A VTE4 gene for detecting alpha-tocopherol content in sweet corn kernels and its application

Abstract

The present invention discloses a VTE4 gene for detecting the alpha-tocopherol content of sweet corn kernels and its application, including the following two SNP sites: the first QTL site is the SNP site at position 205305125 of chromosome 5 of the sweet corn genome, and the polymorphism is A / G; the second QTL site is the SNP site at position 205797989 of chromosome 5 of the sweet corn genome, and the polymorphism is C / T; the two sites are positively correlated with the expression of the VTE4 gene and thus affect the alpha-tocopherol content. The invention develops corresponding KASP molecular markers through two variable sites (S5_205305125 and S5_205797989) for regulating the expression of the VTE4 gene developed for alpha-tocopherol, and can rapidly perform genotyping of sweet corn by a fluorescent quantitative PCR instrument, which is suitable for high-throughput detection. This site will greatly promote the future bio-fortification breeding of sweet corn with high alpha-tocopherol content.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and in particular relates to a VTE4 gene for detecting the alpha-tocopherol content of sweet corn kernels and an application thereof. Background Art

[0002] Sweet corn is a fruit and vegetable crop and an important dietary source of micronutrients. Sweet corn kernels are rich in vitamin E, which is one of the ways for the human body to ingest tocopherols and tocotrienols. The structures of all vitamin E compounds differ only in the position and number of methyl substituents on the 2,3-dihydrobenzofuran ring, but their biological activities vary greatly. Vitamin E includes 8 fat-soluble isomers (including tocopherols and tocotrienols), among which alpha-tocopherol has the highest vitamin E activity and is most important for human health. However, the alpha-tocopherol content in most crop seeds is low. It is particularly important to increase the content of alpha-tocopherol in sweet corn kernel tissues through genetic breeding.

[0003] Methods based on genomics and population genetics provide important opportunities for analyzing the genetic basis of tocopherol synthesis. The rich genetic variation of the sweet corn population provides favorable conditions for the utilization of key genes. It creates conditions for the targeted manipulation of the levels and types of tocopherols and tocotrienols in crops. In previous studies, linkage and association analyses of tocopherol content in corn kernels provided a lot of important information for the genetic regulation of tocopherol synthesis and metabolism. However, most of the major quantitative trait genetic loci affecting tocopherol composition usually point to VTE4, that is, VTE4 is the key locus for vitamin E synthesis in corn. There are fewer studies on other loci, and even fewer loci that can be used for molecular marker-assisted selection. The results showed that sweet corn and Arabidopsis have similar tocopherol and tocotrienol biosynthesis pathways. Therefore, drawing on the research results in Arabidopsis, the researchers preliminarily analyzed the vitamin E synthesis pathway and related genes in corn. According to previous reports, sequence variations in VTE4 explain part of the phenotypic variation of alpha-tocopherol, and VTE1 and hggt1 are also involved in the genetic regulation of tocotrienols in sweet corn kernels.

[0004] Currently, there are few molecular markers for predicting the alpha-tocopherol content in sweet corn through genetic markers. There is a rich genetic variation in the alpha-tocopherol content between different sweet corn germplasms. With the reduction in the price of whole genome sequencing, it is possible to obtain effective alpha-tocopherol-related genetic markers using population genetics analysis methods (association analysis, linkage analysis, etc.). In the patent "Nucleotide sequence for regulating corn tocopherol synthesis and its application", the inventor identified a gene ZmPOR1 that controls tocopherol content on chromosome 1 of the corn genome, and designed a molecular marker for screening corn tocopherol content. However, due to the limitation of sweet corn germplasm resources, this molecular marker is not applicable to sweet corn.

