An InDel molecular marker for identifying or breeding low-fat broiler chickens and its application

Abstract

The present invention discloses an InDel molecular marker for identifying or breeding low-fat broiler chickens and its application, belonging to the technical field of poultry breeding, wherein the molecular marker is a nucleotide sequence shown in SEQ ID No. 1, and is located between the 22288438th site and the 22288439th site from the 5' end on chromosome 7 of the GRCg7b version of the chicken genome, and contains a molecular marker sequence, and the genotype DelDel individual has a lower abdominal fat content than the genotype InIn individual. Selecting the genotype DelDel individual for seed retention can quickly reduce the abdominal fat content of broiler chickens, improve the feed conversion efficiency of broiler chickens, and accelerate the breeding and improvement process of high-quality broiler chickens.

Description

Technical Field

[0001] The invention belongs to the technical field of poultry breeding, and specifically relates to or identifies an InDel molecular marker for identifying or breeding low-fat broiler chickens and an application thereof. Background Art

[0002] In the broiler production process, excessive abdominal fat deposition has become a major problem. Studies have shown that excessive abdominal fat deposition in chickens not only leads to a decrease in feed conversion rate, but also changes the ratio of muscle to fat, further affecting the quality of meat. In addition, excessive fat deposition in breeder chickens may also cause fatty liver syndrome, which will seriously affect their egg production rate, fertilization rate and hatching rate, and increase the mortality rate. Therefore, effective control of abdominal fat deposition in chickens can not only improve feed conversion efficiency and carcass quality, but also improve the reproductive performance of breeder chickens. This issue has become a major challenge in global chicken breeding research. In this sense, excessive fat deposition in broilers will cause obvious economic losses to producers, processors and consumers. However, traditional breeding methods rely on phenotypic selection, which is time-consuming and inefficient, and it is difficult to adapt to the breeding needs of modern efficient animal husbandry.

[0003] With the continuous development of molecular genetics and poultry genomics research, researchers have begun to focus on the use of various genetic markers for breeding and explore the genetic mechanism of abdominal fat deposition traits in broilers. Molecular marker-assisted selection is to select molecular markers that determine the target trait to achieve the purpose of selecting the target trait. It has the advantages of being fast, accurate, and not affected by environmental conditions. Combining traditional breeding methods with modern molecular genetic methods in broiler breeding can greatly improve the selection efficiency and further improve the production performance of broilers. However, in addition to using the phenotypic and pedigree information used in traditional selection, marker-assisted selection also needs to make full use of the information of genetic markers. Therefore, the key to the successful implementation of molecular marker-assisted selection lies in the effective identification of key genetic markers that control abdominal fat deposition in broilers. Summary of the invention

[0004] Based on the above shortcomings, the present invention provides an InDel molecular marker for identifying or breeding low-fat broiler chickens and its application, which is used to breed or identify low-fat broiler chickens by effectively identifying key genetic markers that control abdominal fat deposition in broiler chickens.

[0005] The technical solution adopted by the present invention is as follows: an InDel molecular marker for identifying or breeding low-fat broiler chickens is a nucleotide sequence shown in SEQ ID No.1.

[0006] Another object of the present invention is to provide an application of an InDel molecular marker in identifying or breeding low-fat broiler chickens, wherein the molecular marker can affect the abdominal fat deposition of chickens, and according to the genotype between No. 22288438 and No. 22288439 from the 5' end on chromosome 7 of the chicken genome GRCg7b, the abdominal fat content of homozygous individuals having the molecular marker is significantly higher than that of homozygous or heterozygous individuals not having the molecular marker, and the sequence of the molecular marker is shown in SEQ ID No. 1.

[0007] Another object of the present invention is to provide a specific primer pair for identifying or breeding InDel molecular markers for low-fat broiler chickens, the upstream primer sequence is shown in SEQ ID No.2, and the downstream primer sequence is shown in SEQ No.3.

[0008] Another object of the present invention is to provide the use of the specific primer pair as described above in identifying or breeding low-fat broiler chickens.

[0009] Another object of the present invention is to provide an InDel molecular marker kit for identifying or breeding low-fat broiler chickens, comprising a specific primer pair: the upstream primer sequence is shown in SEQ ID No.2, and the downstream primer sequence is shown in SEQ No.3.

[0010] Another object of the present invention is to provide the use of the InDel molecular marker kit as described above in the selection or identification of low-fat broiler chickens.

[0011] Another object of the present invention is to provide a method for identifying or breeding low-fat broiler chickens, the method steps are as follows: S1: extracting DNA from the blood of the chicken to be tested;

[0012] S2: Perform PCR amplification using a DNA specific primer pair to obtain an amplified product, wherein the specific primer pair: the upstream primer sequence is shown in SEQ No.2, and the downstream primer sequence is shown in SEQ No.3;

[0013] S3: After sequencing the amplified product, the genotype of the molecular marker is obtained. When the amplified product is 250bp, the sequence is shown in SEQ ID No.4, which is Del type; when the amplified product is 263bp, the sequence is shown in SEQ ID No.5, which is In type; according to the genotyping results, the abdominal fat traits of the sample chickens to be tested are judged: the abdominal fat content of the individuals with the genotype DelDel is significantly lower than that of the individuals with the genotype InIn.

