Method for constructing a mouse model selectively knocking out integrin alpha 5 molecules in fibroblasts
By constructing a mouse model that selectively knocks out integrin α5 molecules in fibroblasts, we have solved the research challenges of intestinal fibrosis in IBD, provided a drug screening tool, and gained a deeper understanding of the function of integrin α5 in inflammation and tumor progression.
Patent Information
- Application Number
- CN202510148849.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-11
- Publication Date
- 2026-06-12
- Estimated Expiration
- 2045-02-11
Smart Images

Figure CN119856706B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of mouse model construction technology, specifically relating to a method for constructing a mouse model that selectively knocks out integrin α5 molecules in fibroblasts and its application. Background Technology
[0002] Intestinal fibrosis is a common complication of inflammatory bowel disease (IBD), characterized by excessive deposition of extracellular matrix (ECM). Currently, there is no effective treatment to prevent or repair the progression of fibrosis. Fibroblasts are the main source of ECM and can also participate in regulating the inflammatory response and tissue fibrosis during the development of IBD by interacting with immune cells.
[0003] The fibrotic matrix is a highly dynamic environment, and many key intercellular and cell-matrix interactions are mediated by members of the integrin family. Previous reports on integrin α5 have primarily focused on cancer cells and vascular endothelial cells. Recent published research shows that integrin α5 is mainly expressed in intestinal fibroblasts, and it primarily influences tumor growth by regulating ECM remodeling and affecting T cell infiltration. It is an independent prognostic factor for colorectal adenocarcinoma, suggesting a potential therapeutic approach targeting integrin α5 in combination with immunotherapy to inhibit colorectal cancer growth. However, the function of integrin α5 in fibroblasts during inflammatory bowel disease remains unclear. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to provide a method for constructing a mouse model that selectively knocks out integrin α5 molecules in fibroblasts and its application, which addresses the shortcomings of the prior art. The mouse model constructed by this method using a mouse model that selectively knocks out integrin α5 molecules in fibroblasts can be used for IBD progression research, providing an animal model basis for exploring the role and mechanism of integrin α5 molecules in the progression of intestinal fibrosis in IBD.
[0005] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is: a method for constructing a mouse model by selectively knocking out integrin α5 molecules in fibroblasts, the method being as follows:
[0006] S1, Integrin α5 knockout mice (α5 Flox / Flox The hybrid mice were crossed with fibroblast tool mice (Col1a2-CreERT) to obtain the F1 generation of hybrid mice. The F1 generation of hybrid mice was then self-crossed to obtain the F2 generation of hybrid mice.
[0007] S2. Construct primers to identify the genotypes of the F2 generation of hybrid mice obtained in S1, and screen for mice that are simultaneously positive, naming them α5.Flox / Flox Col1a2-CreERT mice;
[0008] The primers used in the genotype identification were primer set A and primer set B;
[0009] The primer set A consists of primers P1 and P2;
[0010] The primer set B consists of primers P3, P4, P5 and P6;
[0011] The nucleotide sequence of primer P1 is shown in SEQ ID NO:1;
[0012] The nucleotide sequence of primer P2 is shown in SEQ ID NO:2;
[0013] The nucleotide sequence of primer P3 is shown in SEQ ID NO:3;
[0014] The nucleotide sequence of primer P4 is shown in SEQ ID NO:4;
[0015] The nucleotide sequence of primer P5 is shown in SEQ ID NO:5;
[0016] The nucleotide sequence of primer P6 is shown in SEQ ID NO:6;
[0017] α5 obtained from S3 and S2 Flox / Flox After adulthood, Col1a2-CreERT mice were injected intraperitoneally with tamoxifen for 5 consecutive days to induce Cre recombinase expression, resulting in α5-CKO mice with selective knockout of integrin α5 molecules in fibroblasts.
[0018] The present invention also provides the application of α5-CKO mice, which selectively knock out integrin α5 molecules in fibroblasts, constructed by the above-described mouse model construction method, wherein the α5-CKO mice are used to construct a mouse model of inflammatory bowel disease (IBD).