[0005] SNP and InDel markers in the corn genome basically evenly cover the entire genome with high density. SNP or InDel markers that are close enough to functional variations can be identified, and the markers can be prevented from becoming invalid due to recombination and other reasons. For the detection of SNP and InDel, KASP detection technology has the advantages of simple operation, low cost, short cycle, etc., and is very suitable as a technical means for molecular marker typing. Through association analysis, a genetic variation site significantly correlated with alpha-tocopherol content in the sweet corn genome was excavated. And the corresponding KASP molecular detection marker was developed. Based on this, the present invention is based on the development of molecular markers for detecting the alpha-tocopherol content in sweet corn kernels based on whole genome association analysis and KASP technology, which is of great significance for the genetic improvement of vitamin E in sweet corn. Therefore, a VTE4 gene for detecting the alpha-tocopherol content in sweet corn kernels and its application are needed. Summary of the invention

[0006] The purpose of the present invention is to provide a VTE4 gene for detecting the alpha-tocopherol content of sweet corn kernels and an application thereof.

[0007] The present invention is achieved through the following technical solutions:

[0008] The sweet corn genome is genome B73, v4 version, and the application of gene VTE4 locus on chromosome 5 of the sweet corn genome includes the following two SNP loci: the first QTL locus is the SNP locus at position 205305125 of chromosome 5 of the sweet corn genome, and the polymorphism is A / G;

[0009] The second QTL locus is the SNP locus at position 205797989 of chromosome 5 of the sweet corn genome, and the polymorphism is C / T;

[0010] The two sites are positively correlated with the expression of VTE4 gene and thus affect the alpha-tocopherol content.

[0011] Furthermore, when the two SNP sites contain bases of AA or CC, respectively, the gene VTE4 is highly expressed and identified as a high alpha-tocopherol content in the sweet corn kernels; when the two SNP sites contain bases of GG or TT, respectively, the gene VTE4 is lowly expressed and identified as a low alpha-tocopherol content in the sweet corn kernels, and the two sites have an additive effect.

[0012] In another aspect, a primer set for detecting a variation site, the primer set for detecting a first QTL site comprises a first primer as shown in SEQ ID NO: 1; a second primer as shown in SEQ ID NO: 2; and a third primer as shown in SEQ ID NO: 3.

[0013] The primer set for detecting the second QTL site includes a fourth primer as shown in SEQ ID NO:4; a fifth primer as shown in SEQ ID NO:5; and a sixth primer as shown in SEQ ID NO:6.

[0014] In another aspect, a kit for detecting high alpha-tocopherol content in sweet corn kernel tissue comprises the variant site detection primer set.

[0015] In another aspect, a method for screening sweet corn with high alpha-tocopherol content is provided. In the early stage of molecular marker-assisted selection breeding (MAS), the genotypes of the SNP sites at positions 205305125 and 205797989 of chromosome 5 of the sweet corn genome are identified based on the above-mentioned primer combination, and sweet corn with favorable variant genotypes is selected for breeding and planting, thereby achieving the breeding of sweet corn with high alpha-tocopherol content.

[0016] Compared with the prior art, the present invention adopts the above technical solution, and the biggest feature is:

[0017] Compared with the prior art, the present invention has the following effects:

[0018] The present invention utilizes association analysis technology to newly mine and identify the variable sites and related genes controlling alpha-tocopherol in sweet corn kernels, thereby supplementing and enriching the genetic sites for molecular identification of alpha-tocopherol content in sweet corn kernels.

[0019] The SNP molecular marker used in the present invention has the characteristics of high marker density, stability, and easy development of detection markers compared to SSR, InDel and other types of markers.

[0020] The present invention develops corresponding KASP molecular markers through two SNP sites (S5_205305125 and S5_205797989) that regulate VTE4 gene expression developed by alpha-tocopherol, which can be used for rapid genotyping of sweet corn by fluorescent quantitative PCR instrument, and is suitable for high-throughput detection. This site will greatly promote the future sweet corn biofortification breeding with high alpha-tocopherol content. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The GWAS of the present invention identified VTE4 as a candidate gene for alpha-tocopherol variation. SNP S5_20535125 and S5_205797989 are two loci that are independent of each other and significantly correlated with alpha-tocopherol content;

[0022] Figure 2 A comparison diagram of two QTL sites identified by genome-wide association analysis of VTE4 expression in the present invention;