[0014] Furthermore, in the InDel molecular labeling method described above, the PCR amplification reaction system, calculated as 25 μl, is as follows: 500 ng of the DNA to be tested, 12.5 μl of 2×Taq PCR Mix containing loading dye, 1 μl of 10 μM upstream primer, 1 μl of 10 μM downstream primer, and sterile water to make up to 25 μl.

[0015] Furthermore, in the InDel molecular labeling method described above, the reaction conditions for PCR amplification are: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 sec, annealing at 56°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 5 min; and storage at -20°C.

[0016] Compared with the prior art, the present invention has the following beneficial effects: the molecular marker of the present invention can act as an allele-specific enhancer to remotely enhance the transcription of IGFBP2 and IGFBP5, thereby regulating the abdominal fat content of broilers. The present invention provides a new marker target for marker-assisted selection of abdominal fat deposition traits in broilers, and has the advantages of improving the feed conversion efficiency of broilers and accelerating the breeding and improvement process of high-quality broilers. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the agarose gel electrophoresis detection diagram of molecular markers.

[0018] Figure 2 This is the Sanger sequencing map of molecular markers.

[0019] Figure 3 This is a correlation analysis chart between genotype and abdominal fat weight of broilers.

[0020] Figure 4 This is a correlation analysis chart between genotype and abdominal fat rate of broilers.

[0021] Figure 5 It is the epigenetic modification map of the region where the molecular marker genome is located.

[0022] Figure 6 A three-dimensional interaction map of the region where the molecular marker genome is located. DETAILED DESCRIPTION

[0023] The sequences and analysis results in the present invention are based on the information of the chicken genome GRCg7b version.

[0024] Example 1: rs734209466 genotype analysis

[0025] High- and low-fat broiler chickens from Northeast Agricultural University with clear origin and pedigree records were selected as experimental materials. Blood was collected from subwing vein, anticoagulated and then lysed. After proteinase K digestion, genomic DNA was extracted using the saturated sodium chloride method.

[0026] Using the above-extracted genomic DNA as a template, PCR amplification was performed on the upstream and downstream sequences of the molecular marker rs734209466:

[0027] Upstream primer: 5'GTTCCTGAATGGCATTTGACCC 3'

[0028] Downstream primer: 5'CTTCCACGCAGAGGCGAA 3'

[0029] The reaction system of the PCR amplification is calculated as follows based on 25 μl:

[0030] DNA to be tested 500ng

[0031] 2×Taq PCR Mix (Loading dye in Mix)12.5μl

[0032] 10 μM upstream primer 1 μl

[0033] 10 μM downstream primer 1 μl

[0034] Make up to 25 μl with sterile water

[0035] The reaction conditions of the above PCR amplification were: 94°C pre-denaturation for 3 min; 94°C denaturation for 30 sec, 56°C annealing for 30 sec,

[0036] Extension at 72°C for 60 seconds, for a total of 30 cycles; extension at 72°C for 5 minutes; storage at -20°C.

[0037] The Del-type amplification product is 250 bp and the sequence is:

[0038] GTTCCTGAATGGCATTTGACCCTGCTCCCCAGGGCCCGGAGATGGAGTTTGTGATTAACACAGAGCATTTGTATCAGGGTGAATATTTGGAGCAAACTGCAGAGCACTGACTTCTTCCCTAGGGAGGGCTAAGAGGAAAACTCTAGCAAAACCTATTTCATGGGTCCAGACCATCTAAAACACAATGTTGTTCCTCCAGTCACCATTTCTTACGGAGCCAATGCTTGTTTCCTTCGCCTTGCGTGGAAG

[0039] The In-type amplification product is 263 bp and the sequence is:

[0040] GTTCCTGAATGGCATTTGACCCTGCTCCCCAGGGCCCGGAGATGGAGTTTGTGATTAACACAGAGCATTTGTATCAGGGTGAATATTTGGAGCAAACTGCAGAGCACTGACTTCTTCCCTAGGGAGGGCTAAGAGGAAAACTCTAGCAAAACCTATTTCATGGGTCCAGACCATCTAAAACACAATGTTGTTCCTCCAGT CTTCCAGTTCCTC CACCATTTCTTACGGAGCCAATGCTTGTTTCCTTCGCCTCTGCGTGGAAG

[0041] Agarose gel electrophoresis detection: The PCR products of each sample were subjected to gel electrophoresis. Figure 1 shown.

[0042] Sanger sequencing: For the DNA samples tested by agarose gel electrophoresis, 5 samples of each high-fat and low-fat series were randomly selected and sent to a sequencing company for Sanger sequencing. The sequencing results are as follows: Figure 2 shown.