[0019] Preferably, the IBD mouse model provides an animal model basis for studying the role and mechanism of integrin α5 molecules in the progression of intestinal fibrosis in IBD, or can be used to prepare drugs for inflammatory bowel disease.
[0020] Compared with the prior art, the present invention has the following advantages:
[0021] 1. This invention successfully constructed a model animal for selectively knocking out integrin α5 molecules in fibroblasts. Before tamoxifen treatment, integrin α5 expression was normal in this model; after tamoxifen induction, integrin α5 expression was absent in fibroblasts. This model can be used for in vivo functional studies of integrin α5 protein in fibroblasts and its role in fibrosis progression in diseases such as inflammatory bowel disease and liver-lung related diseases. The establishment and application of this animal model will contribute to a deeper understanding of the role of fibroblasts in inflammation and tumor progression, particularly how integrin α5 protein regulates fibroblast function and its importance as a potential therapeutic target.
[0022] 2. The animal models prepared using this invention can be used for drug screening and efficacy studies targeting integrin α5, as well as for applications in immune-related diseases and oncology drugs, accelerating the new drug development process, saving time and costs, and reducing drug development risks. They are also useful for research on the progression of fibrotic diseases, such as intestinal fibrosis during intestinal inflammation and tumor progression, and fibrosis related to liver and lung tumor progression; providing a powerful tool for studying the function of integrin α5 protein and screening for oncology drugs.
[0023] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments. Attached Figure Description
[0024] Figure 1 This relates to the establishment of fibroblast-specific knockout α5-deficient mice (α5-CKO) in Example 1 of this invention. Figure 1 (A) Schematic diagram of the establishment process of α5-CKO mice. (B) Genotyping of F2 generation mice from (A). The above image on the nucleic acid electrophoresis gel shows the identification of α5-CKO mice using primers P1 and P2 PCR. Flox / Flox Genotype. The image below shows the Col1a2-CreERT genotype of mice identified by PCR using primers P3, P4, P5, and P6. A list shows the genotype identification results for six of these mice.
[0025] Figure 2 This refers to the tolerance of α5-CKO mice in Example 2 of this invention to DSS-induced acute intestinal inflammation. Figure 2 (A) Establishment of a DSS-induced acute enteritis mouse model. (B) Changes in mouse body weight. (C) Statistical analysis of enteritis incidence score (Disease Activity Index, DAI) in mice after DSS treatment. (D) Macroscopic examination of intestinal pathological changes in mice after DSS treatment. (E) Statistical analysis of colon length in mice after DSS treatment. (F) H&E staining of the distal colon in mice after DSS treatment. (G) Histological score of colon in mice after DSS treatment. Detailed Implementation
[0026] Example 1
[0027] The method and procedure for constructing a mouse model (α5-CKO) with selective knockout of integrin α5 molecules in fibroblasts in this embodiment ( Figure 1 A) Includes the following steps:
[0028] 1) Shanghai Southern Model Biotechnology Co., Ltd. purchased conditional integrin α5 knockout mice (α5 Flox / Flox The Jackson Laboratory purchased Col1a2-CreERT (fibroblast tool mice); constructed primers, and used PCR technology to identify the genotypes of the two mouse types respectively.
[0029] 2) The two types of mice were crossed to obtain the F1 generation of hybrid mice. The F1 generation of hybrid mice was then self-crossed to obtain the F2 generation of hybrid mice.
[0030] 3) Construct primers to identify the genotypes of the F2 generation of hybrid mice and screen for hybrid mice with selective knockout of integrin α5 in fibroblasts (α5 Flox / Flox (Col1a2-CreERT).
[0031] Genotyping of mice with the two genotypes mentioned above and their hybrid offspring was performed using primer set A and primer set B, respectively. Mice that tested positive for both primer set A and primer set B were identified as α5 mice. Flox / Flox Col1a2-CreERT mice;
[0032] Primer set A consists of primers P1 and P2, and primer set B consists of primers P3, P4, P5, and P6.
