Avian pcv3 gene and application thereof
The application of avian PCV3 gene has solved the problems of PCV3 isolation and passage, provided efficient vaccines and detection methods, and achieved protection and accurate diagnosis of poultry.
Patent Information
- Application Number
- CN202410713103.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-03
- Publication Date
- 2026-02-13
- Estimated Expiration
- 2044-06-03
AI Technical Summary
Existing technologies make it difficult to efficiently isolate and passage porcine circovirus type 3 (PCV3), and the lack of effective vaccines makes disease diagnosis and control difficult.
We provide avian PCV3 gene (aPCV3) and its applications, including the preparation of ELISA detection plates, inactivated vaccines and subunit vaccines, and the efficient isolation and culture of PCV3 using the MDCC-MSB1 cell line.
The system achieved efficient isolation and stable passage of PCV3, and the prepared vaccine has a significant protective effect on poultry such as chickens, ducks and geese. The ELISA test has high specificity and reproducibility.
Smart Images

Figure CN118497227B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of animal virology and immunology, and particularly relates to an avian PCV3 gene and application thereof. BACKGROUND
[0002] Porcine Circovirus (PCV) is a small, non-enveloped virus with a single-stranded circular DNA genome, belonging to the Circoviridae family of the Circovirus genus. To date, at least four porcine circoviruses (PCV) have been discovered, including PCV1 to PCV4. PCV1 was first identified in the 1970s as a contaminant in porcine kidney cell lines and is not pathogenic to pigs (Saha et al., 2011). PCV2 was first discovered in Canada in the early 1990s and was later identified as the primary pathogen of porcine circovirus-associated disease (PCVAD), which is characterized by a variety of clinical conditions, including postweaning multisystemic wasting syndrome (PMWS), porcine dermatitis and nephropathy syndrome (PDNS), reproductive disorders, enteritis, and respiratory disease, and has caused significant economic losses in major pig-producing countries (Afghah et al., 2017; Opriessnig et al., 2007; Saha et al., 2011). In 2016, a new type of circovirus called Porcine Circovirus 3 (PCV3) was identified in the United States through metagenomic sequencing of sows with porcine dermatitis and nephropathy syndrome (PDNS). However, many retrospective studies have shown that this pathogen may have originated from a bat-associated circovirus (Faccini et al., 2017; Ku et al., 2017; Kwon et al., 2017; Saraiva et al., 2019), which may mean that PCV3 as a pathogen exhibits severe pathogenicity to pigs, as observed in PCVAD; and the existence of PCV4 is still controversial. PCV3 is characterized by PDNS, reproductive disorders, and cardiac and multisystemic inflammation (Palinski et al., 2017; Phan et al., 2016). Subsequently, other researchers found that PCV3 may be associated with congenital tremors (CT) and porcine respiratory disease complex (PRDC) (Chen et al., 2018; Kedkovid et al., 2018). Therefore, these data suggest that PCV3 may be associated with pathogenicity in pigs. Currently, research on the pathogenicity of PCV3 is still limited. It has been reported that PCV3 infection exhibits a wide range of tissue tropism, and the virus can be detected in almost all types of pig tissue organs and body fluids, including heart, liver, spleen, lung, kidney, brain, lymph node, tonsil, serum, feces, and oral fluid (Jiang et al., 2020; Wang et al., 2021; Wozniak et al., 2020).
[0003] The genome of PCV3 is a single-stranded circular DNA consisting of 2000 nucleotides (nt) and three major open reading frames (ORFs), ORF1, ORF2 and ORF3, have been predicted, ORF1 is 891 bp in size, located on the positive strand of the genome, encoding replication-associated protein (Rep), ORF2 is 645 bp in size, located on the negative strand of the genome and encodes the only capsid protein (Cap) of the virus, while the function of ORF3 is still unknown. Three motifs conserved in circovirus replicase proteins but unknown in function were found in PCV3, including WWDGY (aa 196 to 200), DDFYGWVP (aa 209 to 216) and DRYP (aa 225 to 228). Interestingly, no canonical start codon was found (Palinski et al., 2017; Phan et al., 2016). As a major structural protein, the capsid protein determines the antigenic properties of the circovirus, PCV3 Cap protein contains 214 amino acids (aa), the prediction of immunogenic epitopes in the protein identified seven potential epitopes, almost across the entire surface of the protein, and indicated that the amino acid region of site 24 distinguished PCV3a and PCV3b branches (Li et al., 2018). A study showed that the amino acids of sites 10, 24, 27, 77, 104 and 150 frequently mutated in global viral strains (Qi et al., 2019), which indicated that the N-terminal half of PCV3 Cap has a tendency to mutate, while the C-terminal half of PCV3 Cap is more likely to be conserved. Therefore, the C-terminal region of PCV3 Cap is more suitable as an antigen candidate region for the production of diagnostic reagents.
[0004] For viral infectious diseases, rapid and effective isolation of pathogens is the key to diagnosis and epidemic prevention and control. Cells that can continuously propagate the virus are one of the most important tools for virus diagnosis and subsequent research. Previously, Zhu et al. (Zhu et al., 2007) reported that PK-15 cell populations were heterogeneous in permissiveness to PCV2 infection, only about 20% of the cell populations were susceptible to infection (Tischer et al., 1987), and the viral titer never exceeded 10 5TCID50 titers (Meerts et al., 2005). However, the replication efficiency of PCV1 appears to be higher than that of PCV2, and the replication efficiency of PCV2 in PK-15 cells appears to be higher than that of PCV3 (Fenaux et al., 2003). Virus isolation is an important basis for disease diagnosis and a key to vaccine development and the establishment of diagnostic methods. Since PCV3 belongs to the same genus as PCV2, most studies have used PK-15 to isolate PCV3, but the effect is not good. Although strains can be isolated, they are all high in titer in the first few generations and cannot be continuously passaged (Mora-Diaz et al., 2020). Currently, efficient in vitro isolation and passage of PCV3 is still difficult, and there are problems such as great difficulty in isolation, low isolation rate, and unstable isolation rate. At present, there is no mature PCV3 vaccine. SUMMARY
[0005] Therefore, the purpose of the present application is to provide an avian PCV3 (aPCV3) gene and its application in preparing a PCV3 vaccine.
[0006] Another purpose of the present application is to provide an ELISA detection plate for detecting PCV3, an inactivated vaccine, and a subunit vaccine.
[0007] Another purpose of the present application is to provide a method for efficiently isolating avian PCV3 or porcine PCV3 and the application of MDCC-MSB1 cell lines in isolating and culturing PCV3.
[0008] In order to achieve the above-mentioned purposes, the present application provides the following technical solutions.