[0023] Figure 3 The present invention uses SNP S5_205305125 as a covariate to perform a genome-wide association analysis of VTE4 expression;

[0024] Figure 4 It is a comparison diagram of the gene VTE4 model of the present invention and the locations of SNPs S5_205305125 and S5_205797989 (SNP520, S5_205305125; SNP28, S5_205797989);

[0025] Figure 5 This is a correlation analysis diagram between the expression level of the gene VTE4 of the present invention and the content of alpha-tocopherol;

[0026] Figure 6 This is a difference analysis diagram of alpha-tocopherol under different haplotypes of the present invention;

[0027] Figure 7 This is a differential analysis diagram of the expression of the gene VTE4 of the present invention under different haplotypes;

[0028] Figure 8 This is a diagram showing the typing results of the KASP marker of the present invention for SNP sites (S5_205305125 and S5_205797989); DETAILED DESCRIPTION

[0029] The technical scheme of the present invention is further described below in conjunction with embodiments and comparative examples, but they should not be construed as limiting the present invention:

[0030] Example 1: Mining and analysis of alpha-tocopherol-related gene VTE4

[0031] 1) Sweet corn association analysis population:

[0032] 295 sweet corn inbred line materials were selected from widely representative inbred line materials collected from the main sweet corn growing areas in the world (including China, the United States, Thailand, Japan, Argentina, etc.) to form a sweet corn association analysis population. Leaf tissues were collected at the seedling stage, and whole genome resequencing was performed on the llumina Hiseq 2500 platform after genomic DNA extraction, library construction and other steps. The average sequencing depth was 11X, and about 9.86 million high-quality SNP data sets were identified on the entire genome. Secondly, the grain tissues of the sweet corn materials in the population were sampled 15 days after pollination, and a transcriptome sequencing library with an insert size of 300-500bp was constructed. Transcriptome sequencing was performed using 150bp double-end paired RNA sequencing technology, and transcriptome sequencing of the whole grain tissue was performed on the llumina Hiseq 2500 sequencing platform, generating a total of 31.27 million read bases. After bioinformatics analysis, the expression data of each gene in each material in the sweet corn population were obtained. Thus, the expression results of the grain tissue in the sweet corn population were completed.

[0033] In 2019, 295 sweet corn lines were planted at the Field Experiment Station of Guangdong Academy of Agricultural Sciences (E113°224, N23°093) with a planting pattern of about 12 plants per row. The experiment adopted a randomized block design, with 3 replicates for each inbred line. All sweet corn lines in each plot were self-pollinated, and pollination data were recorded. 20 days after pollination, an appropriate amount of grains were harvested from 3 plants in each row. Immediately after harvesting, the grains were frozen in liquid nitrogen until transferred to a -80°C refrigerator for storage.

[0034] 2) Determination of alpha-tocopherol content in sweet corn kernels

[0035] Vitamin E extraction: Sweet corn kernels were precooled with liquid nitrogen and then ball-milled for 60 seconds at 30 Hz using a mill (MM400; Retsch). 2 g of fresh sweet corn flour was accurately weighed in a frozen state. The sample was saponified with 2 mL of ethanol (95%). Antioxidants (1 mL of sodium chloride, 176 mg / mL; 4 mL of pyrogallol ethanol, 63.055 g / L; 1 mL of ascorbic acid, 176 mg / mL) and 2 mL of potassium hydroxide (600 g / L) were then added and mixed using a vortex mixer. The mixture was then extracted with n-hexane / ethyl acetate (9:1, v / v). The liquid phase of the organic layer was collected and concentrated to dryness using a concentrator under nitrogen. The residue was dissolved in 1% isopropanol in n-hexane for HPLC analysis.

[0036] Quantitative detection of vitamin E: The quantitative detection of vitamin E adopts normal phase high performance liquid chromatography (NP-HPLC) method. The NP-HPLC system includes a Waters 515 high performance liquid chromatography pump and a Waters 2475 multi-λ fluorescence detector. The chromatographic column is Agilent (ZORBAX RX-SIL, 250mm×4.6mm), and the flow rate is 1mL / min. The mobile phase is 0.85% n-hexane-2-propanol, and 20μL is injected. The excitation wavelengths of the detection are 290nm and 330nm. The content of each vitamin E component is calculated using a standard curve constructed using 8 external standards.