[0033] The nucleotide sequence of primer P1 is TCCGACTACTTTTCCGAGCG (SEQ ID NO:1).
[0034] The nucleotide sequence of primer P2 is CTCCCAGAGGCGAATGACTC (SEQ ID NO:2).
[0035] The nucleotide sequence of primer P3 is CAGGAGGTTTCGACTAAGTTGG (SEQ ID NO:3,
[0036] The nucleotide sequence of primer P4 is CATGTCCATCAGGTTCTTGC (SEQ ID NO:4).
[0037] The nucleotide sequence of primer P5 is AGTGGCCTCTTCCAGAAATG (SEQ ID NO:5).
[0038] The nucleotide sequence of primer P6 is TGCGACTGTGTCTGATTTCC (SEQ ID NO:6).
[0039] 4) In the offspring of hybrid animals, the cre recombinase will be expressed in fibroblasts activated by the Col1a2 promoter and recognize the loxp site in the fluxed α5 gene. After the offspring of hybrid animals reach adulthood, they will be injected intraperitoneally with tamoxifen for 5 consecutive days. This will fuse the ligand-binding region of the estrogen receptor with the cre recombinase to produce a chimeric recombinase, which will enter the nucleus and exert its function, thereby specifically knocking out α5 in fibroblasts (α5-CKO mice).
[0040] (I) Extraction of mouse genomic DNA
[0041] 1) Cut off the mouse tail (about 0.5cm in length), put it into a 1.5mL centrifuge tube and put the cap on.
[0042] 2) Add 0.5 mL of lysis buffer (purchased from Thermo Fisher Scientific) and 50 μL of proteinase K stock solution to each tube and tighten the cap.
[0043] 3) Place the centrifuge tubes in a hybridization oven and rotate them overnight at 56°C.
[0044] 4) The next day, centrifuge the sample at 12,000 rpm for 10 minutes at room temperature.
[0045] 5) Pour the supernatant into a 1.5 mL Eppendorf tube, add 1 mL of anhydrous ethanol (approximately twice the volume of the supernatant), tighten the cap, and shake gently. A flocculent precipitate will be visible. Stir at 13000 rpm for 15 min, then discard the supernatant.
[0046] 6) Add 1 mL of 70% ethanol, wash, centrifuge at 13000 rpm for 10–15 min, discard the supernatant, collect the precipitate, and air dry at room temperature for 15 min. Add 80–100 μL of sterile water to each tube, cap, and incubate at room temperature or 37°C for 1 h to fully dissolve. After incubation at room temperature for several hours until the DNA is completely dissolved, store at -20°C or directly perform PCR or hybridization experiments. If the DNA is not completely dissolved, it can be placed in a 37°C water bath for 30–60 min, but not overnight. The DNA concentration should be controlled at 50–100 ng / μL, and the OD260 / 280 should be between 1.8 and 2.0.
[0047] (II) PCR identification of mouse genotype
[0048] 1) Primers P1 and P2 can identify wild-type (no loxp insertion sites flanking the α5 gene, PCR product band is 309 bp) and α5 Flox / Flox In mice (α5 gene with insertion sites flanking it, PCR product band 371 bp), this primer pair can amplify bands of 309 bp and / or 371 bp in offspring hybrid mice, used to identify wild-type and α5 mice, respectively. Flox / Flox Transgenic positive mice. Figure 1 In the electrophoresis image of B, the red arrows indicate that the band corresponding to Wt 309 represents the wild-type genotype, and the band corresponding to Mut371 represents the α5 genotype. Flox / Flox Transgenic positive genotypes (Table 1).
[0049] Table 1 α5 Flox / Flox Mouse identification methods
[0050]
[0051] 2) Primers P3, P4, P5, and P6 were used to identify wild-type and transgenic Col1a2-CreERT mice. Primer pair P3 / P4 amplified a 180 bp band in transgenic mice, but could not distinguish between heterozygous and homozygous mice; however, it could identify Cre-positive mice. The PCR product of primer pair P5 / P6 was an endogenous control sequence, 521 bp in size. Bands were observed in both Cre-positive and Cre-negative mice. Figure 1 In the nucleic acid electrophoresis diagram below, the red arrows indicate that the band corresponding to Control521 is the endogenous control sequence band, and the band corresponding to Tg18 is the Cre-positive genotype. Mice with this band are Cre-positive mice (Table 2).
