A ZmCS2 gene, locus and application thereof for detecting alpha-tocopherol content in sweet corn kernels

Abstract

The invention discloses a ZmCS2 gene, a site and an application thereof for detecting the alpha-tocopherol content of sweet corn kernels, including SNP sites at positions 6,246,230, 36,246,245, 36,246,279, 36,246,672, 36,246,703, 36,247,066, 36,247,456, 36,249,909, 36,254,984, 36,255,010 and 36,256,682 of chromosome 1 of the sweet corn genome, wherein the SNP sites are significantly correlated with the alpha-tocopherol content. The KASP primers developed by the invention are highly flexible, can quickly complete the detection of a small amount and a large amount of sweet corn material genotypes, and can quickly screen sweet corn materials with high alpha-tocopherol content.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and in particular relates to a ZmCS2 gene for detecting the alpha-tocopherol content of sweet corn kernels, a site and an application thereof. Background Art

[0002] Sweet corn is a fruit and vegetable crop and an important dietary source of micronutrients. The structures of all vitamin E compounds differ only in the position and number of methyl substituents on the 2,3-dihydrobenzofuran ring, but their biological activities vary greatly. Vitamin E includes eight fat-soluble isomers (including tocopherol and tocotrienol), of which alpha-tocopherol has the highest content among the eight vitamin E components, accounting for about 38% of the total vitamin E content, which is three times the content of alpha-tocopherol. Studies have shown that although tocopherol and tocotrienol are similar in structure, there are huge differences in their biological functions. Compared with tocopherol, tocotrienol has stronger antioxidant and lipid oxidation inhibition. It also has physiological functions such as lowering cholesterol and anti-tumor. For sweet corn seeds, these physiological functions of alpha-tocopherol can not only ensure the normal development of sweet corn seeds, but also increase the nutrition and added value of sweet corn. It is of great significance to increase the content of alpha-tocopherol in sweet corn kernel tissue through genetic breeding.

[0003] Methods based on genomics and population genetics provide important opportunities for analyzing the genetic basis of vitamin E synthesis. The rich genetic variation of sweet corn populations provides favorable conditions for the utilization of key genes. It creates conditions for the targeted manipulation of the levels and types of tocopherols and tocotrienols in crops. In previous studies, linkage and association analyses of tocopherol and tocotrienol content in corn kernels provided a lot of important information for the genetic regulation of vitamin E synthesis and metabolism. However, most of the major quantitative trait genetic loci affecting tocopherol composition usually point to VTE4, that is, VTE4 is the key locus for vitamin E synthesis in corn, and there are fewer studies on other loci. However, except for VTE4, other genes / locus for screening high tocopherol and high tocotrienol content are rarely reported. Therefore, a ZmCS2 gene, locus and its application for detecting the alpha-tocopherol content in sweet corn kernels are needed. Summary of the invention

[0004] The purpose of the present invention is to provide a ZmCS2 gene, a site and an application thereof for detecting the alpha-tocopherol content of sweet corn kernels.

[0005] The present invention is achieved through the following technical solutions:

[0006] Application of SNP sites on chromosome 1 of the sweet corn genome, the sweet corn genome is genome B73, v4 version, ID is Zm00001d028477, the SNP site at position 36,246,230 of chromosome 1 of the sweet corn genome, the polymorphism is G / C. The SNP site at position 36,246,245, the polymorphism is C / A. The SNP site at position 36,246,279, the polymorphism is C / T. The SNP site at position 36,246,672, the polymorphism is T / G. The SNP site at position 36,246,703, the polymorphism is A / C. The SNP site at position 36,247,066, the polymorphism is G / A. The SNP site at position 36,247,456, the polymorphism is A / G. The SNP site at position 36,249,909 has a polymorphism of C / G. The SNP site at position 36,254,984 has a polymorphism of G / T. The SNP site at position 36,255,010 has a polymorphism of G / T. The SNP site at position 36,256,682 has a polymorphism of A / T. The sites are significantly correlated with the level of alpha-tocopherol.

[0007] Furthermore, when the SNP site within the ZmCS2 range contains a favorable allele, the alpha-tocopherol content of the sweet corn is identified to be increased; when the SNP site within the ZmCS2 range contains an unfavorable allele, the alpha-tocopherol content of the sweet corn is identified to be reduced.

[0008] In another aspect, a variant site detection primer set is provided, wherein the detection site primer set comprises a forward primer as shown in SEQ ID NO: 1; a reverse primer as shown in SEQ ID NO: 2; and a universal primer as shown in SEQ ID NO: 3.

