Method for constructing mouse model of neuronal intranuclear inclusion disease and application thereof

Abstract

The present application provides a method for constructing a mouse model stably expressing neuronal nuclear inclusion disease (NIID) and its use. Specifically, the present application relates to constructing a mouse model expressing NIID disease by means of a lentivirus stably expressing mutant N2C-iso2 protein (PolyG_N2C-iso2) in the brain. The present application also relates to the use of the mouse model in studying the pathogenesis of NIID and developing drugs for treating NIID disease.

Description

Technical Field

[0001] This invention provides a method for constructing a stable mouse model exhibiting neuronal intranuclear inclusion body disease (NIID) and its uses. Specifically, this invention relates to constructing a mouse model exhibiting NIID by stably expressing the mutant N2C-iso2 protein (PolyG_N2C-iso2) in the brain using a lentiviral packaging system. This invention also relates to the use of this mouse model in studying the pathogenesis of NIID and in developing drugs to treat NIID. Background Technology

[0002] Neuronal intranuclear inclusion disease (NIID) is a rare, chronic, progressive neurodegenerative disease, commonly found in Caucasian populations, but more prevalent in Asian adults. NIID is characterized by eosinophilic inclusion bodies in the central and peripheral nervous systems and various visceral organs, often accompanied by varying degrees of neuronal loss. Inclusion bodies are primarily distributed in the central nervous system, peripheral nervous system, and non-neural tissues. The clinical manifestations of NIID are highly heterogeneous depending on the primary site of neuronal loss, and may include dementia, intellectual disability, progressive spasms, seizures, Parkinson's symptoms, peripheral neuropathy, and autonomic dysfunction.

[0003] In 2019, an aberrant 5'UTR GGC repeat amplification in the human-specific NOTCH2NLC gene was found to be associated with NIID. A study by Manon Boivin et al. (Translation of GGC repeat expansions into a toxic polyglycine protein in NIID defines a novel class of human genetic disorders: The polyG diseases) found that the GGC repeat sequence is embedded in a small open reading frame upstream of the NOTCH2NLC gene, encoding the uN2CpolyG protein containing PolyG, which disrupts nucleocytoplasmic transport. Therefore, Manon Boivin et al. believed that the toxicity of the uN2CpolyG protein plays an important role in the pathological mechanism of NIID. However, Manon Boivin et al. also found that European NIID patients with typical p62-positive intranuclear inclusions were all negative for uN2CpolyG staining. Genetic analysis of these individuals showed that their NOTCH2NLC GGC amplification was negative. Similarly, reports indicate that this mutation is negative in most European NIID patients. To date, the pathogenesis of NIID remains unclear in this field.

[0004] Stable and efficient animal models play a crucial role in the study of the pathogenesis of non-invasive disease (NIID) and in drug development. Compared to primates, whose sources are limited, mice with homogeneous genetic backgrounds remain the best subjects for researchers studying NIID. However, there is currently no research targeting the NOTCH2NLC transcript 2, nor have mouse models been obtained that exhibit NIID due to carrying the corresponding mutant protein. Research targeting the NOTCH2NLC transcript 2 will further contribute to exploring the pathogenesis of NIID, thereby providing new ideas and solutions for its treatment. Therefore, there is an urgent need for suitable mouse models as tools to deeply investigate the pathogenesis of NIID and develop corresponding treatment methods.

[0005] This invention solves the above-mentioned problems to a certain extent. Summary of the Invention

[0006] This invention provides a mouse model of GGC duplication amplification disorder associated with the NOTCH2NLC gene, a method for its preparation, and the medicinal uses of the mouse model.

[0007] To achieve the objectives of this invention, the following technical solution is provided:

[0008] In a first aspect, the present invention provides a method for preparing mice suffering from GGC repeat amplification disorder associated with the NOTCH2NLC gene, comprising:

[0009] (a) Selecting NOTCH2NLC transcript 2 as a target, a polynucleotide sequence encoding a GGC sequence (PolyG) rich in 50–200 glycine residues was inserted upstream of exon 1 of the transcript, thereby obtaining a polynucleotide sequence encoding PolyG_N2C-iso2;

[0010] (b) Construct a lentiviral vector plasmid containing the above-mentioned polynucleotide sequences;

[0011] (c) Using a lentivirus packaging system, obtain a lentivirus containing a polynucleotide sequence encoding PolyG_N2C-iso2;

[0012] (d) F0 generation mice were obtained by infecting mice with lentivirus.

[0013] (e) F0 generation mice were mated with wild-type mice to obtain F1 generation mice. F1 generation mice expressing PolyG_N2C-iso2 were selected to obtain mice suffering from GGC repeat amplification disorder associated with NOTCH2NLC gene.

[0014] In one implementation, the GGC duplication amplification disorder associated with the NOTCH2NLC gene is selected from NIID diseases, dementia, Parkinson's disease, essential tremor, multiple system atrophy, Alzheimer's disease, oculopharyngeal myopathy, etc. In a preferred implementation, the GGC duplication amplification disorder associated with the NOTCH2NLC gene is an NIID disease.

[0015] In one implementation, step (a) uses the following primer sequence to obtain the polynucleotide sequence encoding PolyG_N2C-iso2:

[0016] 5′-ggtaccgccaccatgtgga-3′ (SEQ ID No. 2),

[0017] 5′-ccagcatgcctgctatt-3′ (SEQ ID No. 3).

[0018] In one implementation, the polynucleotide sequence in step (a) is codon optimized.