[0052] Table 2. Identification methods for Col1a2-CreERT mice
[0053]
[0054]
[0055] 3) Mouse hybridization and genotype screening α5 Flox / Flox Col1a2-CreERT mice: Genotyping was performed on the hybrid offspring of mice with the above two genotypes. Mice that were simultaneously positive for primers P1 and P2, primers P3, P4, P5, and P6 were identified as α5 mice. Flox / Flox Col1a2-CreERT mice; all identified by genotype; α5 Flox / Flox Col1a2-CreERT is a homozygous genotype, and its offspring can be used for experiments. It is currently in the population expansion stage. Figure 1List B shows the genotypic analysis of six representative F2 generation hybrid mice. The analysis was based on nucleic acid electrophoresis results. Taking mouse B48 as an example, its P1 / P2 primer identification band was a single band of Mut371, which is α5. Flox / Flox Homozygous (HO) mice; the presence of the Control521 band identified by primers P3 / P4 indicates that the endogenous control sequence is correct; the presence of the Tg180 band identified by primers P5 / P6 indicates that they are Col1a2-CreERT positive mice. B48 mice were ultimately identified as α5... Flox / Flox Col1a2-CreERT mice contain cre recombinase activity and can be induced by tamoxifen to produce α5-CKO homozygous mice.
[0056] Taking mouse B54 as an example, the identification band of its P1 / P2 primers contained both the Wt309 band and the Mut371 band, indicating α5 Flox / - Heterozygous (HE) mice; the presence of the Control521 band identified by the P3 / P4 primers indicates that the endogenous control sequence is correct; the presence of the Tg180 band identified by the P5 / P6 primers indicates that the mice are Col1a2-CreERT positive. The B48 mice were ultimately identified as α5... Flox / - Col1a2-CreERT mice. These mice contain cre recombinase activity and can be induced by tamoxifen to produce α5-CKO heterozygous mice.
[0057] Taking mouse B64 as an example, the P1 / P2 primer identification band was a single band of Mut371, which is α5. Flox / Flox Homozygous (HO) mice; the presence of the Control521 band identified by primers P3 / P4 indicates that the endogenous control sequence is correct; the absence of the Tg180 band identified by primers P5 / P6 indicates that they are Col1a2-CreERT negative mice. B64 mice were ultimately identified as α5 Flox / Flox The homozygous single-gene mouse does not contain cre recombinase activity and cannot be induced to produce α5-CKO mice.
[0058] Caption: HO: homozygous α5 loxP / loxP Mouse; HE: heterozygous α5 loxP / - Mice. (+) indicates cre-positive mice, (-) indicates cre-negative mice. ×: Mouse hybridization; Mice self-fertilized.
[0059] 4) Cre-ERT2 mice are a type of mouse containing a fusion protein expressing an estrogen receptor (ER) ligand-binding domain mutant (ERT) and Cre recombinase. Cre-ERT2 is inactive in the cytoplasm without Tamoxifen induction; upon Tamoxifen induction, the Tamoxifen metabolite 4-OHT (an estrogen analog) binds to ERT, allowing Cre-ERT2 to enter the nucleus and exert Cre recombinase activity. In the offspring of these hybrid animals, the Cre recombinase is expressed in fibroblasts activated by the Col1a2 promoter and recognizes the loxp site in the fluxed α5 gene. After adulthood, these hybrid offspring receive intraperitoneal injections of Tamoxifen for five consecutive days, which fuses the estrogen receptor ligand-binding domain mutant with the Cre recombinase to produce a chimeric recombinase, allowing it to enter the nucleus and exert its function, thereby specifically knocking out α5 in fibroblasts (α5-CKO mice). Figure 1 A. Schematic diagram.