[0009] In another aspect, a kit for detecting high alpha-tocopherol content in sweet corn comprises the variable site detection primer set.

[0010] In another aspect, a method for screening sweet corn with high alpha-tocopherol content comprises the following steps: identifying the genotypes of SNP sites located at positions 6,246,230, 36,246,245, 36,246,279, 36,246,672, 36,246,703, 36,247,066, 36,247,456, 36,249,909, 36,254,984, 36,255,010, and 36,256,682 of chromosome 1 of the sweet corn genome, selecting sweet corn with the genotype of the variable site for breeding and planting, and achieving the breeding of sweet corn with high alpha-tocopherol content.

[0011] Compared with the prior art, the present invention adopts the above technical solution, and the biggest feature is:

[0012] Compared with the prior art, the present invention has the following effects:

[0013] 1. The present invention utilizes association analysis technology to newly discover and identify SNP sites and related genes ZmCS2 that control alpha-tocopherol content in sweet corn kernels, supplementing and enriching the genetic sites for molecular identification of alpha-tocopherol content in sweet corn kernels.

[0014] 2. The present invention develops KASP molecular markers based on the chorismate synthase gene (ZmCS2) site, which can quickly complete genotype detection, has low cost, simple operation, and is suitable for high-throughput detection. This site will greatly promote the biofortification breeding of sweet corn with high alpha-tocopherol content. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Schematic diagram of PCA analysis of 76 SNPs in the chorismate synthase ZmCS2 gene region of the present invention

[0016] Figure 2 Schematic diagram of the analysis of the differences in alpha-tocopherol content between haplotype groups of the present invention.

[0017] Figure 3 Schematic diagram of the distribution of characteristic SNP sites of the three haplotype groups of the present invention.

[0018] Figure 4 Schematic diagram of the results of allele typing using KASP markers in the sweet corn population material of the present invention. DETAILED DESCRIPTION

[0019] The technical scheme of the present invention is further described below in conjunction with embodiments and comparative examples, but they should not be construed as limiting the present invention:

[0020] Example 1 Mining and analysis of alpha-tocopherol related gene ZmCS2

[0021] 1. Collection of sweet corn population phenotypic data

[0022] A sweet corn association analysis population was formed by selecting 295 sweet corn inbred line materials from widely representative inbred line materials collected from the world's major sweet corn growing areas (including China, the United States, Thailand, Japan, Argentina, etc.). Leaf tissues were collected at the seedling stage, and whole genome resequencing was performed on the llumina Hiseq 2500 platform after genomic DNA extraction, library construction and other steps. The average sequencing depth was 11X, and about 9.86 million high-quality SNP data sets were identified on the entire genome. Secondly, the kernel tissues of the sweet corn materials in the population were sampled 15 days after pollination, and a transcriptome sequencing library with an insert size of 300-500 bp was constructed. Transcriptome sequencing was performed using 150bp double-end paired RNA sequencing technology, and transcriptome sequencing of the whole kernel tissue was performed on the llumina Hiseq 2500 sequencing platform, generating a total of 31.27 million read bases. After bioinformatics analysis, the expression data of each gene in each material in the sweet corn population were obtained. This completes the expression results of kernel tissue in the sweet corn population.

[0023] In 2019, 295 sweet corn lines were planted at the Field Experiment Station of Guangdong Academy of Agricultural Sciences (E113°224, N23°093) with a planting pattern of about 12 plants per row. The experiment adopted a randomized block design, with 3 replicates for each inbred line. All sweet corn lines in each plot were self-pollinated, and pollination data were recorded. 20 days after pollination, an appropriate amount of grains were harvested from 3 plants in each row. Immediately after harvesting, the grains were frozen in liquid nitrogen until transferred to a -80°C refrigerator for storage.

[0024] 2. Determination of alpha-tocopherol

[0025] Vitamin E extraction: Sweet corn kernels were precooled with liquid nitrogen and then ball-milled for 60 seconds at 30 Hz using a mill (MM400; Retsch). 2 g of fresh sweet corn flour was accurately weighed in a frozen state. The sample was saponified with 2 mL of ethanol (95%). Antioxidants (1 mL of sodium chloride, 176 mg / mL; 4 mL of pyrogallol ethanol, 63.055 g / L; 1 mL of ascorbic acid, 176 mg / mL) and 2 mL of potassium hydroxide (600 g / L) were then added and mixed using a vortex mixer. The mixture was then extracted with n-hexane / ethyl acetate (9:1, v / v). The liquid phase of the organic layer was collected and concentrated to dryness using a concentrator under nitrogen. The residue was dissolved in 1% isopropanol in n-hexane for HPLC analysis.