[0043] Example 2: Correlation analysis between rs734209466 genotype and abdominal fat traits in broilers

[0044] In this example, 330 high-fat and low-fat broiler individuals were selected to conduct correlation analysis between genotype and abdominal fat traits of broilers. The statistical results are shown in Table 1. Figure 3 and Figure 4 As shown, among the 330 individuals tested, there were 131 DelDel genotypes, 87 InDel genotypes, and 112 InIn genotypes. The InIn type broilers had the highest abdominal fat weight and abdominal fat rate, followed by the InDel type broilers, and the DelDel type broilers had the lowest abdominal fat weight and abdominal fat rate. There were extremely significant differences in abdominal fat weight and abdominal fat rate among the three genotypes (p<0.01).

[0045] Table 1 Correlation analysis between genotype and abdominal fat traits in broilers

[0046]

[0047]

[0048] Note: Different letters in the same row indicate extremely significant differences (p<0.01).

[0049] Example 3: The rs734209466 molecular marker can act as an active enhancer to regulate abdominal fat deposition in broilers

[0050] This example performs epigenetic analysis on the genomic region where the molecular marker is located. First, the ATAC-seq technology is used to analyze the chromatin open region of the abdominal fat tissue of high- and low-fat broilers; secondly, the ChIP-seq technology is used to analyze histone modifications (H3K27ac, H3K27me3, H3K4me1, H3K4me3) and insulator activity-related factors CTCF; finally, the above-mentioned multiple epigenomic sequencing data are combined to draw the whole genome epigenomic map of the abdominal fat tissue of high- and low-fat broilers, and analyze the epigenomic genetic marker characteristics of functional genomic genetic variation in the whole genome. This project uses machine learning and other methods to functionally annotate the chromatin state of the above-mentioned different epigenomic genetic marker characteristics, and identify high- and low-fat broiler abdominal fat tissue-specific active regulatory elements, mainly including: resting promoters, active promoters, resting enhancers, active enhancers, super enhancers, insulators, etc. Figure 5 As shown, the results showed that the molecular marker acts as an allele-specific enhancer to regulate abdominal fat deposition in broiler chickens.

[0051] Example 4: rs734209466 molecular marker remotely regulates the expression of IGFBP2 and IGFBP5 through the loop structure to regulate abdominal fat deposition in broilers

[0052] In this example, Hi-C analysis was performed on abdominal fat tissues of high- and low-fat broiler chickens. The higher-order chromatin structure was used as a bridge to connect functional genomic variations with gene transcription. The functional genomic variations related to body fat deposition in broilers screened were linked to genes (including specifically expressed genes). The interaction network between functional regulatory elements and target genes was constructed using gene network analysis technology. Figure 6 As shown, the results showed that molecular markers remotely regulated the expression of IGFBP2 and IGFBP5 through the Loop structure to affect abdominal fat deposition in broiler chickens.

Claims

1. An application of an InDel molecular marker in identifying or breeding low-fat broiler chickens, wherein the molecular marker can affect abdominal fat deposition in chickens, and according to the genotype between No. 22288438 and No. 22288439 from the 5' end on chromosome 7 of the chicken genome GRCg7b, the abdominal fat content of homozygous individuals having the molecular marker is significantly higher than that of homozygous or heterozygous individuals not having the molecular marker, and the sequence of the molecular marker is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that: A specific primer pair of the InDel molecular marker of broiler chickens is used, the upstream primer sequence of which is shown as SEQ ID No.2, and the downstream primer sequence is shown as SEQ ID No.

3.

3. The use according to claim 1, characterized in that: A molecular marker kit is used, which contains a specific primer pair of the InDel molecular marker of broiler chickens, the upstream primer sequence of which is shown as SEQ ID No.2, and the downstream primer sequence is shown as SEQ ID No.

3.

4. A method for identifying or breeding low-fat broiler chickens, characterized in that: The steps are as follows: S1: Extract DNA from chicken blood to be tested; S2: Perform PCR amplification using a DNA specific primer pair to obtain an amplified product, wherein the specific primer pair: the upstream primer sequence is shown in SEQ ID No.2, and the downstream primer sequence is shown in SEQ ID No.3; S3: After sequencing the amplified product, the genotype of the molecular marker is obtained. When the amplified product is 250bp, the sequence is shown in SEQ ID No.4, which is Del type; when the amplified product is 263bp, the sequence is shown in SEQ ID No.5, which is In type; according to the genotyping results, the abdominal fat traits of the sample chickens to be tested are judged: the abdominal fat content of the individuals with the genotype DelDel is significantly lower than that of the individuals with the genotype InIn.

5. The method for identifying or breeding low-fat broiler chickens according to claim 4, characterized in that: The reaction system of the PCR amplification is calculated as follows in 25 μl: 500 ng of the DNA to be tested, 12.5 μl of 2×Taq PCR Mix containing loading dye, 1 μl of 10 μM upstream primer, 1 μl of 10 μM downstream primer, and sterile water to make up to 25 μl.

6. The method for identifying or breeding low-fat broiler chickens according to claim 4, characterized in that: The reaction conditions of PCR amplification were as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 sec, annealing at 56°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 5 min; and storage at -20°C.

Images