[0060] Example 2
[0061] This embodiment demonstrates the application of α5CKO mice constructed using the method described in Example 1 in the treatment of inflammatory bowel disease.
[0062] 1) Method for establishing a mouse model of inflammatory bowel disease (IBD) using α5CKO mice: An acute enteritis model was established by treating the mice with 3% DSS for five days.
[0063] 2) Phenotypic identification and analysis of the α5CKO mouse IBD model. This was mainly assessed through changes in mouse body weight, colon length, and histological pathological changes.
[0064] 3) Research on the progression of IBD disease using α5 protein molecules in fibroblasts. The main focus was on detecting the degree of fibrosis in DSS-induced enteritis tissues. In a mouse enteritis model, α5 deficiency in fibroblasts reduced the degree of enteritis and fibrosis.
[0065] (I) Establishment of DSS-induced acute IBD mouse model
[0066] To investigate the function and mechanism of integrin α5 in fibroblasts during intestinal inflammation, we used a dextran sulfate sodium (DSS)-induced enteritis model. Tamoxifen was first dissolved in corn oil at a concentration of 20 mg / mL and incubated overnight at 37°C with shaking. After dissolution, the tamoxifen was stored at 4°C during injection. Integrin α5 in 6–8 week old cells... Flox / FloxCol1a2-CreERT mice were intraperitoneally injected daily for 5 days with tamoxifen (50 mg / kg body weight) to continuously knock out α5 from the fibroblast population (α5-CKO mice). The control group was injected with corn oil as a carrier (α5-Ctrl mice). Ten days later, an acute enteritis model was established by treating the mice's drinking water with 3% DSS (molecular weight 36,000-50,000) for four days. Figure 2 A). Figure 2 Figure A caption: Red triangle: Tamoxifen or corn oil treatment for 5 consecutive days; Blue bar: 3% DSS treatment for 4 consecutive days; Black arrow: Sacrifice of mice under anesthesia.
[0067] (ii) In a mouse model of enteritis, the absence of α5 in fibroblasts can reduce the degree of enteritis and fibrosis.
[0068] During the establishment of acute enteritis in mice, the body weight of mice in both the experimental and control groups was measured and recorded daily. Fecal viscosity and occult blood were also observed, and the Diabetic Inflammatory Index (DAI) score was calculated. After the experiment, mice were anesthetized and euthanized, and intact colon tissue was photographed and its length recorded. The colon tissue sections were fixed, paraffin-embedded, and sectioned. The tissue sections were stained with H&E and Masson staining, and the histology score was calculated based on the H&E staining results.
[0069] 1. The detailed scoring rules for the Inflammation Index (DAI score) are shown in Table 3.
[0070] Table 3. Scoring Rules for the Inflammation Index (DAI score)
[0071]
[0072]
[0073] 2. Colon tissue fixation, paraffin embedding, and sectioning.
[0074] (1) Material collection: Fresh tissue is collected in a standardized manner for each tissue part and cut into tissue blocks of about 3-4 mm in size with a blade in one direction. Do not exceed 5 mm.
[0075] (2) Fixation: Place the cut tissue blocks into 4% paraformaldehyde (PFA) for fixation, with a volume ratio of tissue block to 4% paraformaldehyde of 1:7.
[0076] (3) Wash away PFA: After fixation, rinse with running water 3 times, 5 minutes each time.
[0077] (4) Dehydration and clearing: The time for this step should be set according to different tissues. The basic process is as follows:
[0078] Dehydration: 30% ethanol → 50% ethanol → 70% ethanol (key step: can be done within 2 hours on the same day or overnight) → 95% ethanol 1 → 95% ethanol 2 → anhydrous ethanol
[0079] Adjust the dehydration time according to different tissue sizes and types: 30 min to 1 hour for 95% ethanol and 5 min to 30 min for 100% ethanol.
[0080] Transparent: 50% ethanol + 50% xylene → xylene 1 → xylene 2 → xylene 3
[0081] Taking advantage of the fact that the clearing agent can be mixed with both dehydrating agents and paraffin, the dehydrating agent can be replaced and the paraffin introduced into the tissue. Xylene is volatile and toxic, so this step is performed in a fume hood.