[0026] Quantitative detection of vitamin E: The quantitative detection of vitamin E was performed by normal phase high performance liquid chromatography (NP-HPLC). The NP-HPLC system included a Waters 515 HPLC pump and a Waters 2475 multi-λ fluorescence detector. The chromatographic column was Agilent (ZORBAX RX-SIL, 250 mm × 4.6 mm) with a flow rate of 1 mL / min. The mobile phase was 0.85% n-hexane-2-propanol, and 20 µL was injected. The excitation wavelengths for detection were 290 nm and 330 nm. The content of each vitamin E component was calculated using a standard curve constructed using 8 external standards.

[0027] 3. Sweet corn population SNP profile and expression level identification

[0028] Leaf tissues were collected at the seedling stage, and after genomic DNA extraction and library construction, whole genome resequencing was performed on the llumina Hiseq2500 platform. The average sequencing depth was 11X, and about 9.86 million high-quality SNP maps were identified on the entire genome. Secondly, the grain tissues were sampled 15 days after pollination, and a transcriptome sequencing library with an insert size of 300-500 bp was constructed. Transcriptome sequencing was performed using 150bp double-end paired RNA sequencing technology. Transcriptome sequencing of the whole grain tissue was performed on the llumina Hiseq 2500 sequencing platform, generating a total of 31.27 million read bases. Thus, the expression results of genes in grain tissues of each individual in the sweet corn population were completed.

[0029] 4. Genome-wide association analysis of alpha-tocopherol

[0030] Genome-wide association analysis was performed using TASSEL (3.0) using a mixed linear model to control for population structure and kinship. To determine the genome-wide threshold for GWAS results, we estimated the number of genome-wide effective SNPs using the GEC (Genetic Type Ierror calculator) software with default parameters. We then selected P = 5.08 × 10 -7 (P<1 / n, n=number of valid markers) was used as the significance threshold for genome-wide association analysis. Based on the results of the alpha-tocopherol association analysis, we conducted a gene-based association analysis (magma_v1.10) on 131 genes related to VE synthesis and metabolic pathways, and found that a chorismate synthase ZmCS2 (Zm00001d028477) gene was significantly associated with alpha-tocopherol and related phenotypes (P<0.001; Table 2). Through haplotype analysis of 76 SNPs in the ZmCS2 region, we found that the chorismate synthase ZmCS2 gene was mainly divided into three haplotype groups ( Figure 1 ), haplotype group 2 (HG2) has a higher alpha-tocopherol content and a lower distribution frequency in the population ( Figure 2 ). The underutilization of favorable alleles in sweet corn breeding is a haplotype that can be used in breeding. Based on this, we identified 11 SNP types unique to haplotype group 2, which can distinguish this haplotype group from other materials (Table 3). These 11 SNP loci are highly linked and can be used to screen materials with high alpha-tocopherol content ( Figure 3 ).

[0031] Table 1 Results of gene-based association analysis of alpha-tocopherol

[0032]

[0033] aCandidate genes are genes that are target genes in gene-based association analysis and reach a significant level.

[0034] The chromosome information of the b gene was determined by referring to the V4 sequence of the corn B73 reference genome.

[0035] c Gene-based association analysis was performed, and the starting position of the genes used.

[0036] d End positions of genes used for gene-based association analysis.

[0037] e Number of SNPs in the interval used for gene-based association analysis.

[0038] f The number of materials within the population used for gene-based association analysis.

[0039] Table 2 Chorismate synthase (ZmCS2) gene-related high alpha-tocopherol molecular sites

[0040]

[0041] Example 2 Development of alpha-tocopherol-related KASP markers

[0042] Association analysis and transcriptome analysis verified the function of chorismate synthase ZmCS2 in the alpha-tocopherol content of sweet corn kernel tissue. Combined with the 11 100% linked SNP sites identified by association analysis and significantly associated with alpha-tocopherol, any SNP site can be developed for markers for screening sweet corn materials with high alpha-tocopherol content. In this embodiment, KASP markers were developed for S1_36246230 (G / C) in the above SNP sites. KASP primer design was completed by PRIMER-BLAST, a web primer design tool provided by NCBI. Primer synthesis was performed by LGC (Laboratory of the Government Chemist, Hoddeston, UK).

