably, the operation of preparing the sensing interface in step S1 is to first polish the gold electrode with alumina powder, place the electrode in a dilute sulfuric acid solution for cyclic voltammetry scanning, blow dry with nitrogen, react the fixed probe IP with tris(2-carboxyethyl)phosphine for 60 minutes, add it dropwise to the electrode surface in the dark for 12 hours, rinse, and then add mercaptohexanol MCH dropwise to the electrode for 30 minutes to seal, thereby obtaining MCH / IP / AuE.

[0014] Preferably, the experimental operation of step S2 is to mix an aqueous solution of trivalent iron (such as a ferric chloride solution) with a surfactant Pluronic F127, add acetic acid and terephthalic acid in sequence and stir for 2 hours, then transfer it to a polytetrafluoroethylene reactor and place it at a high temperature of 110°C for 24 hours. After centrifugal drying, the obtained MOF is mixed with 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC), N-hydroxysuccinimide (NHS) and SP for 5 hours to obtain SP-MOF.

[0015] Preferably, the experimental operation of step S3 is to mix DNA single strands S1, S2, and S3 in equal moles, heat them at 95°C for 10 minutes, and then cool them to room temperature at a rate of 1°C / minute to obtain a DTP structure. Subsequently, the mixture is mixed with Aptamer / BP, SP-MOF, AP, S1D, S3U, and S3D in equal proportions and stirred at room temperature for 1 hour. Then, an equal molar amount of FP is added and stirred at room temperature for 1 hour to obtain DTP / (Aptamer / BP+(SP-MOF)-AP+FP).

[0016] Preferably, the experimental operation of step S4 is to mix DTP / (Aptamer / BP+(SP-MOF)-AP+FP) with different concentrations of serotonin, transfer it to the surface of MCH / IP / AuE and react at room temperature for 30 minutes, then place the electrode in K3Fe(CN)6 solution and apply a voltage of 1.6V to generate Fe 3+ , then reacts at a voltage of 0V to produce Prussian white PW, which is oxidized by oxygen to obtain Prussian blue PB on the electrode surface.

[0017] The construction structure of a serotonin electrochemical sensor based on a DNA framework nanomachine is applied to the construction method of a serotonin electrochemical sensor based on a DNA framework nanomachine. The construction structure of the serotonin electrochemical sensor based on a DNA framework nanomachine is an electrochemical sensor obtained by adopting the construction method of a serotonin electrochemical sensor based on a DNA framework nanomachine.

[0018] The application of the serotonin electrochemical sensor based on the DNA framework nanomachine is the application of the electrochemical sensor in detecting the serotonin content in a serum sample.

[0019] The advantages of the present invention are that, compared with the existing technology, the present invention utilizes DNA self-assembly technology to prepare nano triangular prism DTP, introduces an entropy-driven loop reaction for cyclic amplification, and performs efficient signal output through electrochemical conversion of metal framework material MOF, thereby realizing sensitive detection of serotonin in serum samples. This provides a construction method, construction structure and application of an efficient electrochemical sensor for detecting biomarkers, and has important application value in the prevention, diagnosis and treatment of diseases such as depression and carcinoid syndrome. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The present invention will be described in further detail below with reference to the accompanying drawings and specific embodiments.

[0021] Figure 1 Schematic diagram of the principle of the serotonin electrochemical sensor based on the DNA framework nanomachine of the present invention;

[0022] Figure 2 This is a feasibility characterization diagram of the serotonin electrochemical sensor based on the DNA framework nanomachine of the present invention;

[0023] Figure 3 The present invention is based on the DNA framework nanomachine constructed based on the target regulation to detect serotonin by cyclic amplification. Characterization diagram: (AB), atomic force microscopy characterization; C, dynamic light scattering characterization; D, zeta potential characterization;

[0024] Figure 4 Figure 1 shows the quantitative detection of serotonin in the DNA framework nanomachine-based serotonin electrochemical sensor of the present invention: A, current response caused by different concentrations of serotonin; B, linear relationship between current and logarithm of concentration;

[0025] Figure 5 This is a detection diagram of a serum sample in the serotonin electrochemical sensor based on the DNA framework nanomachine of the present invention. DETAILED DESCRIPTION

[0026] The serotonin electrochemical sensor based on the DNA framework nanomachine of the present invention comprises the following steps:

[0027] Step S1: First, the gold electrode is polished and electrochemically treated, and the immobilized probe IP is modified onto the surface of the gold electrode AuE, and then blocked with mercaptohexanol MCH to obtain MCH / IP / AuE; wherein the sequence of the IP is 5'-CGCTCTTCTATATTGTTTTTT-SH-(CH2)6-3';