[0009] The present application provides an avian PCV3 gene, which is named aPCV3 to distinguish it from porcine PCV3 (PCV3). The nucleotide sequence of the aPCV3 gene includes any one of the following: (1) SEQ ID NO. 1, (2) SEQ ID NO. 2, (3) a sequence with a homology of more than 90% to SEQ ID NO. 1, and (4) a sequence with a homology of more than 90% to SEQ ID NO. 2.
[0010] The present application also provides the application of the above-mentioned aPCV3 gene in preparing a PCV3 vaccine.
[0011] The present application also provides an expression vector containing a Cap gene or a Rep gene in the above-mentioned aPCV3 gene. The nucleotide sequence of the Cap gene includes SEQ ID NO. 3 or SEQ ID NO. 4, and the nucleotide sequence of the Rep gene includes SEQ ID NO. 5 or SEQ ID NO. 6.
[0012] The application also provides a host cell containing the expression vector.
[0013] The application also provides a recombinant protein purified from the expression of the host cell.
[0014] The application also provides the use of the expression vector, the host cell or the recombinant protein in the preparation of a product for detecting PCV3 or in the preparation of a PCV3 vaccine.
[0015] The application also provides an ELISA detection plate for detecting PCV3, which is coated with the recombinant protein at a concentration of 1.0-2.0 μg / ml.
[0016] The application also provides an inactivated vaccine containing a virus strain containing the aPCV3 gene.
[0017] The application also provides a subunit vaccine containing the recombinant protein and an adjuvant.
[0018] The application also provides a method for efficiently isolating PCV3, which comprises the steps of injecting PCV3 virus liquid into the allantoic cavity of an 8-11 day old embryonated egg, and collecting the allantoic fluid to obtain PCV3 virus after incubation, wherein the PCV3 virus liquid comprises avian aPCV3 virus liquid or porcine PCV3 virus liquid, and the avian aPCV3 virus liquid is a virus liquid of a virus strain containing the avian aPCV3 gene.
[0019] The application also provides the use of the MDCC-MSB1 cell line in the isolation and culture of porcine PCV3 or avian aPCV3, wherein the avian aPCV3 is a virus strain containing the avian aPCV3 gene.
[0020] The application has the following beneficial effects:
[0021] The application provides an aPCV3 gene for the first time, and a virus strain containing the aPCV3 gene has a high viral titer and can be stably passaged for multiple times. An inactivated vaccine prepared from the virus strain containing the aPCV3 gene of the application has a significant protective effect on poultry such as chickens, ducks and geese, and a subunit vaccine prepared from the Cap gene or the Rep gene in the aPCV3 gene also has a significant protective effect on poultry such as chickens, ducks and geese, and an ELISA detection plate prepared from the Cap gene or the Rep gene in the aPCV3 gene can accurately detect PCV3 and has high specificity and repeatability.
[0022] The method for isolating PCV3 provided by this invention can efficiently isolate porcine PCV3 and aPCV3 in vitro, with advantages such as low isolation difficulty, high isolation rate, and stable isolation rate. Furthermore, this invention is the first to propose that the MDCC-MSB1 cell line can be used for the isolation and culture of PCV3, with the advantage of stable passage. Attached Figure Description
[0023] Figure 1 The image shows an agarose gel electrophoresis result for detecting PCV3 in avian clinical samples. The top image shows the PCR amplification result of the Rep gene, and the bottom image shows the PCR amplification result of the Cap gene. In the image, M represents a 2000bp DNA Marker, 1 represents chicken kidney tissue sample, 2 represents chicken serum sample, 3 represents duck kidney tissue sample, 4 represents duck serum sample, 5 represents goose kidney tissue sample, 6 represents goose serum sample, 7 represents negative control, and 8 represents PCV3 positive control.
[0024] Figure 2 A genetic evolutionary diagram of aPCV3 from chickens, ducks, and geese with other porcine circoviruses from different species;
[0025] Figure 3 The image shows the complete genome of the aPCV3 isolate aPCV3-duck-GDMZ1. The orange part represents the ORF1 gene sequence, and the green part represents the ORF2 gene sequence.
[0026] Figure 4 The image shows the complete genome of the aPCV3 isolate aPCV3-chicken-GDZJ1. The orange part represents the ORF1 gene sequence, and the green part represents the ORF2 gene sequence.
[0027] Figure 5 Genetic evolutionary analysis diagram of the ORF2 gene in aPCV3 isolates aPCV3-duck-GDMZ1 and aPCV3-chicken-GDZJ1;
[0028] Figure 6 A comparative diagram of the amino acid sequences of the eight isolated aPCV3 isolates;
[0029] Figure 7 Agarose gel electrophoresis image of aPCV3 isolated from MDCC-MSB1 cells in passages F2-F15 (duck-GDMZ1);
[0030] Figure 8 The images show the results of transmission electron microscopy (TEM), with the left image showing the results for aPCV3-chicken-GDZJ1 and the right image showing the results for aPCV3-duck-GDMZ1.