[0019] In one embodiment, PolyG in step (a) contains 80-150 glycine residues, such as 80-130 glycine residues, 90-120 glycine residues, 100-110 glycine residues, such as 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, and 110 glycine residues.

[0020] In one embodiment, the polynucleotide sequence encoding PolyG_N2C-iso2 comprises the sequence shown in SEQ ID NO:1. In another embodiment, the lentiviral vector plasmid comprises the sequence shown in SEQ ID NO:4.

[0021] In one implementation, packaged lentiviral particles are administered to mice via intratestinal administration; in another specific implementation, packaged lentiviral particles are administered to mice via lentiviral injection through the vas deferens or rete testis.

[0022] In one implementation, the mouse may be an adult mouse.

[0023] In one implementation, mice suffering from NIID disease were obtained using the above method.

[0024] In one implementation, a large number of p62-positive inclusion bodies were observed in the nuclei of neurons in the obtained NIID model mice, exhibiting a unique p62 recruitment phenomenon.

[0025] Secondly, the present invention provides a method for screening candidate drugs for the treatment of NIID, comprising:

[0026] (a) Administering the candidate drug to NIID model mice;

[0027] (b) To examine the performance of NIID model mice, especially their neurological manifestations, and related indicators of NIID disease; and

[0028] (c) Compare the index parameters obtained in step (b) with the corresponding indicators of known normal control mice.

[0029] This allows for the identification of useful drug candidates.

[0030] In one embodiment, the present invention provides the use of NIID model mice for studying the pathogenic mechanism of NIID, including:

[0031] (a) Obtaining multi-organ tissue samples and multi-organ pathological sections from model mice;

[0032] (b) The multi-organ tissue samples and pathological sections of the model mice were examined and compared with those of normal mice;

[0033] This leads to an exploration of the pathogenesis of NIID.

[0034] In one embodiment, the present invention provides the use of NIID model mice for evaluating the in vivo efficacy of drugs for treating NIID, including...

[0035] (a) Administering the candidate drug to NIID model mice; and

[0036] (b) Detect relevant NIID levels in the mice.

[0037] If NIID-related indicators are significantly reduced compared to control mice that do not receive the candidate drug, then the candidate drug is considered to be effective in treating NIID.

[0038] In one embodiment, the present invention provides a method for evaluating the efficacy of a candidate drug in treating NIID, comprising:

[0039] (a) Provide NIID model mice;

[0040] (b) Administer the candidate drug to the NIID model mice; and

[0041] (c) Detect the relevant indicators of NIID in the mice.

[0042] If NIID-related indicators are significantly reduced compared to control mice that do not receive the candidate drug, then the candidate drug is considered to be effective in treating NIID.

[0043] In one implementation, the relevant indicators of NIID include phenotypic indicators and pathological indicators. Phenotypic indicators include, for example, cognitive impairment, sensory abnormalities, autonomic dysfunction, ataxia, limb weakness, episodic loss of consciousness, stroke-like episodes, encephalitis-like episodes, etc. Pathological indicators include, for example, the presence of eosinophilic intranuclear inclusion bodies detected by invasive methods such as skin biopsy or autopsy.

[0044] Thirdly, the present invention provides a mouse model of NIID disease, characterized in that a GGC sequence (PolyG) rich in glycine residues is inserted into the upstream non-coding region of exon 1 of the NOTCH2NLC transcript 2 of the mouse.

[0045] In one embodiment, the mouse model has eosinophilic intranuclear inclusion bodies in the brain.

[0046] Fourthly, the present invention provides a polynucleotide encoding PolyG_N2C-iso2, a vector containing a polynucleotide encoding PolyG_N2C-iso2, and a host cell containing the vector.

[0047] In one embodiment, the polynucleotide sequence encoding PolyG_N2C-iso2 comprises the sequence shown in SEQ ID No. 1.

[0048] In one embodiment, the vector comprising the PolyG_N2C-iso2 encoded polynucleotide is a lentiviral vector. In one embodiment, the lentiviral vector comprises the sequence shown in SEQ ID NO:4. Attached Figure Description

[0049] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0050] Figure 1 : Schematic diagram of the Lenti-CMV-PolyG_N2C iso2 constructor.

[0051] Figure 2 : Electrophoresis diagram of the F1 generation transgenic mouse genome.

[0052] Figure 3 : Genome sequencing results of F1 generation transgenic mice.

[0053] Figure 4 : Intranuclear inclusions of neurons found in the brain tissue of F1 generation mice (white arrow). Invention Details

[0054] This invention discloses an animal model suitable for studying GGC repetitive amplification disease associated with the NOTCH2NLC gene, as well as the corresponding disease model mice and their uses in the medical field.

[0055] Unless otherwise defined below, all technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. Furthermore, the materials, methods, and examples described herein are illustrative only and are not intended to be limiting. Other features, objects, and advantages of the invention will become apparent from this specification and the accompanying drawings, and from the appended claims.

[0056] I. Definition

[0057] The term "about" when used in conjunction with a numeric value means to cover a range of numeric values ​​having a lower limit of 5% less than the specified numeric value and an upper limit of 5% greater than the specified numeric value. The term is also intended to cover values ​​within ±1%, ±0.5%, or ±0.1% of the specified numeric value.

[0058] In this document, the terms “comprising” or “including” mean that the stated elements, integers or steps are included, but do not exclude any other elements, integers or steps.