[0082] During the clearing process, observe the tissue morphology and adjust the clearing time as needed. Observe the tissue under light to see if it has cleared successfully. Clearing is complete when the tissue is sufficiently cleared, generally taking about 5-30 minutes. After clearing, place it in a small plastic box and label it.
[0083] (5) Wax impregnation: Melt the paraffin wax and maintain the temperature at around 55℃. A total of three wax impregnations are required. Because the tissue contains too much xylene in the first impregnation, the first wax impregnation time should be as short as possible, about 15 minutes. The subsequent two impregnations can be appropriately extended to 30 minutes to 1 hour. The purity of the wax in this step does not require high quality, but it should be noted that the melting point of the paraffin wax in this step is 54-56℃.
[0084] (6) Embedding: Embedding is carried out on an embedding machine. The embedding machine has a 60°C worktable and a -10°C worktable. The top is molten paraffin wax, which is pressed out from the wax outlet head.
[0085] Take a metal tank, add some paraffin wax, then use tweezers to fix the tissue in place. Move it to a -10°C platform; the paraffin wax will quickly solidify, fixing the tissue inside. Finally, cover it with the marked lid. Place it on a freezing platform, and after about half an hour, the metal tank can be removed.
[0086] (7) Sections: Reference for different tissue thicknesses: Liver, lungs and heart: 4-6 μm, routine: 4 μm, lymph nodes and kidneys: 2 μm.
[0087] (8) Slides: Carefully transfer the cut segments to clean water in a slide stand at 38-40℃ using a brush. After a few minutes, when the slices are completely wrinkle-free, select slices with intact tissue shape and no knife marks for retrieval. Two slices can be retrieved from one slice. Use adhesive slides for stronger adhesion.
[0088] (9) Baking: Place the slices in a 60℃ oven and bake overnight. After baking, remove them and store them at room temperature for later use.
[0089] 3. H&E staining of colon tissue sections
[0090] (1) Paraffin dissolution: Place the slices in a 70℃ in situ hybridization apparatus and bake for 30 minutes.
[0091] (2) Dewaxing: Quickly place the baked slices into xylene twice, for 5 minutes each time.
[0092] (3) Gradient hydration: Place in 100%, 90%, 80%, and 70% ethanol for 5 minutes each, and in distilled water for 5 minutes.
[0093] (4) Nuclear staining: Dry the water, add hematoxylin staining solution (purchased from Beyotime Biotechnology Co., Ltd.), stain for 5 minutes, rinse off the hematoxylin staining solution with running water, and observe the degree of staining under a microscope.
[0094] (5) Differentiation: Differentiate with 1% hydrochloric acid alcohol (purchased from Beyotime Biotechnology Co., Ltd.) for 1-3 seconds, wash with water, soak in tap water for 5-10 minutes to return to blue; observe the color under a microscope. If the color is not deep enough, add hematoxylin staining solution directly for 1 minute, then differentiate again and wash with water immediately; if it is too deep, increase the differentiation time appropriately.
[0095] (6) Counterstaining: Add 1 drop of 0.5% eosin staining solution (purchased from Beyotime Biotechnology Co., Ltd.), stain for 10-15 seconds, rinse with distilled water and observe under a microscope.
[0096] (7) Gradient dehydration: Dehydration with 80%, 90%, 95% and 100% ethanol.
[0097] (8) Transparency: Apply xylene twice, 5 minutes each time, and air dry at room temperature.
[0098] (9) Mounting: Add one drop of neutral resin to the tissue and mount with a coverslip. Observe and photograph under a microscope after 24 hours.
[0099] (10) Results
[0100] Blue: Normal cell nuclei are bright blue, apoptotic cell nuclei are bluish-black, necrotic cells are pale blue or the blue color disappears, cartilage matrix and calcium salt granules are dark blue, and mucus is grayish-blue.