[0031] Figure 9The aPCV3 virus copy number in different tissues after immunization of inactivated vaccine in chickens, wherein PBS+aPCV3 represents the control group, PCV3-GDMZ1+PCV3 represents the aPCV3-duck-GDMZ1 group, and PCV3-GDZJ1+PCV3 represents the aPCV3-chicken-GDZJ1 group;
[0032] Figure 10 The aPCV3-duck-GDMZ1 Cap PCR amplification diagram;
[0033] Figure 11 The aPCV3-duck-GDMZ1 Rep PCR amplification diagram, wherein 1 is a DEPC water negative control, and 2 and 3 are Rep gene amplification diagrams;
[0034] Figure 12 The Z-aPCV3 Cap recombinant protein purification result, wherein M is an 8-180 protein marker, 1 is before induction, 2 is supernatant after induction, 3 is precipitate after induction, 4 is a direct current sample, 5 is 20 mmol imidazole elution, 6 is 50 mmol imidazole elution, 7 is 100 mmol imidazole elution, 8 is 200 mmol imidazole elution, and 9 is 500 mmol imidazole elution;
[0035] Figure 13 The Z-aPCV3 Rep recombinant protein purification result, wherein M is an 8-180 protein marker, 1 is precipitate after induction, 2 is a direct current sample, 3 is 20 mmol imidazole elution, 4 is 100 mmol imidazole elution, and 5 is 200 mmol imidazole elution;
[0036] Figure 14 The Z-aPCV3 Cap recombinant protein Western-blot identification result, wherein M is an 8-180 protein marker, 1 is 20 mmol imidazole elution, 2 is 50 mmol imidazole elution, 3 is 100 mmol imidazole elution, 4 is 200 mmol imidazole elution, and 5 is 500 mmol imidazole elution;
[0037] Figure 15 The Z-aPCV3 Rep recombinant protein Western-blot identification result, wherein M is an 8-180 protein marker, 1 is 20 mmol imidazole elution, 2 is 100 mmol imidazole elution, and 3 is 200 mmol imidazole elution;
[0038] Figure 16 The antibody level after immunization of the aPCV3 Cap protein;
[0039] Figure 17 The antibody level after immunization of the aPCV3 Rep protein;
[0040] Figure 18 Results of PCV3 virus copy number in different tissues after aPCV3 Cap;
[0041] Figure 19 Results of PCV3 virus copy number in different tissues after aPCV3 Rep;
[0042] Figure 20 Picture for verifying the effect of aPCV3 infection on MDCC-MSB1 cells by WB;
[0043] Figure 21 Picture for verifying the effect of aPCV3 infection on MDCC-MSB1 cells by IFA;
[0044] Figure 22 Virus copy number in allantoic fluid;
[0045] Figure 23 Results of aPCV3 immunohistochemistry in different tissues in chicken embryos;
[0046] Figure 24 Agarose gel electrophoresis picture for detecting Cap gene of aPCV3-chicken-GDZJ1 strain F2-F15 generations separated from MDCC-MSB1 cells. DETAILED DESCRIPTION
[0047] The application provides an avian PCV3 (aPCV3) gene, and the nucleotide sequence of the aPCV3 gene comprises any one of the following: (1) SEQ ID NO. 1, (2) SEQ ID NO. 2, (3) a sequence with a homology of more than 90% to SEQ ID NO. 1, and (4) a sequence with a homology of more than 90% to SEQ ID NO. 2.
[0048] In the application, the avian source includes a chicken source, a duck source and a goose source. Eight strains are isolated from kidney tissues and serum samples of the chicken source, the duck source and the goose source, and the nucleotide sequences of the eight strains have high similarity, wherein the nucleotide sequence of aPCV3-duck-GDMZ1 strain is shown in SEQ ID NO. 1, and the nucleotide sequence of aPCV3-chicken-GDZJ1 strain is shown in SEQ ID NO. 2. The nucleotide sequences of the remaining six strains have high homology with SEQ ID NO. 1 or SEQ ID NO. 2.
[0049] The application further provides application of the aPCV3 gene in preparation of a PCV3 vaccine.
[0050] The application further provides an expression vector containing the Cap gene or the Rep gene in the aPCV3 gene, wherein the nucleotide sequence of the Cap gene comprises SEQ ID NO. 3 or SEQ ID NO. 4, and the nucleotide sequence of the Rep gene comprises SEQ ID NO. 5 or SEQ ID NO. 6.
[0051] In the application, the nucleotide sequence of the Cap gene in the aPCV3-duck-GDMZ1 strain with the nucleotide sequence as shown in SEQ ID NO. 1 is as shown in SEQ ID NO. 3, the nucleotide sequence of the Rep gene in the aPCV3-duck-GDMZ1 strain with the nucleotide sequence as shown in SEQ ID NO. 1 is as shown in SEQ ID NO. 5, the nucleotide sequence of the Cap gene in the aPCV3-chicken-GDZJ1 strain with the nucleotide sequence as shown in SEQ ID NO. 2 is as shown in SEQ ID NO. 4, and the nucleotide sequence of the Rep gene in the aPCV3-chicken-GDZJ1 strain with the nucleotide sequence as shown in SEQ ID NO. 2 is as shown in SEQ ID NO. 6.
[0052] The application further provides a host cell containing the expression vector.
[0053] The application further provides a recombinant protein obtained by inducing the host cell to express and purify.
[0054] The application further provides application of the expression vector, the host cell or the recombinant protein in preparation of a product for detecting PCV3 or in preparation of a PCV3 vaccine.
[0055] The application further provides an ELISA detection plate for detecting PCV3, wherein the ELISA detection plate is coated with the recombinant protein, and the coating concentration of the recombinant protein is 1-2.0 μg / ml.
[0056] The application further provides an inactivated vaccine comprising the virus strain containing the aPCV3 gene.
[0057] The application further provides a subunit vaccine comprising the recombinant protein and an adjuvant.
[0058] The application further provides a method for efficiently isolating PCV3, comprising the following steps: injecting PCV3 virus liquid into the allantoic cavity of an 8-11-day-old avian embryo, and collecting the allantoic fluid to obtain PCV3 virus after incubation, wherein the PCV3 virus liquid comprises avian aPCV3 virus liquid or porcine PCV3 virus liquid, and the avian aPCV3 virus liquid is virus liquid of a virus strain containing the aPCV3 gene.
[0059] In the application, the avian embryo preferably comprises a chicken embryo, a duck embryo or a goose embryo, the temperature of the incubation is preferably 37°C, and the time of the incubation is preferably 72 h.
[0060] The application further provides application of the MDCC-MSB1 cell line in isolation and culture of porcine PCV3 or avian aPCV3, wherein the avian aPCV3 is a virus strain containing the aPCV3 gene.
[0061] The technical solutions provided by the application are described in detail below in combination with examples, but they should not be understood as limiting the protection scope of the application.
[0062] In the following examples, all the conventional methods are used unless otherwise specified.
[0063] In the following examples, all the materials and reagents used are commercially available unless otherwise specified.
[0064] Example 1
[0065] Isolation and identification of avian porcine circovirus type 3 (aPCV3)
[0066] 1.1 aPCV3 detection
[0067] PCR amplification detection
[0068] Total viral nucleic acid was extracted from kidney tissues and serum samples from chickens, ducks, and geese that were positive for porcine circovirus type 3. The specific procedures for viral nucleic acid extraction were strictly performed according to the instructions of the Total Viral DNA / RNA Extraction Kit from Meiji Biotechnology Co., Ltd. The extracted total nucleic acid was amplified by PCR using the primers shown in Table 1. The PCR amplification reaction system is shown in Table 2, and the PCR amplification reaction procedure is shown in Table 3.
[0069] Table 1 Primer sequences
[0070]
[0071] Table 2. Reaction system for PCR amplification
[0072]
[0073] Table 3 PCR amplification reaction procedure
[0074]
[0075]
[0076] After PCR, the PCR amplification products were detected by 1% agarose gel electrophoresis. DEPC water was used as a negative control, and pCDNA3.1-PCV3 plasmid was used as a PCV3 positive control. The results are as follows: Figure 1 As shown, all samples tested positive for specific bands. This indicates the presence of aPCV3 virus in the avian tissue.