[0028] Step S2: preparing MOF material by hydrothermal method, and modifying the surface of MOF with signal probe SP to obtain SP-MOF; wherein the sequence of the SP is 5'-CCCTACGCATCGAATCTTTTTTTTT-COOH-3';

[0029] Step S3: DNA single strands S1, S2, and S3 are mixed and annealed to obtain DTP, and then Aptamer / BP, SP-MOF, AP, FP, S1D, S3U, and S3D are self-assembled into the DTP structure to obtain DTP / (Aptamer / BP+(SP-MOF)-AP+FP); wherein the sequence of S1 is 5'-CTCTATTCACGTCTATTTTTTCATGAGTCAGGGCGACGACATGAGTCAGGGCTTTTGAGATACACAAGGTGAGCACGAGATACACAAGGTTTTTGTTTAGAGCCAATGTCCAGTTTAGAGCCAATTTTTTGAGTCCCTCTGAGTCC-3'; the sequence of S2 is 5'-GAAGCTGATTCGATGCGTA GGGCGCTCTTCTATATTGTTTTAATAGACGTGAATAGAGGGACTCAGAGGGACTCATTTTAAAGCCGTAGAACGAACGAAAGCCGTAGAACTTTTAGTCTTCTGTTTGGACTGGTGACTAGTCGTTTGG-3'; the sequence of S3 is 5'-CTCACCTTGTGTATCTCTTTTACGA AGCATACGAATCTCACGAAGCATACGATTTTCCAAACGACTAGTCACCAGTCCAAACAGAAGACTTTTTCTCCTAAGATGCCGTGTCCTCCTAAGATGCCTTTTACCTTGTGTATCTCGTG-3'; the sequence of the Aptamer is 5'-CGACTGGTAGGCAGATAGGGGAAGCTGA TTCGATGCGTGGGTCGGCCCTGACTCATGTCGTCGCCCTGACTCATG-3'; the sequence of the BP is 5'-ACGCATCGAATCAGCTTC-3'; the sequence of the AP is 5'-CAATATAGAAGAGCG-3'; the sequence of the FP is 5'-GTTCTACGGCTTTCGTTCGTTCTACGGCTTTTTTTTTCAATATAGAAGAGCGCCCTACGCATCGAATC-3'; the sequence of the S1D is 5'-ATTGGCTCTAAACTGGACATTGGCTCTAAAC-3'; the sequence of the S3U is 5'-TCGTATGCTTCGTGAGATTCGTATGCTTCGT-3'; the sequence of the S3D is 5'-GGCATCTTAGGAGGACACGGCATCTTAGGAG-3';

[0030] Step S4: Serotonin at different concentrations was mixed with DTP / (Aptamer / BP+(SP-MOF)-AP+FP), transferred to the MCH / IP / AuE surface for reaction, and then electrochemical conversion of MOF was performed.

[0031] The present invention utilizes DNA self-assembly technology to prepare nano-triangular prisms DTP, introduces an entropy-driven loop reaction for cyclic amplification, and electrochemically converts the metal framework material MOF for efficient signal output, thereby achieving sensitive detection of serotonin in serum samples. This provides a construction method, construction structure, and application of an efficient electrochemical sensor for detecting biomarkers, which has important application value in the prevention, diagnosis, and treatment of diseases such as depression and carcinoid syndrome.

[0032] The operation of preparing the sensing interface in the above-mentioned step S1 is as follows: first, the gold electrode is polished with aluminum oxide powder, the electrode is placed in a dilute sulfuric acid solution for cyclic voltammetry scanning, and after drying with nitrogen, the fixed probe IP is reacted with tris(2-carboxyethyl)phosphine for 60 minutes, and then added dropwise to the electrode surface in the dark for 12 hours. After rinsing, mercaptohexanol MCH is added dropwise to the electrode for sealing for 30 minutes to obtain MCH / IP / AuE.

[0033] The experimental operation of the above-mentioned step S2 is as follows: an aqueous solution of trivalent iron (e.g., ferric chloride solution) is mixed with a surfactant Pluronic F127, acetic acid and terephthalic acid are added in sequence and stirred for 2 hours, and then the mixture is transferred to a polytetrafluoroethylene reactor and placed at a high temperature of 110°C for 24 hours. After centrifugal drying, the obtained MOF is mixed with 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC), N-hydroxysuccinimide (NHS) and SP for 5 hours to obtain SP-MOF.