[0059] In this document, the expression “and / or” is used to refer to any one of the listed related items, or any and all possible combinations of multiple listed related items.

[0060] The term "functional connectivity," also known as "effective connectivity," refers to a relationship in which the specified components are in a way that allows them to function in the intended manner.

[0061] The term "sequence homology" is used to describe the sequence structural similarity between two amino acid sequences or polynucleotide sequences. To determine the percentage of identity between two amino acid sequences or two nucleic acid sequences, the sequences can be aligned for optimal comparison purposes (e.g., vacancies can be introduced in one or both of the first and second amino acid sequences or nucleic acid sequences for optimal alignment, or non-homologous sequences can be discarded for comparison purposes). In a preferred embodiment, for comparison purposes, the length of the reference sequence being aligned is at least 30%, preferably at least 40%, more preferably at least 50%, 60%, and even more preferably at least 70%, 80%, 90%, 100% of the reference sequence length. The amino acid residues or nucleotides at the corresponding amino acid or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide at the corresponding position in the second sequence, the molecules are identical at that position.

[0062] Mathematical algorithms can be used to compare sequences and calculate the percentage of identity between two sequences. In a preferred embodiment, the Needlema and Wunsch ((1970) J. Mol. Biol. 48: 444-453) algorithm (available at http: / / www.gcg.com) is used in the GAP program integrated into the GCG software package, employing a Blossum 62 matrix or a PAM250 matrix and vacancy weights of 16, 14, 12, 10, 8, 6, or 4, and length weights of 1, 2, 3, 4, 5, or 6, to determine the percentage of identity between two amino acid sequences. In yet another preferred embodiment, the GAP program in the GCG software package (available at http: / / www.gcg.com) is used, employing an NWSgapdna.CMP matrix and vacancy weights of 40, 50, 60, 70, or 80, and length weights of 1, 2, 3, 4, 5, or 6, to determine the percentage of identity between two nucleotide sequences. The particularly preferred set of parameters (and unless otherwise specified, a set of parameters to be used) is a Blossum 62 scoring matrix with a vacancy penalty of 12, a vacancy extension penalty of 4, and a shift vacancy penalty of 5.

[0063] Alternatively, the PAM120 weighted remainder table, gap length penalty of 12, and gap penalty of 4 can be used to determine the percentage of identity between two amino acid sequences or nucleotide sequences using the E. Meyers and W. Miller algorithm ((1989) CABIOS, 4:11-17) which has been incorporated into the ALIGN program (version 2.0).

[0064] The term "host cell" refers to a cell into which exogenous polynucleotides have been introduced, including progeny cells of this type. In some embodiments, the host cell can be any type of cell system that can be used to produce the viral vector of the present invention, such as mammalian cells.

[0065] The term "regulatory sequence" or "expression control sequence" refers to a nucleic acid sequence that induces, inhibits, or otherwise controls the transcription of a protein encoding a nucleic acid sequence that is effectively linked to it. Regulatory sequences can be, for example, initiation sequences, enhancer sequences, intron sequences, and promoter sequences.

[0066] The terms “exogenous” and “heterogeneous” used to describe nucleic acids or proteins are used interchangeably and refer to nucleic acids or proteins that are not naturally present at the location of their presence on the chromosome or in the host cell. Exogenous nucleic acid sequences also refer to sequences derived from and inserted into the same host cell or subject but existing in a non-natural state; for example, the sequences may exist at different copy numbers or be under the control of different regulatory elements.

[0067] In this document, “isolation” or “purification” of a viral vector means that the viral vector is partially separated from at least some components of the starting material containing it. In some embodiments, the “isolated” viral vector is enriched at least about 10, 100, 1000, 10,000 or more relative to the starting material.

[0068] The term "treatment" refers to a clinical intervention intended to alter the natural course of a disease in an individual undergoing treatment. Desired therapeutic effects include, but are not limited to, preventing the onset or recurrence of disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, slowing the rate of disease progression, improving or mitigating the disease state, and alleviating or improving prognosis.

[0069] II. NOTCH2NLC gene

[0070] The NOTCH2NL gene is a partial duplication of the NOTCH2 gene, stably expressed throughout cerebral cortex development, and promotes cortical neurogenesis through interaction with Notch receptors. The NOTCH2NLC gene is a paralog of the NOTCH2NL gene, expressed only in humans and highly expressed in radial glial cell populations; it is believed to be involved in human brain development, neuronal proliferation, and differentiation. Studies have found that GGC duplication amplification in the 5' untranslated region (UTR) of the NOTCH2NLC gene is associated with neurological disorders such as intranuclear inclusion body disease (NIID), essential tremor, dementia, Alzheimer's disease, Parkinson's disease, and peripheral neuropathy.

[0071] Nucleotide repeat amplification disorders (NREDs) are a heterogeneous group of diseases that primarily affect the nervous system and lead to neurodegenerative changes. The pathogenesis of these diseases is closely related to the nucleotide repeat units, the number of repeat amplifications, the composition of the repeat sequences, the gene they reside in, and their location within the gene. In 2019, GGC repeat amplification in the NOTCH2NLC gene was found to be associated with NIIDs. Subsequently, GGC repeat amplification was found to be associated with various neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, multiple system atrophy, and frontotemporal dementia. Therefore, in current technology, the various neurological diseases associated with GGC repeat amplification in the 5'UTR of the NOTCH2NLC gene are collectively referred to as NOTCH2NLC-associated GGC repeat amplification disorders.