[0077] The complete genome of aPCV3 was amplified using the designed primers. A total of eight strains were obtained from the collected pathogen samples, five of which had a genome length of 2000 bp, including three with a length of 1999 bp. To determine the genetic distance between PCV3 isolated from chicken, duck, and goose sources and other porcine circoviruses, phylogenetic analysis was performed on three of the eight isolated PCV3 strains. The results showed that the genetic distance between chicken, duck, and goose PCV3 and porcine PCV3 was relatively close, belonging to the same branch, while the genetic distance to other porcine circoviruses and porcine PCV2 was relatively large. Figure 2 As shown. The sequence of the aPCV3-duck-GDMZ1 mutant is as follows: Figure 3 As shown, the complete genome sequence of the aPCV3-chicken-GDZJ1 strain is as follows: Figure 4 As shown. Although phylogenetic analysis of the aPCV3 Cap gene sequence and the porcine PCV3 Cap gene sequence showed a close genetic distance to the porcine PCV3b branch, the eight isolated aPCV3 strains can be divided into two new independent branches, named aPCV3a and aPCV3b, as shown. Figure 5The amino acid alignment results of the avian PCV3 and the porcine PCV3 are shown in the following table 1. Figure 6 The sequence comparison analysis of the aPCV3-duck-GDMZ1 ORF2 gene and the porcine PCV3 ORF2 gene showed that the C-terminal sequence of the aPCV3-duck-GDMZ1 ORF2 gene was quite different from that of the porcine PCV3. In addition, the full-length sequence of the aPCV3-duck-GDMZ1 genome was 1999 bp, and the sequence alignment showed that the T base at position 420 of the Cap protein encoded by ORF2 was deleted and a frameshift mutation occurred, changing lysine to aspartic acid, as shown in the following table 2. Figure 6 .
[0078] 1.2 Culture of MDCC-MSB1 cells and isolation of aPCV3
[0079] (1) Cell recovery: The constant temperature water bath was adjusted to 37°C in advance. After the water temperature reached 37°C, the frozen MDCC-MSB1 cells were taken out from the liquid nitrogen tank and quickly shaken left and right in the 37°C water bath to thaw. Then the frozen tube was disinfected with 75% medical alcohol, and then centrifuged at 800 r / min for 5 min. The frozen liquid was discarded, 1 mL of 1640 cell culture medium was added, and the mixture was mixed gently by blowing. Then it was transferred to a T25 cell culture bottle and cultured in a 39°C, 5% CO2 constant temperature incubator for 8 hours. Then it was transferred to a conical cell culture bottle and cultured at 39°C, 5% CO2, 100 r / min.
[0080] (2) Isolation of aPCV3-duck-GDMZ1 and aPCV3-chicken-GDZJ1 strains: The positive chicken and duck samples detected by PCR were cut into small pieces with sterilized scissors, and then high-pressure sterilized PBS was added. The mixture was ground on ice, then centrifuged at 10,000 r / min for 5 min, and the supernatant was transferred to another 2 mL centrifuge tube. Then the filtrate was filtered through a 0.45 μm filter, and then a 0.22 μm filter was used for filtration. Then it was stored in a -80°C refrigerator for standby use. When the cell number of MDCC-MSB1 cells grew to 2 x 10 6 , the cells were collected by centrifugation at 800 r / min for 5 min, then the tissue filtrate was diluted with sterile 1640 cell culture medium at a volume ratio of 10%, and then the cell pellet was gently resuspended. The cells were incubated in a 39°C, 5% CO2 constant temperature incubator for 2 hours, then centrifuged at 800 r / min for 5 min to collect the cells, and then 5 ml of fresh 1640 medium was added. Then 3 mmol of D-glucosamine was added, and the culture was continued for 72 hours. Then it was stored at -80°C. This operation was repeated to the 15th generation.
[0081] (3) PCR amplification and identification
[0082] The aPCV3-duck-GDMZ1 and aPCV3-chiken-GDZJ1 viral solutions obtained in step (2) were passaged for 15 generations in MDCC-MSB1 cells. During this process, 200 μL of cell cultures from generations 2, 5, 10, and 15 were collected for total viral nucleic acid extraction. The extracted total nucleic acid was then amplified by PCR (total nucleic acid extraction and reaction system and procedure were the same as in step 1.1). PCV3 Cap F: ATTTATTTTCACTTAGAGAACGGAC (SEQ ID NO.23) and PCV3 Cap R:
[0083] The Cap gene was amplified using primers ACCAAAATGAGACMCcAGACTATA (SEQ ID NO.24), and the results are as follows: Figure 7 , Figure 24 As shown, from the 2nd to the 15th generation, specific positive bands were detected in cell culture samples of the isolated strains of this invention at different passages. This demonstrates that the isolated strains aPCV3-duck-GDMZ1 and aPCV3-chicken-GDZJ1 of this invention can be continuously passaged in MDCC-MSB1. Sequencing of the PCR amplification products showed that the Cap gene sequence of the aPCV3-duck-GDMZ1 isolate is shown in SEQ ID NO.3, and the Cap gene sequence of the aPCV3-chicken-GDZJ1 isolate is shown in SEQ ID NO.4.
[0084] (4) Electron microscopy observation
[0085] Take aPCV3-duck-GDMZ1 and aPCV3-chicken-GDZJ1 viral solutions, centrifuge at 10000 rpm for 30 minutes, collect the supernatant, centrifuge at 40000 rpm for 5 hours, discard the supernatant, dissolve the precipitate in 0.5 mL of deionized water, and then send the samples to the South China Agricultural University Testing Center for sample preparation, followed by transmission electron microscopy observation. Figure 8 As shown in the results, there are a large number of virus particles in the sample, with a diameter of about 16-18 nm and uniform particle size.
[0086] (5) Virus titer determination
[0087] Take the 5th, 10th, and 15th generation viral solutions of aPCV3-duck-GDMZ1 and aPCV3-chicken-GDZJ1 and dilute them 10-fold to obtain 10^- 1 ~10^ -8, 8 wells for each dilution, 0.1 mL virus dilution was added to each well, and the 96-well plate was incubated in a 37°C, 5% CO2 incubator. After 96 hours, IFA detection was performed, and the TCID of the virus was calculated by the Reed-Muench method 50 The results showed that the virus titers of aPCV3-duck-GDMZ1 at passages 5, 10, and 15 were 10^ 4.5 TCID 50 / mL, 10^ 3.5 TCID 50 / mL, and 10^ 3.5 TCID 50 / mL, respectively. The virus titers of aPCV3-chicken-GDZJ1 at passages 5, 10, and 15 were 10^ 5 TCID 50 / mL, 10^ 3.5 TCID 50 / mL, and 10^ 3.5 TCID 50 / mL, respectively.