[0101] Red: The cytoplasm is pink to peach-pink in various shades, the eosinophilic granules in the cytoplasm are bright red, the collagen fibers are light pink, the elastic fibers are bright pink, the red blood cells are orange-red, and the protein fluid is pink.
[0102] 4. Organizational change score, see Table 4.
[0103] Table 4. Histology score
[0104]
[0105] 5. Masson staining of colon tissue sections
[0106] Masson staining selectively stains cell nuclei, collagen fibers, and muscle fibers using three anionic dyes: hematoxylin, brilliant green, and Ponceau S-acid fuchsin. During staining, different tissues are stained by anionic dyes of varying molecular sizes, resulting in different colors, depending on their permeability. For example, in fixed tissues, Masson staining reveals that erythrocytes and nuclei are stained purple by the smallest anionic dye, hematoxylin; muscle fibers and cytoplasm are stained red by the medium-sized anionic dye, Ponceau S-acid fuchsin; and collagen fibers are stained green by the large anionic dye, brilliant green. This experiment used the Masson staining kit from Beyotime Biotechnology Co., Ltd. This kit is complete, providing the necessary components for Masson staining: hematoxylin staining solution, acidic differentiation solution, Ponceau S-acid fuchsin staining solution, brilliant green staining solution, and phosphotungstic molybdate differentiation solution.
[0107] Experimental steps:
[0108] (1) Paraffin dissolution: Place the slices in a 70℃ in situ hybridization apparatus and bake for 30 minutes.
[0109] (2) Dewaxing: Quickly place the baked slices into xylene twice, for 5 minutes each time.
[0110] (3) Gradient hydration: Place in 100%, 90%, 80%, and 70% ethanol for 5 minutes each, and in distilled water for 5 minutes.
[0111] (4) Hematoxylin staining: Add 50 μl of hematoxylin staining solution to each tissue section, stain for 5 minutes, remove the staining solution, and wash with distilled water for 5 minutes. Differentiate with an appropriate amount of acidic differentiation solution for 30 seconds, rinse with running tap water for 10 minutes to return to blue, and wash once with distilled water (for a few seconds). Note: Depending on the actual size of the section, 50-200 μl of staining solution can be added. This instruction manual uses 50 μl as an example.
[0112] (5) Ponceau S-Acid Fuchsin Staining: Add 50 μL of Ponceau S-Acid Fuchsin staining solution to each tissue section, stain for 10 minutes, remove the staining solution, and rinse with distilled water for a few seconds (not exceeding 10 seconds). Differentiate with an appropriate amount of phosphomolybdic acid differentiation solution for 2 minutes, and then remove the differentiation solution.
[0113] (6) Brilliant green staining: Add 50 μL of brilliant green staining solution to each tissue section, stain for 1 minute, remove the staining solution, and rinse with distilled water for a few seconds.
[0114] (7) Divide the product in an appropriate amount of acidic differentiation solution for 1 minute, then remove the differentiation solution.
[0115] (8) Gradient dehydration: Dehydration with 80%, 90%, 95% and 100% ethanol.
[0116] (9) Transparent: Apply xylene twice, 5 minutes each time, and air dry at room temperature.
[0117] (10) Mounting: Add a drop of neutral resin to the tissue and mount with a coverslip. Observe and photograph under a microscope after 24 hours.
[0118] The results showed that in the acute enteritis model, the weight loss in α5-CKO mice was significantly lower than that in α5-Ctrl mice. Figure 2 B); and compared with α5-Ctrl control mice, α5-CKO mice had a significantly lower intestinal inflammation index (DAI). Figure 2 C); The colon is significantly longer ( Figure 2 D, E). HE staining showed severe damage to the colonic folds and increased lymphocyte infiltration in α5-Ctrl mice, while the intestinal structure of α5-CKO mice remained basically normal. Figure 2 F, G), Figure 2 α5-CKO refers to mice with tamoxifen-induced α5-specific knockout of fibroblasts, while α5-Ctrl refers to control mice without corn oil-induced knockout.
[0119] Based on the above data, compared with α5-Ctrl control mice, α5-CKO mice are more tolerant to DSS-induced acute enteritis.