[0072] The NOTCH2NLC gene has two mRNA transcript isotypes: transcript 1 (NM_001364012.2), which is the physiologically dominant transcript, and transcript 2 (NM_001364013.2). GGC repeat sequences can occur in the 5' UTR of each transcript. Existing techniques have been used to study transcript 1, but no research has been conducted on transcript 2.

[0073] III. Intranuclear Inclusion Disease (NIID)

[0074] Intranuclear inclusion body disease (NIID) is a rare, chronic, progressive neurodegenerative disease characterized by eosinophilic hyaline inclusions in the central and peripheral nervous systems and visceral organs. Recent studies have revealed that the NOTCH2NLC gene participates in the pathogenesis of NIID by amplifying the CGG repeat in the 5' untranslated region of transcript 1 to produce the polyglycine (polyG) toxic protein uN2CpolyG. Furthermore, high methylation of CpG islands in the NOTCH2NLC gene has been found in some NIID patients.

[0075] It is evident that CGG repeat sequences and their length, DNA methylation levels, and other factors are related to the pathogenicity of NIID. Currently, further elucidation of the pathogenic mechanism of NIID is needed to facilitate the development of corresponding therapeutic drugs.

[0076] IV. Lentiviral vectors

[0077] In this paper, the term "viral vector" refers to a viral particle (e.g., a lentiviral particle) that can serve as a delivery vehicle for a target nucleic acid. Typically, a viral vector contains a capsid and a viral genome (e.g., viral DNA) packaged therein, with the target nucleic acid to be delivered inserted into the viral genome.

[0078] In one embodiment, the gene delivery system used in this application is a viral vector, such as a lentiviral vector (e.g., a lentiviral vector derived from HIV-1, HIV-2, SIV, BIV, FIV, etc.).

[0079] Lentiviral vectors are a class of viral vectors developed based on the lentiviral genome, by modifying the elements of the lentivirus itself, and capable of carrying foreign genes. Lentivirals can effectively infect both dividing and non-dividing cells, thus having many unique advantages in gene transfection. For example, lentiviral vectors can accommodate large gene fragments, can stably integrate the carried genes into the genome, and have a wide range of hosts.

[0080] Current recombinant lentiviral vectors typically retain only packaging signals and target gene transcription elements within the lentiviral genome, while other structural genes such as reverse transcription, envelope protein VSVG, and gag-pol are dispersed across 2-3 vectors. In one embodiment, the lentiviral vector system used in this application is a four-plasmid system.

[0081] In one aspect, the present invention provides a recombinant lentiviral vector, wherein the recombinant lentiviral vector comprises in its genome:

[0082] a.5' and 3' LTR sequences, and

[0083] b. An expression construct located between the 5' and 3' LTRs, wherein the expression construct contains the following elements functionally linked to each other in the transcriptional direction:

[0084] -Any CMV promoter according to the present invention

[0085] - A polynucleotide encoding PolyG_N2C-iso2,

[0086] - A transcription terminator, such as a polyA signal sequence, preferably selected from the SV40 late polyA sequence, the rabbit β-globin polyA sequence, the bovine growth hormone polyA sequence, or any variant thereof.

[0087] V. Preparation of recombinant slow vectors

[0088] Existing technologies have relatively mature packaging systems for lentiviral vectors, with the four-plasmid system being commonly used. The recombinant lentiviral vector of this invention can be produced using any suitable method known in the art. In one embodiment, the recombinant lentiviral vector of this invention is produced by co-transfecting multiple vectors into 293T cells, packaging them intracellularly to form mature lentiviral particles, which are then secreted by the 293T cells into the culture supernatant. These mature lentiviral particles can be harvested by ultracentrifugation or chromatography purification. Example

[0089] This invention discloses an animal model suitable for studying GGC repetitive amplification disease associated with the NOTCH2NLC gene. The invention is further illustrated below with reference to embodiments. It is particularly important to note that all similar substitutions and modifications will be obvious to those skilled in the art and are considered to be included in this invention. Unless otherwise specified, all reaction reagents and experimental materials involved in the embodiments are commercially available, and all experimental methods are conventional methods in the art using default parameters and procedures. For specific techniques or conditions not specified in the embodiments, those skilled in the art can perform them according to the techniques or conditions described in existing literature or according to the corresponding product instructions.

[0090] Example 1. Construction of Lentil-D PolyG_N2C-iso2 vector

[0091] 1. Obtain the polynucleotide encoded by PolyG_N2C-iso2.

[0092] The human NOTCH2NLC gene transcription variant 2 (NM_001364013.2) encodes a 293-amino acid protein sequence (N2C-iso2, also known as NOTCH2NLC iso2), which is translated starting from exon 1 of the NOTCH2NLC gene. In this embodiment, a coding sequence containing 108 glycine-rich GGC residues was inserted upstream of exon 1 of the NOTCH2NLC gene to obtain an N2C-iso2 protein containing the amplified GGC sequence, referred to as PolyG_N2C-iso2 or PolyG_NOTCH2NLC iso2, where PolyG represents the amplified GGC sequence. The coding codon was optimized using GGN, thereby obtaining the DNA sequence encoding PolyG_N2C-iso2 (SEQ ID No. 1) for experimental use. Kpn I and EcoRI enzyme recognition sites were added to both ends of this sequence, and the DNA sequence was then synthesized by Qingke Biotechnology Co., Ltd. After sequencing verification, the DNA sequence was cloned into the PUC57 vector to generate the PUC57-PolyG_N2C-iso2 vector. The control vector was the PUC57-N2C-iso2 vector without PolyG.