[0088] Example 2
[0089] Preparation of inactivated vaccines of avian porcine circovirus type 3 aPCV3-duck-GDMZ1 and aPCV3-chicken-GDZJ1 strains
[0090] 2.1 Preparation of PCV3 seed virus: The preparation method is the same as that in 1.2 of Example 1.
[0091] 2.2 Preparation of virus liquid for vaccine production:
[0092] (1) Cell recovery: Adjust the constant temperature water bath to 37°C in advance. After the water temperature reaches 37°C, take out the required MDCC-MSB1 cells from the liquid nitrogen tank and quickly shake left and right in the 37°C water bath to thaw. Then sterilize the outside of the cryopreservation tube with 75% medical alcohol, then centrifuge at 800 r / min for 5 min, discard the cryopreservation liquid, add 1 mL of 1640 cell culture medium, gently blow and mix, then transfer to a T25 cell culture bottle, and culture at 39°C, 5% CO2 constant temperature incubator for 8 h, then transfer to a conical cell culture bottle and culture at 39°C, 5% CO2, 100 r / min.
[0093] (2) Cell expansion culture
[0094] After 72 hours of cell culture, the cell density was 5.0 × 10 6 cells / ml, and 1640 medium was used to prepare a density of 1 × 10 6The cell suspension of 1.0×10~6 / ml was divided into cell flasks and cultured in a 39℃, 5% CO2 incubator. After 72 hours, the cells were subcultured at a ratio of 1:3-1:4 (equivalent to 100 ml of cell suspension expanded to 400-500 ml of culture system).
[0095] (3) Virus inoculation
[0096] When the cell density reached 5.0×10~6 / ml, the cells were centrifuged at 800 r / min for 5 minutes, resuspended in fresh culture medium, and then transferred to cell flasks with four times (40 ml) of culture medium. Then, 10% of the virus stock solution was inoculated into the culture medium, and the culture was continued for 72 hours to obtain the virus. 6
[0097] 2.3 Purification test of virus liquid for vaccine preparation
[0098] According to the current "Chinese Veterinary Pharmacopoeia" appendix, the results showed that the basic virus strain was not contaminated with bacteria, mycoplasma and exogenous virus.
[0099] 2.4 Inactivation of virus liquid for vaccine preparation
[0100] (1) Preparation of diethylene imine (BEI)
[0101] Mix equal volumes of 2 mol / L 2-bromoethylamine hydrobromide (BEA) and 2 mol / L NaOH solution in a 37℃ water bath, shake every 10-15 minutes, and after 60 minutes, diethylene imine (BEI) is generated by cyclization, with a final concentration of 1 mol / L.
[0102] (2) Virus inactivation
[0103] Take the cell-broken avian porcine circovirus type 3 antigen solution, add BEI prepared in step (1) to a concentration of 2 mmol / L, then add 0.8‰ volume of formaldehyde, and place it in a 37℃ constant temperature shaker at 120 rpm / min for 24 hours. Finally, add sodium thiosulfate with a final concentration of 2 mmol / L to terminate the inactivation.
[0104] 2.5 Vaccine preparation
[0105] (1) Oil phase preparation: Take white oil for injection, mix with siben-80, then add aluminum stearate and heat while stirring until transparent.
[0106] (2) Preparation of water phase: Take Tween-80, sterilize it in a bottle with glass balls, and after cooling, add the inactivated porcine circovirus type 2 strain antigen solution, shake well to dissolve the Tween-80 completely.
[0107] (3) Vaccine preparation: the oil phase was emulsified in a high-speed shearing machine, stirred at 300 rpm for 10 minutes, slowly added with the water phase, and emulsified at 3000 rpm for 30 minutes. Quantitative packaging and sealing at 4 DEG C were carried out, and the vaccine was obtained.
[0108] 2.6 Detection of immune protection effect
[0109] 30 15-day-old SPF chickens were purchased and then randomly divided into three groups (control group, aPCV3-duck-GDMZ1 group and aPCV3-chicken-GDZJ1 group). The first immunization was recorded as the first day, the second immunization was carried out 14 days later, and the challenge was carried out on the 35th day. The control group was given 400 μl of PBS per chicken, and the experimental group was given 400 μl of virus solution per chicken. Then, the serum was collected on the 42nd day and the 49th day, and the virus copy number was detected to determine whether aPCV3 was replicated in vivo. The test animals were sacrificed and sampled on the 49th day for detection, and the results are shown in Figure 9 , which shows that the inactivated vaccine prepared by the application has a protective effect on poultry.
[0110] Example 3
[0111] Construction of recombinant expression plasmids pET-28a-Z-aPCV3 cap and pET-28a-Z-aPCV3 Rep
[0112] The nucleic acid of the aPCV3-duck-GDMZ1 strain of avian origin was used as a template for PCR amplification of the PCV3 Cap and Rep gene fragments. The amplification primers are shown in Table 4, and the amplification reaction system and reaction procedure are shown in Tables 2 and 3, respectively. Then, Cap was digested with SacI and XhoI, and Rep was digested with SacI and BmtI, and then the same enzyme-treated prokaryotic expression vector pET-28a was subjected to a ligation reaction to construct the prokaryotic expression plasmids pET-28a-Z-aPCV3 Cap and pET-28a-Z-aPCV3 Rep. The recombinant expression plasmid was transformed into E. coli DH5α, and multiple single colonies were randomly picked and inoculated in 2 mL of LB / Ampr culture solution at 37 DEG C for 8 hours of shaking. Then, PCR identification and enzyme digestion identification were performed, and the results are shown in Figure 10 and Figure 11 The PCR product was sent to a company for sequencing to confirm the accuracy. Then, the accurate bacterial liquid was verified for large shaking (200 mL), and then plasmid extraction was performed.
[0113] Table 4 Amplification primers:
[0114]
[0115]
[0116] Induced expression and purification of recombinant proteins
[0117] The recombinant expression plasmids pET-28a-Z-aPCV3 Cap and pET-28a-Z-aPCV3 Rep that were sequenced correctly were again transformed into E. coli BL21 (DE3), and single colonies were inoculated into 10 mL of LB / Ampr culture solution, which was incubated at 37°C overnight. The next day, the bacterial solution was inoculated into LB / Ampr culture solution at a ratio of 1:100, and incubated at 37°C for 2-4 h until the OD600 value reached 0.5-0.6. Then, IPTG was added to a final concentration of 0.5 mmol / L, and the incubation was continued at 37°C for 12 h for induction and expression. The induced and expressed sample was purified according to the His.tag protein purification kit instructions, and the target protein eluate was collected by step elution. The purified recombinant Z-aPCV3 cap and Z-aPCV3 Rep proteins were detected by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis), and the results are shown in Figure 12 、 Figure 13 .