[0037] 3) Genome-wide association analysis of alpha-tocopherol

[0038] Association analysis was performed using ultra-high density molecular markers (SNPs, 9.86 million), and mixed linear models were used to perform association analysis on alpha-tocopherol content, identifying genetic loci controlling alpha-tocopherol. A genome-wide association analysis of single nucleotide polymorphisms (SNPs) was performed on alpha-tocopherol phenotypic traits using mixed linear models (MLM, controlling Q and K). The number of effective SNPs in the whole genome was estimated using GEC (Genetic Type I error calculator) software with default parameters. P-value < 1 / n was used as the significance threshold for genome-wide association analysis (n, the number of effective SNPs in the whole genome).

[0039] Through association analysis, a key gene for vitamin E synthesis, VTE4 (gene ID: Zm00001d017746, Chr5: 205825586-205829216; reference genome version: B73 V4) was identified. For the functional site of this gene, there are two InDel sites (InDel7 and InDel118) at the front end of VTE4. The two InDel sites of the gene itself affect the expression level of VTE4 and thus the content of vitamin E.

[0040] The present invention identified through Expression-GWAS that the expression of VTE4 is regulated by a Cis-eQTL (Lead SNP S5_205797989; the eQTL site is less than 50kb from the target gene position) and a Trans-eQTL (Lead SNP S5_205305125; the eQTL site is greater than 50kb from the target gene position). These two InDel sites (InDel7 and InDel118) affect VTE4 expression and thus affect alpha-tocopherol content. Through the evaluation of genome-wide association analysis, the effect values ​​of the two eQTL sites identified in the present invention are greater than the existing two InDel sites in terms of the expression of alpha-tocopherol or VTE4. Accordingly, the two SNP sites identified in the present invention can be better used for the identification of vitamin E content.

[0041] KASP marker development: For the above alpha-tocopherol-related SNP sites S5_205305125 and S5_205797989, the corresponding KASP technology marker screening primers were developed for the screening of favorable allele genetic sites with high alpha-tocopherol content. The design of KASP primers was completed using the NCBI-BLAST program. For each detection site, 3 primers were designed, including 2 forward primers for genotype screening and 1 universal reverse primer. The method for purification after primer synthesis was the UPLC method.

[0042] SNP S5_205305125 site KASP marker primer information:

[0043] SEQ ID NO.1:

[0044] gaaggtgaccaagttcatgctCCTGATATGTTTCAAAAACAAACA

[0045] SEQ ID NO.2:

[0046] gaaggtcggagtcaacggattCCTGATATGTTTCAAAAACAAACG

[0047] SEQ ID NO.3:AAAGCTTAACTTGCCAATAATG

[0048] SNP S5_205797989 site KASP marker primer information:

[0049] SEQ ID NO.4: gaaggtgaccaagttcatgctAACATTCAGGTATGTTTTGCSEQ ID NO.5: gaaggtcggagtcaacggattAACATTCAGGTATGTTTTGTSEQ ID NO.6: CCCTTTTACCTGACATTGAC

[0050] KASP marker genotype detection method: As shown in the sequence, the lowercase character sequence gaaggtgaccaagttcatgct is the FAM fluorescent group linker sequence, and the lowercase character sequence gaaggtcggagtcaacggatt is the HEX fluorescent group linker sequence. The products amplified by the primers where these two fluorescent group sequences are located and the universal reverse primer carry fluorescent groups that can excite FAM and HEX respectively. After the KASP reaction system and reaction procedure, the PCR reaction of each material is completed. The KASP reaction system is fluorescently scanned using a PCR instrument or an enzyme marker with a fluorescence scanning function to complete the typing analysis of the sample, obtain the genotype information of the sweet corn material, complete the determination of the allele type, and then screen the sweet corn material with high alpha-tocopherol content.