[0034] The experimental operation of the above-mentioned step S3 is to mix the DNA single strands S1, S2, and S3 in equal moles, heat them at 95°C for 10 minutes, and then cool them to room temperature at a rate of 1°C / minute to obtain the DTP structure. Subsequently, they are mixed with Aptamer / BP, SP-MOF, AP, S1D, S3U, and S3D in equal proportions and stirred at room temperature for 1 hour. Then, an equal molar amount of FP is added and stirred at room temperature for 1 hour to obtain DTP / (Aptamer / BP+(SP-MOF)-AP+FP).

[0035] The experimental operation of step S4 is as follows: DTP / (Aptamer / BP+(SP-MOF)-AP+FP) was mixed with different concentrations of serotonin, transferred to the surface of MCH / IP / AuE and reacted at room temperature for 30 minutes. Then, the electrode was placed in K3Fe(CN)6 solution and a voltage of 1.6V was applied to generate Fe 3+, then reacts at a voltage of 0V to produce Prussian white PW, which is oxidized by oxygen to obtain Prussian blue PB on the electrode surface.

[0036] The electrochemical sensor for detecting serotonin is constructed using the method for constructing a serotonin electrochemical sensor based on a DNA framework nanomachine. The serotonin electrochemical sensor based on a DNA framework nanomachine is used to detect serotonin levels in serum samples.

[0037] The specific principles are as follows:

[0038] The method for constructing the sensor in the invention is as follows Figure 1 As shown. First, three DNA single strands S1, S2 and S3 are annealed and hybridized to obtain the basic structure of a DNA triangular prism. Aptamer / BP, (SP-MOF)-AP and FP are then self-assembled on DTP in sequence, where Aptamer / BP and FP are located at two opposite vertices of the triangular prism, and SP-MOF and AP are located on the same side of the triangular prism. When the target serotonin specifically binds to the aptamer, the aptamer undergoes a conformational change to release the BP chain, and BP triggers a chain displacement reaction. In this reaction, BP first binds to the terminal toehold to displace the SP-MOF, exposing the toehold in the middle region of DTP. The FP chain undergoes a chain displacement reaction with the help of the toehold, releasing the BP chain and allowing it to be recycled. Based on this cyclic reaction, a large amount of SP-MOF is released and immobilized on the electrode surface by hybridization with the IP chain. MOF is used as a precursor to produce Prussian blue through electrochemical conversion. The reaction mechanism is summarized as follows: (1) The electrode undergoes hydrolysis reaction at high potential to produce O2 and H + ; (2) H + Inducing MOF dissociation and releasing Fe 3+ ; (3) At low potential, Fe 3+ and Fe(CN)6 3- Reduced to Fe 2+ and Fe(CN)6 4- ; (4)Fe 2+ and Fe(CN)6 4- The reaction generates Prussian white (PW); (5) PW is oxidized by O2 to Prussian blue (PB). Finally, sensitive detection of serotonin is achieved by measuring the current signal of Prussian blue.

[0039] To demonstrate the feasibility of this method for detecting serotonin, we performed differential pulse voltammetry (DPV) tests ( Figure 2). When the electrode reacted with DTP / (Aptamer / BP+SP-AP+FP), the DPV curve had no obvious peak current (curve a). After the addition of serotonin, the current signal did not change significantly (curve b), which was due to the lack of electrical signal substances. When the sensor was incubated with DTP / (Aptamer / BP+(SP-MOF)-AP+FP), a very small current signal was obtained (curve c), which was caused by nonspecific adsorption. After adding a mixture of serotonin and DTP / (Aptamer / BP+(SP-MOF)-AP), a significant peak current was obtained at 0.23V (curve d). After further introduction of FP, the current signal increased significantly (curve e), indicating that FP drove the DNA chain displacement cycle reaction, thereby proving that the sensor can achieve amplified detection of serotonin.

[0040] The DNA nanostructures were then characterized. Figure 3 As can be seen from the AFM image of A, the prepared DTP complex is in a state of single particle dispersion. After adding the target serotonin, a cross-linked polymer structure is obtained ( Figure 3 B), indicating that multiple DTPs are connected together. The side length of the DTP structure is 34 bases, and its diameter is about 18.4nm according to theoretical calculations. Dynamic light scattering characterization shows that the actual particle size distribution of DTP is between 13.5nm and 21nm ( Figure 3 C) This slight difference may be due to the distortion of the DNA nanostructure. Further analysis revealed that the product particle size increased significantly after the addition of serotonin. Figure 3 Zeta potential characterization of D showed that the potential of the DNA complex changed from -12.3 mV to -39.4 mV with the addition of the target. These experimental results successfully demonstrated that the addition of serotonin triggered the connection of DTP.