[0118] The preparation method of the recombinant proteins J-aPCV3 cap and J-aPCV3 Rep is the same as that of the recombinant proteins Z-aPCV3 cap and Z-aPCV3 Rep.
[0119] Identification of recombinant proteins
[0120] The purified recombinant Z-aPCV3 cap and Z-aPCV3 Rep proteins were subjected to SDS-PAGE electrophoresis and membrane transfer, and then blocked with 5% (m / v) skimmed milk powder at 4°C overnight. Western-blot identification was performed using mouse-derived PCV3 Cap and PCV3 Rep primary antibodies and HRP-labeled goat anti-mouse IgG as the secondary antibody, and the results are shown in Figure 14 、 15 , indicating that the recombinant proteins Z-aPCV3 cap and Z-aPCV3 Rep were successfully obtained.
[0121] The identification of J-aPCV3 cap and J-aPCV3 Rep proteins is the same as that of Z-aPCV3 cap and Z-aPCV3 Rep proteins.
[0122] Example 4
[0123] Preparation of PCV3 ELISA detection plate
[0124] The purified Z-aPCV3 cap protein obtained in Example 3 was coated as an antigen, and the Z-aPCV3 cap protein was diluted to 2.0 μg / mL with ELISA coating buffer, 100 μL of the diluted antigen was added to a 96-well ELISA plate, and the plate was stored at 4°C overnight. After the antigen was coated, the coating solution (ELISA coating buffer) was discarded, the plate was washed three times with 350 μL of PBST (PBS containing 0.05% Tween-20), and the plate was blocked with 1% BSA (PBS containing 1% BSA) at 4°C for 12 h. After blocking, the plate was washed three times with 350 μL of PBST, and the plate was dried at 37°C for 60 min.
[0125] Example 5
[0126] Establishment of PCV3 indirect ELISA detection method
[0127] (1) Determination of the concentration of coated antigen and the dilution concentration of antibody
[0128] The purified prokaryotic expressed Z-aPCV3 cap protein of Example 3 was coated as an antigen, and the antigen was diluted by a dilution method, 100 μL of the antigen was diluted to 2.0, 1.0, 0.5, 0.25, 0.1 μg / mL with coating diluent, and the plate was coated at 4°C overnight. After the antigen was coated, the coating solution was discarded, and blocking solution was added for overnight blocking. The positive serum and negative serum were diluted at 1:25, 1:50, and 1:100, respectively, and the orthogonal method was used to set the combination of coating concentration and dilution ratio. Each negative and positive sample was set in triplicate, and the subsequent steps were performed according to the conventional procedure. The antigen coating concentration with serum OD positive value around 1.0 and the maximum P / N ratio of positive OD / negative OD was the optimal working concentration. The orthogonal test results showed (see Table 5) that when the coating antigen concentration was 2.0 μg / mL and the serum dilution ratio was 1:50, the OD450nm value of the PCV3 positive serum was close to 1.0, and the P / N ratio was the maximum, which met the selection conditions. Therefore, the optimal coating antigen concentration was 2.0 μg / mL, and the optimal serum dilution ratio was 1:50.
[0129] Table 5 Orthogonal test results of the concentration of coated Z-aPCV3 cap antigen and the dilution concentration of antibody
[0130]
[0131]
[0132] Note: *P / N = positive serum OD450nm value / negative serum OD450nm value.
[0133] (2) Optimization of the working concentration of enzyme-labeled secondary antibody
[0134] Enzyme-labeled secondary antibody optimization experiment was performed with antigen coating concentration of 2.0 μg / mL and serum dilution ratio of 1:50. Goat anti-chicken enzyme-labeled secondary antibody was diluted at three ratios, i.e. 1:10,000, 1:20,000 and 1:30,000, for indirect ELISA. Each step of the reaction was performed at 37°C for 30 min, and the color development was stopped after 12-15 min. The OD value of the sample was measured at 450 nm wavelength. The enzyme secondary antibody concentration at which the P / N value was the largest was the optimal working concentration. The results are shown in Table 6. When the dilution ratio of the enzyme-labeled secondary antibody was 1:20,000, the P / N value was the largest, and therefore the optimal working concentration of the secondary antibody was 1:20,000.
[0135] Table 6 Dilution results of enzyme-labeled secondary antibody
[0136]
[0137] (3) Determination of positive and negative critical values of indirect ELISA
[0138] Thirty SPF poultry sera were selected as negative controls, and the PCV3 antibody level was detected according to the optimized and determined ELISA steps. The OD450 value of each sample was read, and the OD450 average value and standard deviation of the 30 SPF poultry sera were calculated. According to the formula: OD450 average value + 3 times standard deviation (SD), P / N is the OD450 value of positive serum / OD450 value of negative serum, and the identification limit of P / N serum sample is 3 SDs of the negative control. The average absorbance of 30 negative serum samples at 450 nm wavelength was 0.155, and the standard deviation of the absorbance was 0.052. Therefore, the critical value of ELISA was 0.155 + 3 x 0.052 = 0.311, and the serum sample with OD450 nm equal to or higher than the critical value was positive.
[0139] (4) ELISA detection according to the optimal results of screening in (1)-(3) above, including the following steps:
[0140] 96-well ELISA plates (obtained in Example 4) were added with 100 μL of 100 μL of serum diluted with sample diluent (1xPBS) per well, and negative and positive controls were set, and incubated at 37°C for 60 min. After 5 times of PBST washing, each time for 2-3 min, 120 μL of horseradish peroxidase-labeled (HRP) goat anti-pig IgG secondary antibody, horseradish peroxidase-labeled (HRP) goat anti-chicken IgG secondary antibody, and horseradish peroxidase-labeled (HRP) goat anti-duck IgG secondary antibody diluted with PBST were added, respectively. After incubation at 37°C for 30 min, 5 times of PBST washing was performed, each time for 2-3 min. Finally, 100 μL of tetramethylbenzidine-hydrogen peroxide (TMB) solution was used as a substrate for peroxidase reaction. After incubation at room temperature for 15 min in the dark, 50 μL of 2M sulfuric acid was added to each well to stop the reaction, and the optical density (OD450) at 450 nm was read by a microplate reader at 450 nm. The serum sample with OD450 nm equal to or higher than 0.311 was positive, otherwise it was negative.