[0051] Example 2

[0052] Genome-wide association analysis of alpha-tocopherol

[0053] TASSEL (3.0) was used for genome-wide association analysis, and mixed linear models were used to control for population structure and kinship. To determine the genome-wide threshold for GWAS results, the number of genome-wide effective SNPs was estimated using the GEC (Genetic Type I error calculator) software with default parameters. Then, P = 5.08 × 10 -7 (P = 1 / n, n = number of effective markers) was used as the significance threshold for genome-wide association analysis.

[0054] The sweet corn genome is genome B73, v4 version. Two QTL loci were identified in the range of 205.2-206.1Mb on chromosome 5 of sweet corn. In order to explore the independence of these two QTLs, conditional genome-wide association analysis was performed using the most significant SNP in the QTL region as a covariate. The candidate genes of the GWAS loci are located within the confidence interval or within 100kb for subsequent analysis. Through the screening of candidate genes, the gene VTE4 (a key gene in the vitamin E synthesis pathway) is located in one of the QTL intervals, so this gene determines the candidate gene of the QTL ( Figure 1). Through conditional association analysis, it was determined that the two QTL loci independently and jointly affected the alpha-tocopherol content. Genome-wide association analysis of VTE4 expression

[0055] The genome-wide association analysis using the expression of gene VTE4 also identified the above two QTL loci ( Figure 2 ), through conditional genome-wide association analysis, that is, using S5_205305125 as a covariate to perform genome-wide association analysis of VTE4 expression, only SNP S5_205797989 was significantly associated with VTE4 expression ( Figure 3 ). That is, the Lead SNPs (the most significantly associated SNPs in the QTL region) of the two QTLs, S5_205305125 and S5_205797989, were identified to be independent of each other and both were significantly correlated with VTE4 expression ( Figure 4 ).

[0056] Relationship between VTE4 expression and alpha-tocopherol content

[0057] Correlation analysis showed that the expression of VTE4 was significantly positively correlated with the content of alpha-tocopherol, with a correlation coefficient of r = 0.55 and a significant p-value of 2.2 × 10 -16 ( Figure 5 ). Expression level association analysis revealed that the expression level of VTE4 was regulated by two QTLs, and the haplotypes of the lead SNPs of the two QTLs were analyzed. It was found that there were four haplotypes in the sweet corn population (AACC, AATT, GGCC and GGTT), among which the haplotype AACC, which had both favorable allele loci, had the highest VTE4 expression and alpha-tocopherol content ( Figure 6 , Figure 7 ). However, there was no significant difference in VTE4 expression and alpha-tocopherol content between the haplotype combinations in which one of the two loci was a favorable allele, and both were higher than the haplotype combinations without favorable alleles. This shows that both loci can increase the content of alpha-tocopherol and have an additive effect. By screening for favorable alleles at these two SNP loci, sweet corn materials with high alpha-tocopherol content can be identified.

[0058] Example 3 Molecular marker development

[0059] Development of alpha-tocopherol-related KASP markers

[0060] Association analysis and transcriptome analysis verified the function of gene VTE4 in the alpha-tocopherol content of sweet corn kernel tissue. SNP S5_205305125 and SNP S5_205797989 identified by association analysis were significantly associated with alpha-tocopherol content, which was used to screen sweet corn materials with high alpha-tocopherol content. In this embodiment, S5_205305125 (A / G) and SNP S5_205797989 (C / T) in the above SNP sites were developed for KASP markers. KASP primer design was completed by PRIMER-BLAST, a web primer design tool provided by NCBI. Primer synthesis was performed by LGC (Laboratory of the Government Chemist, Hoddeston, UK).