[0093] 2. Construct a lentiviral packaging vector containing PolyG_N2C-iso2 polynucleotides.

[0094] Using the PUC57-PolyG_N2C-iso2 vector as a template, the PolyG_N2C-iso2 fragment from the PUC57-PolyG_N2C-iso2 vector was cloned into a lentiviral packaging vector using PCR amplification. This allowed the PolyG_N2C-iso2 fragment to be regulated by the CMV promoter in the vector and its transcription to be blocked by BGH polyA, thus obtaining the corresponding lentiviral packaging vector Lenti-CMV-PolyG_N2C iso2, also known as pLenti6 / v5-PolyG_N2C iso2. (See schematic diagram below.) Figure 1 As shown.

[0095] The primer sequences for amplifying the PolyG_N2C-iso2 fragment are as follows:

[0096] 5′-ggtaccgccaccatgtgga-3′ (SEQ ID No. 2),

[0097] 5′-ccagcatgcctgctatt-3′ (SEQ ID No. 3).

[0098] The PCR amplification program used was as follows: 33 cycles of 95℃ for 30s, 58℃ for 15s, and 72℃ for 10s.

[0099] 3. Packaging and harvesting of lentiviral particles with high infectivity rates

[0100] (1) Take 293T cells in the logarithmic growth phase (cell density 5×10⁻⁶). 6 Cells were seeded in 15cm diameter cell culture dishes containing 25ml of antibiotic-free DMEM medium supplemented with 10% (v / v) FBS and cultured at 37°C under 5% carbon dioxide conditions.

[0101] (2) Preparation of four plasmid DNA solutions for the lentiviral packaging system:

[0102] Using the four-plasmid packaging system (Life Technologies), plasmid DNA was prepared according to the instructions. The plasmid was added to sterile water and brought to a final volume of 1800 μL. Then, 200 μL of calcium chloride solution (2.5 mol / L) was added, mixed well, and 2000 μL of 2×PBS buffer solution was added. The mixture was then incubated at room temperature for 20-30 min.

[0103] (3) Transfection is performed when the cell density reaches 60%-70%. The DNA solution and calcium phosphate mixture prepared in step (2) is transferred to the cell culture dish containing monolayer cells obtained in step (1), mixed well, cultured for 12 h, and then the culture medium is discarded. The cells are washed three times with 15 mL PBS solution.

[0104] (4) Add 15 mL of DMEM cell culture medium containing 10% FBS to the cell culture dish and continue culturing for 48 h;

[0105] (5) Collect the cell supernatant after 72 hours of transfection, centrifuge at 400g for 10 minutes at 4℃, and take the upper culture medium and discard the lower cell pellet.

[0106] (6) The collected supernatant was filtered through a 0.45 μm filter, and the filtrate was centrifuged in a 40 ml ultracentrifuge tube at 4 °C and 20,000 rpm for 3 h to purify LV virus. The virus precipitate was harvested, resuspended in PBS buffer, aseptically filtered, aliquoted, and frozen. The virus titer was detected by RT-PCR, indicating that the harvested virus titer met the requirements for further experiments.

[0107] Example 2. Preparation of a transgenic mouse model

[0108] 1. Strain selection and treatment

[0109] Male C57BL / 6J mice (7 weeks old) and female C57BL / 6J mice (1.5-2 months old) (commercially available) were selected. All mice had free access to water and food, and were housed and bred in a sterile environment with controlled temperature (25±5℃) and humidity (30-70%) for 14 hours each night. Eight 7-week-old (24±1g) male mice were used to prepare the F0 generation.

[0110] 2. Preparation of F0 generation mice

[0111] The germ cells of male mice are capable of self-renewal and differentiation into mature sperm, and are the only cells in adult males that can pass on genetic information to the next generation, thus making them a favorable method for transgenic manipulation. This application describes the preparation of transgenic mice carrying the PolyG_N2C-iso2 encoding gene by infecting germ cells in the testicular tissue of adult male mice with lentivirus.

[0112] For 7-week-old mice, avertin (400 μL / 30 g body weight) was administered intraperitoneally for anesthesia. A 0.3–0.5 cm incision was made in the skin and muscle anterior to the penis using sterile ophthalmic scissors. With the aid of sterile dressing forceps, the testis was gently removed from the intestine or scrotum, and the dorsal fat pad was pulled out. To illustrate the effect at the injection site, the lentiviral particles were resuspended in PBS buffer (Life Technology) containing trypan blue (0.04%). Lentiviral virus was injected via the vas deferens or rete testis under a stereomicroscope. Each injection used 5.5 × 10⁻⁶ ppm. 6 Five microliters of lentiviral particles with a concentration of TU / mL were used to obtain F0 generation mice.

[0113] 3. F1 generation mouse preparation

[0114] F0 generation mice were mated with mature wild-type female mice of the same strain (1.5-2 months old) 5 or 6 weeks after surgery to produce F1 generation. The newborn F1 pups were then genotyped by PCR. Since the NOTCH2NLC gene is expressed only in humans and is not present in the mouse genome, N2C-iso2 specific primers were used to genotype the obtained F1 generation mice. Only mice exhibiting the N2C iso2 specific band were considered transgenic F1 generation.