[0141] Example 6
[0142] Specificity and repeatability of the detection method described in Example 5
[0143] Clinical sera specific for each of the following viruses were used: avian porcine circovirus type 3 (aPCV3), porcine circovirus type 3 (PCV3), porcine circovirus type 2 (PCV2), porcine pseudorabies virus (PRV), porcine epidemic diarrhea virus (PEDV), porcine reproductive and respiratory syndrome virus (PRRSV), and classical swine fever virus (CSFV). These sera have been identified using commercial kits, and three sera for each pathogen were tested according to the ELISA detection steps of Example 5, step (4), with negative and blank controls. The OD450 values were calculated to determine the specificity of the indirect ELISA method. The results are shown in Table 7, and the OD450 nm values of the positive sera of porcine circovirus type 2, porcine pseudorabies virus, porcine reproductive and respiratory syndrome virus, porcine epidemic diarrhea virus, and classical swine fever virus were all less than the critical value of 0.311. Therefore, the indirect ELISA method established under these conditions has high specificity. The results are as follows.
[0144] Table 7 Specificity detection results
[0145]
[0146]
[0147] In order to evaluate the repeatability of the test, four negative and four positive sera with different levels of poultry-derived antibodies were taken, and the ELISA detection step of step (4) of Example 5 was performed for three intra-batch and inter-batch repeats, respectively, and the results are shown in Table 8. The coefficients of variation of the intra-batch and inter-batch experimental results were less than 10%, and thus it can be seen that the detection method of the present application has high repeatability.
[0148] Table 8 repeatability test results
[0149]
[0150]
[0151] Example 7
[0152] Preparation of ELISA detection plate for PCV3
[0153] The purified Z-PCV3 Rep protein obtained in Example 3 was used as an antigen for coating, and the Z-PCV3 Rep protein was diluted to 2.0 μg / mL with ELISA coating buffer, 100 μL of the diluted antigen was added to a 96-well ELISA plate, and the plate was stored at 4°C overnight. After coating the antigen, the coating solution (ELISA coating buffer) was discarded, and the plate was washed three times with 350 μL of PBST (PBS containing 0.05% Tween-20), and then the plate was blocked with bovine serum albumin (BSA) (1% BSA in PBS) at 4°C for 12 h. After blocking, the plate was washed three times with 350 μL of PBST, and then the plate was dried at 37°C for 60 min.
[0154] Example 8
[0155] Determination of the concentration of the ELISA detection plate coating antigen and the antibody dilution concentration when using the ELISA detection plate of Example 7
[0156] The Z-aPCV3 Rep protein obtained in Example 3 was used as an antigen for coating, and the antigen was diluted by a dilution method, diluted with a coating diluent to 2.0, 1.0, 0.5, 0.25, 0.1 μg / mL, 100 μL per well, and coated at 4°C overnight. After coating the antigen, the coating solution was discarded, and blocking solution was added for overnight blocking. The positive serum and negative serum were diluted by 1:25, 1:50, and 1:100, respectively, and the coating concentration and dilution ratio combination were set by using the orthogonal method. Each negative and positive sample was set with 3 repeats, and the subsequent steps were performed according to the conventional procedure. The antigen coating concentration with serum OD positive value around 1.0 and the largest positive OD / negative OD (P / N) ratio was the optimal working concentration. The orthogonal test results showed (see Table 9) that when the coating antigen concentration was 2.0 μg / mL and the serum dilution ratio was 1:50, the OD450nm value of the PCV3 positive serum was close to 1.0, and the P / N ratio was the largest, which met the selection conditions. Therefore, the optimal coating antigen Z-PCV3 Rep concentration was 2.0 μg / ml, and the optimal serum dilution ratio was 1:50.
[0157] Table 9 Orthogonal test results of coating Z-PCV3 Rep antigen concentration and antibody dilution concentration
[0158]
[0159] Note: *P / N = positive serum OD450nm value / negative serum OD450nm value.
[0160] Example 9
[0161] Preparation of subunit vaccine and immunoprotective effect
[0162] 9.1 Vaccine preparation
[0163] (1) Calculate the amount and volume of antigen required for each injection. For subcutaneous injection or intramuscular injection, 50-200 μg of antigen per chick per injection, and the injection volume is less than 50 μL; for intraperitoneal injection, the injection volume is 200-400 μl per chick per injection. Strong detergents can weaken the emulsification effect and need to be avoided. Prepare about 50% more vaccine than the final required amount.
[0164] (2) Choose a syringe according to the total volume of the added material. The total volume of adjuvant and Z-pcv3 Cap or Z-PCV3 Rep or J-PCV3 cap or J-PCV3 Rep protein (antigen) obtained in Example 3 should be about half of the syringe volume. For example, when preparing 2.5 ml of vaccine, use a 5 ml syringe for emulsification.
[0165] (3) Pre-warm Freund's Complete Adjuvant (or Freund's Incomplete Adjuvant) at 37°C before use, resuspend the adjuvant evenly by shaking for 1-2 minutes or by inverting the bottle several times by hand. Draw the required volume of Freund's Complete Adjuvant or Freund's Incomplete Adjuvant into a syringe, attach the syringe to the double-bore adaptor, and expel the air (excess air will prevent the formation of a stable emulsion).
[0166] (4) Draw the water-soluble antigen into the other syringe, expel the air (excess air can prevent the formation of a stable emulsion).
[0167] (5) Attach the syringe with the antigen to one end of the double-bore adaptor. Ensure that both syringes are securely attached to the double-bore emulsion adaptor by Luer-lock.
[0168] (6) Push the plunger steadily so that all of the antigen solution is mixed with the Freund's Complete Adjuvant or Freund's Incomplete Adjuvant in the double-bore adaptor. Continue to transfer the mixture from one syringe to the other, alternating between them.
[0169] (7) Continue the emulsification as described above until a stable emulsion is formed. This will take several minutes. Expel a small drop of the emulsion into a beaker of water, and the small droplets should form stable oil beads on the surface of the water. If the emulsion droplets disperse on the surface of the water, reassemble the syringes and continue the emulsification.
[0170] (8) Push all of the emulsion into one syringe. Remove the double-bore adaptor and attach a needle. Alternatively, remove the empty syringe and replace it with a 1 ml sterile syringe. At this point, the emulsion can be transferred into the 1 ml syringe for injection.