[0120] The degree of fibrosis in DSS-induced enteritis tissue was further examined. Hematoxylin and eosin (H&E) staining of colonic tissue from DSS-induced acute enteritis model mice revealed severe inflammation and fibrosis in the colon of DSS-induced α5-Ctrl mice, with distorted crypt structures, multiple inflammatory cells, and extensive edema in the mucosa and submucosa. In contrast, the mucosal integrity of DSS-exposed α5-CKO mice was well preserved. Masson staining of collagen in colonic tissue showed severe fibrosis in the colon of α5-Ctrl mice, while α5-CKO mice exhibited significantly less collagen deposition in the submucosa. Therefore, we can conclude that α5 deficiency in fibroblasts can alleviate enteritis and fibrosis in mouse enteritis models.
[0121] This invention investigates the role of integrin α5 expression in fibroblasts in intestinal inflammation. We established a fibroblast-specific knockout integrin α5-deficient mouse model (α5-CKO). We selected a dextran sulfate sodium (DSS)-induced enteritis model. DSS is widely used in studies of ulcerative colitis (UC), and its symptoms and pathological changes are similar to those of human UC, with lymphocyte and macrophage infiltration playing important roles. The results showed that:
[0122] (1) In the DSS-induced intestinal inflammation model, compared with the control mice (α5-Ctrl) that were not induced by corn oil knockout, α5-CKO mice showed a protective effect against intestinal inflammation.
[0123] (2) Further examination of the degree of fibrosis in the DSS-induced enteritis tissue revealed that the degree of fibrosis in the enteritis tissue of α5-CKO mice was significantly lower than that in the control mice (α5-Ctrl) without corn oil knockout, which showed a decrease in Collagen abundance.
[0124] This invention demonstrates that a mouse model using fibroblasts to selectively knock out integrin α5 molecules can be used for IBD disease progression research, providing an animal model basis for exploring the role and mechanism of integrin α5 molecules in the progression of intestinal fibrosis in IBD.
[0125] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any way. Any simple modifications, alterations, and equivalent changes made to the above embodiments based on the inventive essence shall still fall within the protection scope of the present invention.
Claims
1. A method for constructing a mouse model that selectively knocks out integrin α5 molecules in fibroblasts, characterized in that, The method is as follows: S1. Integrin α5 knockout mice α5 Flox / Flox The mice were hybridized with Col1a2-CreERT fibroblast tool mice to obtain the F1 generation of hybrid mice. The F1 generation of hybrid mice was then self-crossed to obtain the F2 generation of hybrid mice. S2. Construct primers to identify the genotypes of the F2 generation of hybrid mice obtained in S1, and screen for mice that are simultaneously positive, naming them α5. Flox / Flox Col1a2-CreERT mice; The primers used in the genotype identification were primer set A and primer set B; The primer set A consists of primers P1 and P2; The primer set B consists of primers P3, P4, P5 and P6; The nucleotide sequence of primer P1 is shown in SEQ ID NO:1; The nucleotide sequence of primer P2 is shown in SEQ ID NO:2; The nucleotide sequence of primer P3 is shown in SEQ ID NO:3; The nucleotide sequence of primer P4 is shown in SEQ ID NO:4; The nucleotide sequence of primer P5 is shown in SEQ ID NO:5; The nucleotide sequence of primer P6 is shown in SEQ ID NO:6; α5 obtained from S3 and S2 Flox / Flox After adulthood, Col1a2-CreERT mice were injected intraperitoneally with tamoxifen for 5 consecutive days to induce Cre recombinase expression, resulting in α5-CKO mice with selective knockout of integrin α5 molecules in fibroblasts.
2. The application of an α5-CKO mouse constructed using the mouse model construction method described in claim 1, characterized in that, The α5-CKO mice were used to construct a mouse model of inflammatory bowel disease (IBD).
Citation Information
Patent Citations
Humanized anti-cd19 antibodies and their use in treatment of oncology, transplantation and autoimmune disease
CN101534859A
Targeted modification of rat genome
CN105308184A