[0043] Primer information is as follows:

[0044] KASP primer sequence F1: gaaggtgaccaagttcatgctCGGTCCGGTCCAGCCGCC (SEQ ID NO: 1)

[0045] KASP primer sequence F2: gaaggtcggagtcaacggattCGGTCCGGTCCAGCCGCG (SEQ ID NO: 2)

[0046] KASP universal primer sequence: GCTCGTGTACTACTACTACCCGTGCGTA (SEQ ID NO: 3)

[0047] The PCR amplification reaction system is shown in Table 2 (96-well white opaque PCR plate, 10.14 μL reaction system). The KASP amplification reaction procedure is shown in Table 3.

[0048] Table 3 KASP PCR reaction system

[0049]

[0050] Table 4 KASP amplification reaction procedure

[0051]

[0052] The results of KASP amplification reaction are shown in the figure ( Figure 4), the SNP CC allele of the KASP primer has a high alpha-tocopherol content in the sweet corn material to stimulate HEX fluorescence, and the SNP GG allele has a low alpha-tocopherol content in the sweet corn material to stimulate FAM fluorescence. The allele CC and allele GG can be distinguished by fluorescence quantitative PCR detection; the genotyping results of this KASP marker are completely consistent with the high-throughput sequencing results, and it has high stability and universality. The application of this marker in the improvement of sweet corn alpha-tocopherol will play an important role in promoting the high-quality breeding of sweet corn.

[0053] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which are all covered by the protection scope of the present invention.

Claims

1. Application of gene ZmCS2 locus on chromosome 1 of sweet corn genome for screening sweet corn with high alpha-tocopherol content, wherein the sweet corn genome is genome B73, v4 version, ID is Zm00001d028477, characterized in that: The site is a SNP site at position 36,246,230 of chromosome 1 of the sweet corn genome, which is used to screen sweet corn with high alpha-tocopherol content, the polymorphism is G / C, and the favorable allele is C.

2. The use according to claim 1, characterized in that: The site is also selected from one or more of the following SNP sites: 1) The SNP site at position 36,246,245 on chromosome 1 of the sweet corn genome has a polymorphism of C / A and the favorable allele is A; 2) The SNP site at position 36,246,279 on chromosome 1 of the sweet corn genome has a polymorphism of C / T and a favorable allele of T; 3) The SNP site at position 36,246,672 on chromosome 1 of the sweet corn genome has a polymorphism of T / G and the favorable allele is G; 4) The SNP site at position 36,246,703 on chromosome 1 of the sweet corn genome has a polymorphism of A / C and a favorable allele of C; 5) The SNP site at position 36,247,066 on chromosome 1 of the sweet corn genome has a polymorphism of G / A and the favorable allele is A; 6) The SNP site at position 36,247,456 on chromosome 1 of the sweet corn genome has a polymorphism of A / G and a favorable allele of G; 7) The SNP site at position 36,249,909 on chromosome 1 of the sweet corn genome has a polymorphism of C / G and a favorable allele of G; 8) The SNP site at position 36,254,984 on chromosome 1 of the sweet corn genome has a polymorphism of G / T and a favorable allele of T; 9) The SNP site at position 36,255,010 on chromosome 1 of the sweet corn genome, the polymorphism is G / T, and the favorable allele is T; or 10) The SNP site at position 36,256,682 on chromosome 1 of the sweet corn genome has a polymorphism of A / T and the favorable allele is T.

3. The use according to claim 1, characterized in that: When the genotype of the SNP site is CC, the sweet corn is identified as having a high alpha-tocopherol content; when the genotype of the SNP site is GG, the sweet corn is identified as having a low alpha-tocopherol content.

4. A primer set for detecting a variant site, characterized in that: The detection site primer set consists of a forward primer as shown in SEQ ID NO: 1, a reverse primer as shown in SEQ ID NO: 2, and a universal primer as shown in SEQ ID NO:

3.

5. A kit for detecting high alpha-tocopherol content in sweet corn, characterized in that: Comprising the variant site detection primer set as described in claim 4.

6. A method for screening sweet corn with high alpha-tocopherol content, characterized in that: The method comprises the following steps: based on the primer combination described in claim 4, the genotype of the SNP site at position 6,246,230 of the sweet corn chromosome 1 is identified, and the sweet corn with the genotype of the favorable mutation site is selected for breeding to achieve the breeding of sweet corn with high alpha-tocopherol content, wherein the genotype with the favorable mutation site is CC.

Images