[0171] 9.2 Immunoprotection test
[0172] 50 15-day-old SPF chickens were purchased and then randomly divided into 5 groups (control group, Z-PCV3-Cap group, Z-PCV3-Rep group, J-PCV3-Cap group, J-PCV3-Rep group), and rested for one week, and blood was collected on day 0, the first immunization was recorded as the first day, and the second immunization was performed 14 days later, each time 150 μl of emulsified vaccine was injected intramuscularly and 150 μl was injected subcutaneously, blood was collected every 7 days during the period, and PCV3 challenge was performed on day 35, 400 μl of PBS per chicken for the control group, and 400 μl of virus solution per chicken for the experimental group, then the collected serum on day 0, day 7, day 14, day 21, day 28, and day 35 was detected for antibody level, and the test animals were sacrificed on day 49 and sampled for detection, the antibody level results are shown in Figure 16 and Figure 17 , and the immunoprotection is shown in Figure 18 and Figure 19 , indicating that the subunit vaccine of the application has a protective effect on poultry.
[0173] Example 10
[0174] MDCC-MSB1 can be used to isolate porcine circovirus type 3
[0175] 10.1 Effect of MDCC-MSB1 infection with porcine circovirus type 3
[0176] After the MDCC-MSB1 cells were recovered, they were cultured in a culture flask using RPMI 1640 medium containing 10% fetal bovine serum, and when the cells grew to 2 x 10 6 After 5 min of centrifugation at 800 r / min, the supernatant was discarded, a small amount of fresh medium was added, and the cells were gently resuspended.
[0177] The PCV3 virus solution isolated using PK-15 was diluted by 10% of the volume ratio using sterile 1640 (the method for isolating porcine circovirus type 3 using PK-15 is described in the article by Taehwan Oh et al. (Oh et al., 2020)), and then added to the resuspended cell solution, incubated for 1 h, centrifuged at 800 r / min for 5 min, the supernatant was discarded, 10 ml of fresh medium was added, and then 3 mmol of D-glucosamine was added, and the culture was continued for 24 and 48 hours, centrifuged at 800 r / min for 5 min, the supernatant was discarded, and WB lysate or 4% paraformaldehyde was added; the control group was performed using PK-15, and when the PK-15 cells grew to about 70% confluence, they were inoculated with the virus, the medium was changed to 2% DMEM, and after 24 h and 48 h of culture in a 37°C incubator, WB lysate or 4% paraformaldehyde was added. Then, WB and IFA were performed for verification.
[0178] 10.2 WB verification
[0179] (1) Sample preparation: discard the culture medium of the cells, add WB cell lysis solution and 1% protease phosphatase inhibitor (operation on ice), use a pipette to repeatedly blow off the cells from the wall, transfer to a 1.5 mL centrifuge tube. (2) Electrophoresis: protein loading, first run electrophoresis at 85V constant voltage until the protein band runs from the concentrated gel to the separation gel, adjust the voltage to 100V, stop when the protein band reaches the appropriate position. (3) Membrane transfer: PVDF membrane is activated in formaldehyde solution (previously -20°C), wet transfer method is used for membrane transfer (transfer solution needs to be pre-cooled at -20°C), membrane transfer is carried out under ice bath conditions, 100V for 2h. (4) Blocking: after membrane transfer is completed, the membrane is taken out and placed in a box containing skimmed milk powder blocking solution with the front side facing up, and blocked at room temperature for 2h. (5) Membrane washing: wash the membrane with PBST washing solution on a shaker for five times, 5min each time. (6) Incubation of primary antibody: incubate overnight at 4°C. The primary antibody is diluted according to 1:1000 using primary antibody diluent. (7) Membrane washing: step (5). (8) Incubation of secondary antibody: place the membrane in the diluted secondary antibody solution, incubate on a shaker at room temperature for 1h. The secondary antibody is goat anti-mouse secondary antibody, diluted according to 1:5000 using secondary antibody diluent. (9) Membrane washing: step (5). (10) Membrane exposure: mix A and B in the hypersensitive ECL chemiluminescence kit at 1:1, place the membrane, use the instrument to expose the membrane, take a picture and save the results, the results are shown in Figure 20 .
[0180] 10.3 IFA identification
[0181] The cells were fixed with 4% paraformaldehyde, then IFA detection was performed, and the fluorescence was observed under a fluorescence microscope, and the results needed were photographed and stored, and the results are shown in Figure 21 .
[0182] As can be seen from Figure 20 and Figure 21 , MDCC-MSB1 can infect PCV3 virus of porcine origin, and the infection efficiency is higher than that of PK-15, so MDCC-MSB1 can be used to isolate and culture porcine circovirus type 3.
[0183] Example 11
[0184] Chicken embryo separation of PCV3 test
[0185] Purchase 40 SPF level fertilized chicken eggs, incubate in a 37°C incubator, at 8 days of age, randomly divided into two groups (experimental group, control group), the experimental group in a sterile clean bench to the allantoic cavity injection using PK-15 isolated from pig PCV3 virus liquid (PK-15 isolation of porcine circovirus type 3 method reference Taehwan Oh et al. article (Oh et al., 2020)), 200ul virus liquid per egg, the control group is not treated. Then put back in 37°C incubator for 72h, then under sterile conditions to collect allantoic fluid to obtain virus, extract total nucleic acid, q-PCR detection, with Taehwan Oh et al. article in the PK-15 isolation of porcine circovirus type 3 method as a control group, the results as shown in Figure 22 , found that the virus content of chicken embryo isolated from the traditional PK-15 cell isolation is high; and the sampling of the chicken embryo tissue for immunohistochemical detection, the results as shown in Figure 23 .
[0186] This example shows that pig PCV3 can infect poultry, and at the same time, a higher titer of pig porcine circovirus can be detected in the allantoic fluid, indicating that this method can be used to isolate porcine circovirus type 3.
[0187] The above only is the preferred embodiment of the present application, it should be noted that for those skilled in the art, without departing from the principles of the present application, can also make a number of improvements and refinements, these improvements and refinements should also be considered as the protection scope of the present application.
Claims
1. An aPCV3 gene, characterized in that, The nucleotide sequence of the aPCV3 gene is shown in SEQ ID NO.
1.
2. The use of the aPCV3 gene as described in claim 1 in the preparation of PCV3 vaccines.
3. An inactivated vaccine, characterized in that, This includes viral strains containing the aPCV3 gene as described in claim 1.
4. A method for efficiently separating PCV3, characterized in that, The procedure includes the following steps: injecting PCV3 virus into the allantoic cavity of 8-11 day old avian embryos, collecting allantoic fluid after incubation to obtain PCV3 virus, wherein the PCV3 virus is a virus strain containing the aPCV3 gene as described in claim 1.
5. Application of the MDCC-MSB1 cell line in the isolation and culture of PCV3, wherein the PCV3 is a viral strain containing the aPCV3 gene as described in claim 1.
Citation Information
Patent Citations
Porcine circovirus type 3 strain, and preparation method and application thereof
CN109251897A
Methods and Compositions for Immunizing Pigs Against Porcine Circovirus
US20090017064A1