[0115] The genome was obtained from the tail of F1 generation mice using conventional methods, and the presence of the N2C-iso2 fragment was detected by PCR. The primer sequences used are as follows:

[0116] 5'-CTCATGTCCAACATTACCGC-3'(SEQ ID No.5)

[0117] 5'-CTTCTCGGTCCCCTCCAC-3'(SEQ ID No.6)

[0118] The procedure used for PCR amplification is as follows:

[0119] The loop program is 95℃ for 30s, 58℃ for 15s, and 72℃ for 10s, with 33 loops. The expected fragment size is approximately 1K.

[0120] The obtained PCR products were subjected to agarose gel electrophoresis. The results are as follows: Figure 2 As shown, F1-1, F1-2, F1-4, and F1-7 have positive bands of about 1K.

[0121] The PCR products corresponding to the positive bands were sequenced, and the results are as follows: Figure 3 As shown, the amplification product is 100% homologous to the target sequence PolyG_N2C-iso2 encoding gene. Therefore, this embodiment obtained transgenic F1 mice containing the PolyG_N2C-iso2 encoding gene.

[0122] Example 3. Pathological characteristics of F1 generation mice

[0123] F1 generation mice carrying the PolyG_N2C-iso2 encoding gene and wild-type mice were euthanized after 3 months of rearing, and brain tissue was collected and embedded in glycosylation. After 48 hours, the tissue was fixed in cryopreservative and frozen sectioned. Immunofluorescence staining was then performed on the tissue sections. The tissue sections were fixed with 70% FAA fixative and incubated at room temperature for 10 minutes. Then, the solution was replaced with PBST containing 0.5% Triton X-100 and permeabilized at room temperature for 30 minutes. The permeabilization solution was then replaced with PBST containing 10% goat serum for blocking at room temperature for 1 hour. After blocking, NOTCH2NLC antibody (Abbexa, Abx167908) and P62 antibody (Abcam, Ab240635) were added at a 1:200 ratio to the blocking solution and incubated overnight at 2–8°C. The next day, the tissue was washed three times with PBST for 15 minutes each time. The antibody was then replaced with goat anti-rabbit 549-Dylight labeled IgG antibody (1:200), incubated at room temperature for 30 min, washed three times with PBST for 20 min each time. Anti-quenching mounting medium (containing DAPI) was added, the slide was mounted, and observed under a microscope.

[0124] The results are as follows Figure 4As shown, inclusion bodies are visible in the neuronal cell nuclei (indicated by the white arrows in the figure), and these inclusion bodies are positive for both p62 and NOTCH2NLC, exhibiting fluorescent co-localization of anti-p62 and anti-NOTCH2NLC antibodies. This phenomenon is not observed in wild-type mice, thus proving that this application has obtained mice with NIID disease caused by PolyG_N2C-iso2 protein.

[0125] Therefore, this application has yielded transgenic mice expressing eosinophilic inclusion bodies in the brain, thus creating a mouse model of NIID disease. This model can be preserved and propagated for research into the pathogenesis of NIID disease and for drug development.

[0126] sequence list

[0127] SEQ ID No. 1: DNA sequence encoding PolyG_N2C-iso2

[0128] ATGTGGATCTGCCCAGGAGGTGGAGGCGGAGGTGGAGGAGGTGGAGGCGGAGGCGGTGGAGG

[0129] TGGAGGTGGTGGAGGCGGAGGGGGTGGTGGCGGTGGTGGGGGGGGAGGTGGAGGTGGAGGTG

[0130] GCGGAGGTGGAGGTGGCGGTGGCGGTGGAGGTGGAGGTGGTGGAGGTGGTGGAGGAGGGGGT

[0131] GGAGGTGGAGGCGGAGGGGGAGGTGGAGGTGGAGGCGGAGGCGGAGGTGGTGGTGGCGGCG

[0132] GTGGCGGTGGAGGGGGAGGTGGAGGGGGAGGAGGTGGGGGAGGTGGAGGGGGAGGAGGAG

[0133] GTGGAGGGGGAGGGGGAGGAGGAGGTGGAGGGGACCGAGAAGATGCCCGCCCTGCGCCGCTC

[0134] TGCTGTGGGCGCTGCTGGCGCTCTGGCTGTGCTGCGCGACCCCCGCGCATGTGTCGAGATGGCTATG

[0135] AACCCTGTGTAAATGAAGGAATGTGTGTTACCTACCACAATGGCACAGGATACTGCAAATGTCCAGAA

[0136] GGCTTCTTGGGGGAATATTGTCAACATCGAGACCCCTGTGAGAAGAACCGCTGCCAGAATGGTGGG

[0137] ACTTGTGTGGCCCAGGCCATGCTGGGGAAAGCCACGTGCCGATGTGCCTCAGGGTTTACAGGAGAG

[0138] GACTGCCAGTACTCGACATCTCATCCATGCTTTGTGTCTCGACCTTGCCTGAATGGCGGCACATGCCAT

[0139] ATGCTCAGCCGGGATACCTATGAGTGCACCTGTCAAGTCGGGTTTACAGGTAAGGAGTGCCAATGGA

[0140] CCGATGCCTGCCTGTCTCATCCCTGTGCAAATGGAAGTACCTGTACCACTGTGGCCAACCAGTTCTCC

[0141] TGCAAATGCCTCACAGGCTTCACAGGGCAGAAGTGTGAGACTGATGTCAATGAGTGTGACATTCCA

[0142] GGACACTGCCAGCATGGTGGCACCTGCCTCAACCTGCCTGGTTCCTACCAGTGCCAGTGCCTTCAGG

[0143] GCTTCACAGGCCAGTACTGTGACAGCCTGTATGTGCCCTGTGCACCCTCGCCTTGTGTCAATGGAGG

[0144] CACCTGTCGGCAGACTGGTGACTTCACTTTTGAGTGCAACTGCCTTCCAGAAACAGTGAGAAGAG

[0145] GAACAGAGCTCTGGGAAAGAGACAGGGAAGTCTGGAATGGAAAAGAACACGATGAGAATTAATAGSEQID No. 2: Primer sequence for amplifying PolyG_N2C iso2 (forward direction)