[0061] Primer information is as follows:

[0062] SNP S5_205305125 site KASP marker primer information:

[0063] SEQ ID NO.1:

[0064] gaaggtgaccaagttcatgctCCTGATATGTTTCAAAAACAAACA

[0065] SEQ ID NO.2:

[0066] gaaggtcggagtcaacggattCCTGATATGTTTCAAAAACAAACG

[0067] SEQ ID NO.3:AAAGCTTAACTTGCCAATAATG

[0068] SNP S5_205797989 site KASP marker primer information:

[0069] SEQ ID NO.4: gaaggtgaccaagttcatgctAACATTCAGGTATGTTTTGCSEQ ID NO.5: gaaggtcggagtcaacggattAACATTCAGGTATGTTTTGTSEQ ID NO.6: CCCTTTTACCTGACATTGAC

[0070] The PCR amplification reaction system is shown in Table 2 (96-well white opaque PCR plate, 10.14 μL reaction system). The KASP amplification reaction procedure is shown in Table 3.

[0071] Table 2 KASP PCR reaction system

[0072] Element volume DNA 5μL 2 × KASPMastermix 5μL KBDassaymix 0.14μL Total 10.14μL

[0073] Table 3 KASP amplification reaction program

[0074]

[0075]

[0076] The results of KASP amplification reaction are as follows Figure 8 As shown, the AA allele of the SNP site S5_205305125 (A / G) in the KASP primer has a high alpha-tocopherol content in the sweet corn material and excites FAM fluorescence, while the GG allele of the sweet corn material has a low alpha-tocopherol content and excites HEX fluorescence ( Figure 8 A); CC allele sweet corn materials with high alpha-tocopherol content at SNP site S5_205797989 (C / T) stimulate FAM fluorescence, and TT allele sweet corn materials with low alpha-tocopherol content stimulate HEX fluorescence ( Figure 8 B). The above two SNP loci can be accurately typed by fluorescent quantitative PCR; the KASP primer developed by the present invention has high flexibility and can quickly complete the genotype detection of a small amount or a large amount of sweet corn materials, and can quickly screen sweet corn materials with high alpha-tocopherol content. It has high stability and universality. The application of this marker in the improvement of sweet corn alpha-tocopherol will play an important role in promoting the breeding of high-quality sweet corn.

[0077] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which are all covered by the protection scope of the present invention.

Claims

1. Application of primers for detecting SNP sites on chromosome 5 of sweet corn genome, wherein the sweet corn genome version is B73V4, characterized in that: The invention comprises at least one of the following SNP sites: the first SNP site is located at position 205305125 of chromosome 5 of the sweet corn genome, and the polymorphism is A / G; The second SNP site is located at position 205797989 of chromosome 5 of the sweet corn genome, and the polymorphism is C / T; When the polymorphism of the first SNP site is A, it is identified as a high alpha-tocopherol content in the sweet corn kernels; when the polymorphism is G, it is identified as a low alpha-tocopherol content in the sweet corn kernels; When the polymorphism of the second SNP site is C, it is identified as a high alpha-tocopherol content in the sweet corn kernels; when the polymorphism is T, it is identified as a low alpha-tocopherol content in the sweet corn kernels.

2. The primer according to claim 1, characterized in that: include: Primer for detecting the first SNP site: the first primer as shown in SEQ ID NO: 1; a second primer as shown in SEQ ID NO: 2; a third primer as shown in SEQ ID NO: 3; and primers for detecting the second SNP site: a fourth primer as shown in SEQ ID NO: 4; a fifth primer as shown in SEQ ID NO: 5; and a sixth primer as shown in SEQ ID NO:

6.

3. A kit for detecting the alpha-tocopherol content of sweet corn, characterized in that: Comprising the primer described in claim 2.

4. A method for screening high-yield sweet corn, characterized in that: The following steps are involved: In the early stage of molecular marker-assisted selection breeding (MAS), based on the primers described in claim 2, the genotype of the first SNP site at position 205305125 or the second SNP site at position 205797989 in chromosome 5 of the sweet corn genome of version B73 V4 is identified. When the polymorphism of the first SNP site is A, it is identified as a high alpha-tocopherol content in the sweet corn kernels; when the polymorphism is G, it is identified as a low alpha-tocopherol content in the sweet corn kernels; When the polymorphism of the second SNP site is C, it is identified as a high alpha-tocopherol content in the sweet corn kernels; when the polymorphism is T, it is identified as a low alpha-tocopherol content in the sweet corn kernels.

Images