[0041] In order to investigate the quantitative detection capability of the sensor, we recorded and analyzed the current responses induced by different concentrations of serotonin. Figure 4 As can be seen from A, the differential pulse voltammetry (DPV) current signal increases with the increase of serotonin concentration. Figure 4 Linear analysis of B showed that there was a good linear relationship between the DPV peak current value and the logarithm of serotonin concentration in the range of 1pM to 500nM (R 2 =0.9957), the linear equation is i=67.85+5.532lgc. By the 3 times standard deviation rule (LOD=3S b / m) and the detection limit was 0.4 pM, where S bis the standard deviation of the blank response, and m is the slope of the calibration curve. Furthermore, the relative standard deviation of the sensor obtained by repeated six detections of 1 nM serotonin was 3.9%, indicating that the sensor has excellent reproducibility.

[0042] We then selected common neurotransmitters and serotonin metabolites as interfering substances to investigate the specificity of the assay. Figure 5 A It can be seen that compared with the background signal, the response of interfering substances including epinephrine (NE), glycine (Gly), tryptophan (Trp), glucose (Glu), histamine (His) and 5-methoxytryptophan (MTP) did not change significantly. However, a concentration of serotonin ten times smaller (20nM) caused a significant increase in the current, and the mixture (Mix) of these interfering substances had no significant effect on the current of serotonin, proving that the sensor has excellent specificity. In addition, we analyzed the feasibility of the sensor in detecting human serum samples and investigated the applicability of this method in detecting actual biological samples. The serum sample was diluted 10 times with a buffer solution in advance, and different concentrations of serotonin (5pM, 50pM, 50nM and 500nM) were added. The experimental results are shown in the figure. Figure 5 As shown in Figure B, the current response caused by the blank serum sample is very small. After adding serotonin, the current signal of the sensor increases significantly. The current signal increases with the increase of serotonin concentration, indicating that this method has good applicability in actual sample detection.

[0043] It should be noted that, in the descriptions of this specification, terms are used only for descriptive purposes and to distinguish similar objects. There is no order of precedence between the two, nor should they be understood to indicate or imply relative importance. In addition, in the descriptions of this specification, unless otherwise specified, "a plurality" means two or more.

[0044] Any numerical values ​​recited herein include all values ​​therefrom in increments of one unit, provided that there is a separation of at least two units between any lower value and any higher value. These are merely examples intended to be expressly stated, and all possible combinations of numerical values ​​between the lowest value and the highest value recited are to be considered expressly stated in this specification in a similar manner.

[0045] It should be understood that the above description is for illustration and not for limitation. Many embodiments and many applications beyond the examples provided will be apparent to those skilled in the art upon reading the above description. Therefore, the scope of the present teachings should not be determined with reference to the above description, but rather with reference to the appended claims and the full scope of equivalents to which such claims are entitled. For the purpose of comprehensiveness, all articles and references, including disclosures of patent applications and publications, are incorporated herein by reference. The omission of any aspect of the subject matter disclosed herein from the foregoing claims is not intended to be a disclaimer of such subject matter, nor should it be assumed that the inventors did not consider such subject matter to be part of the disclosed inventive subject matter.