[0146] ggtaccgccaccatgtgga

[0147] SEQ ID No. 3: Primer sequence for amplifying PolyG_N2C iso2 (reverse)

[0148] ccagcatgcctgctatt

[0149] SEQ ID NO:4: The polynucleotide sequence of the lentiviral vector Lenti-CMV-PolyG_N2C iso2 containing the polynucleotide encoding PolyG_N2C iso2:

[0150]

[0151] ACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCT

[0152] TGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGT

[0153] GCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCA

[0154] GCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAA

[0155] ACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACGACCT

[0156] GGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAG

[0157] AAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTG

[0158] GTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGA

[0159] GTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCTCGAGGAGCTTGCCATTGCAT

[0160] ACGTTGTATCCATATCATAATATGTACATTTATATTGGCTCATGTCCAACATTACCGCCATGTTGACATTGATTATTGACTAG

[0161] TTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGC

[0162] CCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGA

[0163] CTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGT

[0164] ACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACT

[0165] TGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGG

[0166] TTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACT

[0167] TTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAG

[0168] AGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGA

[0169] TCCAGCCTCCCCGGCTAGAGCTTCCCGGGGGTACCGCCACCATGTGGATCTGCCCAGGAGGTGGAGGCGGAGGTGGAG

[0170] GAGGTGGAGGCGGAGGCGGTGGAGGTGGAGGTGGTGGAGGCGGAGGGGGTGGTGGCGGTGGTGGGGGGGGAGGTG

[0171] GAGGTGGAGGTGGCGGAGGTGGAGGTGGCGGTGGCGGTGGAGGTGGAGGTGGTGGAGGTGGTGGAGGAGGGGGTGG

[0172] AGGTGGAGGCGGAGGGGGAGGTGGAGGTGGAGGCGGAGGCGGAGGTGGTGGTGGCGGCGGTGGCGGTGGAGGGGG

[0173] AGGTGGAGGGGGAGGAGGTGGGGGAGGTGGAGGGGGAGGAGGAGGTGGAGGGGGAGGGGGAGGAGGAGGTGGAG

[0174] GGGACCGAGAAGATGCCCGCCCTGCGCCGCTCTGCTGTGGGCGCTGCTGGCGCTCTGGCTGTGCTGCGCGACCCCCGC

[0175] GCATGTGTCGAGATGGCTATGAACCCTGTGTAAATGAAGGAATGTGTGTTACCTACCACAATGGCACAGGATACTGCAA

[0176] ATGTCCAGAAGGCTTCTTGGGGGAATATTGTCAACATCGAGACCCCTGTGAGAAGAACCGCTGCCAGAATGGTGGGAC

[0177] TTGTGTGGCCCAGGCCATGCTGGGGAAAGCCACGTGCCGATGTGCCTCAGGGTTTACAGGAGAGGACTGCCAGTACTC

[0178] GACATCTCATCCATGCTTTGTGTCTCGACCTTGCCTGAATGGCGGCACATGCCATATGCTCAGCCGGGATACCTATGAGT

[0179] GCACCTGTCAAGTCGGGTTTACAGGTAAGGAGTGCCAATGGACCGATGCCTGCCTGTCTCATCCCTGTGCAAATGGAAG

[0180] TACCTGTACCACTGTGGCCAACCAGTTCTCCTGCAAATGCCTCACAGGCTTCACAGGGCAGAAGTGTGAGACTGATGTC

[0181] AATGAGTGTGACATTCCAGGACACTGCCAGCATGGTGGCACCTGCCTCAACCTGCCTGGTTCCTACCAGTGCCAGTGCC

[0182] TTCAGGGCTTCACAGGCCAGTACTGTGACAGCCTGTATGTGCCCTGTGCACCCTCGCCTTGTGTCAATGGAGGCACCTG

[0183] TCGGCAGACTGGTGACTTCACTTTTGAGTGCAACTGCCTTCCAGAAACAGTGAGAAGAGGAACAGAGCTCTGGGAAA

[0184] GAGACAGGGAAGTCTGGAATGGAAAAGAACACGATGAGAATTAATAGGAATTCGTCGACAGATCTGCCTCGACTGTGC

[0185] CTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTT

[0186] TCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACA

[0187] GCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGATCCGACCTTGTGCAGAA

[0188] CTCGTGGTGCTGGGCACTGCTGCTGCTGCGGCAGCTGGCAACCTGACTTGTATCGTCGCGATCGGAAATGAGAACAGG

[0189] GGCATCTTGAGCCCCTGCGGACGGTGCCGACAGGTGCTTCTCGATCTGCATCCTGGGATCAAAGCCATAGTGAAGGACA

[0190] GTGATGGACAGCCGACGGCAGTTGGGATTCGTGAATTGCTGCCCTCTGGTTATGTGTGGGAGGGCTAAGCACAATTCGA

[0191] GCTCGGTACCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGA

[0192] AGGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCT

[0193] GGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGC

[0194] CCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTAGTAGTT

[0195] CATGTCATCTTATTATTCAGTATTTATAACTTGCAAAGAAATGAATATCAGAGAGTGAGAGGAACTTGTTTATTGCAGCTT

[0196] ATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGT

[0197] CCAAACTCATCAATGTATCTTATCATGTCTGGCTCTAGCTATCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCC

[0198] CAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCT

[0199] ATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGGACGTACCCAATTCGCCCTATAGTGAGTCGTATTACGCGCG

[0200] CTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCC

[0201] CCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAAT

[0202] GGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCG

[0203] CCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGG

[0204] GGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGT

[0205] GGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAAC

[0206] TGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAA

[0207] TGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTAGGTGGCACTTTTCGGGGAAA

[0208] TGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATG

[0209] CTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGC

[0210] CTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACA

[0211] TCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAA

[0212] AGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGA

[0213] ATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGC

[0214] CATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTG

[0215] CACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGT

[0216] GACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGC

[0217] AACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTAT

[0218] TGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGT

[0219] ATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCAC

[0220] TGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAG

[0221] GATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACC

[0222] CCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACC

[0223] GCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAG

[0224] ATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGC

[0225] TCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTAC

[0226] CGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAA

[0227] CTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGC

[0228] GGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTT

[0229] CGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCG

[0230] GCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACC

[0231] GTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAG

[0232] CGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCC

[0233] CGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTT

[0234] ATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGC

[0235] CAAGCGCGCAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTT

[0236] SEQ ID NO:5: N2C-iso2 specific primer (forward)

[0237] TCTATATAAGCAGAGCTCGTTT

[0238] SEQ ID NO:6: N2C-iso2 specific primer (reverse)

[0239] CTTCTCGGTCCCCTCCAC

Claims

1. A method for preparing a mouse model suffering from GGC repeat amplification disorder associated with the NOTCH2NLC gene, comprising: (a) Select NOTCH2NLC gene transcript 2 as the target and insert a polynucleotide sequence encoding a GGC sequence (PolyG) rich in 50-200 glycine residues upstream of exon 1 of NOTCH2NLC gene transcript 2 to obtain the polynucleotide sequence encoding PolyG_N2C-iso2; (b) Construct a lentiviral vector plasmid containing the above-mentioned polynucleotide sequence; (c) Using a lentivirus packaging system, obtain a lentivirus containing a polynucleotide sequence encoding PolyG_N2C-iso2; (d) F0 generation mice were obtained by infecting mice with lentivirus. (e) F0 generation mice were crossed with wild-type mice to obtain F1 generation mice. F1 generation mice expressing PolyG_N2C-iso2 were selected to obtain mice suffering from GGC repeat amplification disorder associated with the NOTCH2NLC gene. The polynucleotide sequence was obtained by amplification using the primers shown in SEQ ID NO: 2 and SEQ ID NO:

3. The lentiviral vector plasmid contains the sequence shown in SEQ ID NO:

1. Among them, GGC duplication impairment associated with the NOTCH2NLC gene is a NIID disease.

2. The method of claim 1, wherein PolyG comprises 80-150 glycine residues.

3. The method of claim 2, wherein PolyG comprises 80-130 glycine residues, or 90-120 glycine residues, or 100-110 glycine residues.

4. The method of any one of claims 1-3, wherein the polynucleotide sequence is codon optimized.

5. The method of any one of claims 1-3, wherein the lentiviral vector plasmid comprises the sequence shown in SEQ ID NO:

4.

6. The method of any one of claims 1-3, wherein the packaged lentiviral particles are administered to mice via intratestinal administration.

7. The method of claim 6, wherein packaged lentiviral particles are administered to mice by injecting lentiviral via the vas deferens or rete testis.

8. A method for screening candidate drugs for effective treatment of NIID disease, comprising: (a) A mouse model of GGC duplication impairment associated with the NOTCH2NLC gene, obtained by administering the candidate drug to any of the methods of claims 1-7; (b) Detect the performance of the model mice, including neurological manifestations and indicators related to NIID disease; and (c) The index parameters obtained in step (b) are compared with the corresponding indexes of known normal control mice to identify effective candidate drugs.

9. A method for evaluating the efficacy of a candidate drug in treating NIID disease, comprising: (a) The candidate drug is administered to a mouse model of GGC duplication impairment associated with the NOTCH2NLC gene, obtained by the method of any one of claims 1-7; (b) Detecting relevant indicators of NIID disease in model mice, If the relevant indicators of NIID disease are significantly reduced compared with control NIID mice that do not receive the candidate drug, then the candidate drug is effective in treating NIID.

10. The method of claim 8 or 9, wherein the relevant indicators of NIID disease include phenotypic indicators and pathological indicators, the phenotypic indicators including cognitive impairment, sensory abnormalities, autonomic dysfunction, ataxia, limb weakness, episodic loss of consciousness, stroke-like episodes, encephalitis-like episodes, and the pathological indicators including the presence of eosinophilic intranuclear inclusion bodies detected by invasive methods such as skin biopsy or autopsy.

11. The use of a mouse model of NIID disease obtained by the method of any one of claims 1-7 in studying the pathogenesis of NIID or in evaluating the in vivo efficacy of drugs for treating NIID.

Images