Claims

1. A serotonin electrochemical sensor based on a DNA framework nanomachine, characterized by: The serotonin electrochemical sensor based on the DNA framework nanomachine includes the following preparation steps: Step S1: First, the gold electrode is polished and electrochemically treated, and the fixed probe IP is modified onto the surface of the gold electrode AuE, and then blocked with mercaptohexanol MCH to obtain MCH / IP / AuE; Wherein, the sequence of the IP is 5'-CGCTCTTCTATATTGTTTTTT-SH-(CH2)6-3'; Step S2: preparing MOF material by hydrothermal method, and modifying the signal probe SP on the MOF surface to obtain SP-MOF; Wherein, the sequence of the SP is 5'-CCCTACGCATCGAATCTTTTTTTTT-COOH-3'; Step S3: DNA single strands S1, S2, and S3 are mixed and annealed to obtain nano-triangular prism DTP, and then Aptamer / BP, SP-MOF, AP, FP, S1D, S3U, and S3D are self-assembled into the nano-triangular prism DTP structure to obtain DTP / (Aptamer / BP+(SP-MOF)-AP+FP); Wherein, the sequence of S1 is 5'-CTCTATTCACGTCTATTTTTTCATGAGTCAG GGCGACGACATGAGTCAGGGCTTTTGAGATACACAAGGTGAGCACGAGATACACAAGGTTTTTGTTTAGAGCCAATGTCCAGTTTAGAGCCAATTTTTTGAGTCCCTCTGAGTCC-3'; the sequence of S2 is 5'-GAAGCTGATTCGATGCGTAGGGCGCTCTTCTATATTGTTTTAATAGACGTGAATAGAGGGACTCAGAGGGACTCAT TTTAAAGCCGTAGAACGAACGAAAGCCGTAGAACTTTTAGTCTTCTGTTTGGACTGGTGACTAGTCGTTTGG-3'; the sequence of S3 is 5'-CTCACCTTGTGTATCTCTTTTACGAAGCATACGAATCTCACGAAGCATACGATTTTCCAAACGACTAGTCACCAGTCCAAACAGAAGACTTTTTCTCCTAAGATGCCGTGTCCTCCTAA GATGCCTTTTACCTTGTGTATCTCGTG-3'; the sequence of the Aptamer is 5'-CGACTGGTAGGCAGATAGGGGAAGCTGATTCGATGCGTGGGTCGGCCCTGACTCATGTCGTCGCCCTGACTCATG-3'; the sequence of the BP is 5'-ACGCATCGAATCAGCTTC-3'; the sequence of the AP is 5'-CAATATAGAAGAGCG-3'; the sequence of the FP is 5'-GTTCTA CGGCTTTCGTTCGTTCTACGGCTTTTTTTTTCAATATAGAAGAGCGCCCTACGCATCGAATC-3'; the sequence of the S1D is 5'-ATTGGCTCTAAACTGGACATTGGCTCTAAAC-3'; the sequence of the S3U is 5'-TCGTATGCTTCGTGAGATTCGTATGCTTCGT-3'; the sequence of the S3D is 5'-GGCATCTTAGGAGGACACGGCATCTTAGGAG-3'; Step S4: Serotonin at different concentrations was mixed with DTP / (Aptamer / BP+(SP-MOF)-AP+FP), transferred to the MCH / IP / AuE surface for reaction, and then electrochemical conversion of MOF was performed.

2. The serotonin electrochemical sensor based on a DNA framework nanomachine according to claim 1, wherein: The operation of preparing MCH / IP / AuE in step S1 is as follows: first, a gold electrode is polished with alumina powder, the electrode is placed in a dilute sulfuric acid solution for cyclic voltammetry scanning, and after drying with nitrogen, the fixed probe IP is reacted with tris(2-carboxyethyl)phosphine for 60 minutes, and then added dropwise to the electrode surface in the dark for 12 hours. After rinsing, mercaptohexanol MCH is added dropwise to the electrode for sealing for 30 minutes to obtain MCH / IP / AuE.

3. The serotonin electrochemical sensor based on a DNA framework nanomachine according to claim 1, wherein: The experimental operation of step S2 is as follows: an aqueous solution of trivalent iron is mixed with a surfactant Pluronic F127, acetic acid and terephthalic acid are added in sequence, and the mixture is stirred for 2 hours. Subsequently, the mixture is transferred to a polytetrafluoroethylene reactor and reacted at a high temperature of 110°C for 24 hours. After centrifugal drying, the obtained MOF is mixed with 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC), N-hydroxysuccinimide (NHS) and SP for 5 hours to obtain SP-MOF.

4. The serotonin electrochemical sensor based on a DNA framework nanomachine according to claim 1, wherein: The experimental operation of step S3 is to mix DNA single strands S1, S2, and S3 in equal moles, heat at 95°C for 10 minutes, and then cool to room temperature at a rate of 1°C / minute to obtain a DTP structure, and then mix it with Aptamer / BP, SP-MOF, AP, S1D, S3U, and S3D in equal proportions and stir at room temperature for 1 hour, and then add equal moles of FP and stir at room temperature for 1 hour to obtain DTP / (Aptamer / BP+(SP-MOF)-AP+FP).

5. The serotonin electrochemical sensor based on a DNA framework nanomachine according to claim 1, wherein: The experimental operation of step S4 is to mix DTP / (Aptamer / BP+(SP-MOF)-AP+FP) with different concentrations of serotonin, transfer it to the surface of MCH / IP / AuE and react it at room temperature for 30 minutes. Then, the electrode is placed in K3Fe(CN)6 solution and a voltage of 1.6 V is applied to generate Fe 3+ , then reacts at a voltage of 0 V to produce Prussian white PW, which is oxidized by oxygen to obtain Prussian blue PB on the electrode surface.

Images