Conserved B cell epitopes of VP1 protein of chicken infectious anemia virus capsid and their application in functional display and detection of Peg fimbriae

Abstract

The present invention discloses the amino acid sequence of the conserved B cell epitope of the capsid VP1 protein of chicken infectious anemia virus (CIAV) and the functional expression of the B cell epitope in the Salmonella Peg pili and the ability to specifically identify CIAV infectious antibodies. The present invention also discloses a chicken infectious anemia virus infectious antibody detection system and a detection kit thereof. The rapid and convenient agglutination test detection method based on direct mediation of B cell epitope-antibody of the present invention can qualitatively and quantitatively detect the specific antibodies induced to be produced by the host after CIAV infection, and can be detected on the 5th day after CIAV infection, and no non-specific reaction or cross reaction occurs with other pathogen-infected sera. In view of the advantages of specificity, sensitivity, convenience and low cost, the present invention is expected to become a technology and platform for early diagnosis of CIAV infection.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and immune diagnosis and detection technology, and specifically relates to the functional expression of the conserved B cell epitope RR07 of the Chicken infectious anemia virus (CIAV) capsid VP1 protein in Salmonella Peg pili, and the ability to specifically recognize CIAV infectious antibodies; a rapid and convenient agglutination test detection method based on the direct mediation of the B cell epitope RR07 and the antibody, which can qualitatively and quantitatively detect specific antibodies induced in the host after CIAV infection; and potential applications thereof. Background Art

[0002] Among immunosuppressive diseases, chicken infectious anemia (CIA) is caused by the chicken infectious anemia virus (CIAV), which causes severe immunosuppression and anemia in infected chickens worldwide. CIAV, the only member of the genus Tobiviridae in the family Tobiviridae, can infect chickens of all ages, but the disease is most common in 2-3 week old chicks, presenting with aplastic anemia and systemic lymphoid tissue atrophy. Chickens over 3 to 4 weeks old infected with CIAV do not show clinical symptoms, but can develop immunosuppression, leading to secondary infection and vaccination failure. CIAV can be transmitted both vertically and horizontally. Notably, due to limitations in detection and monitoring, attenuated vaccines are easily contaminated with CIAV, resulting in immune failure. These characteristics of CIAV greatly complicate the prevention and control of CIA, severely impacting the healthy development of the poultry industry.

[0003] There is currently no commercially available vaccine to prevent CIA infection in China. Therefore, strict CIAV antibody testing is essential when introducing breeder chickens, allowing for the prompt culling of positive chickens to prevent vertical transmission of CIAV. Therefore, accurate and rapid early diagnosis of CIAV is essential for preventing its prevalence, but there is currently no definitive "gold standard" diagnostic method. Traditional pathogen isolation and identification procedures are cumbersome and time-consuming. Virus neutralization (VN) tests or indirect immunofluorescence antibody tests (IFA) can detect CIAV antibodies in chicken serum or egg yolk, but they require specialized laboratories, technical staff, and adequate equipment, and require lengthy preparation and implementation. PCR methods require consideration of the correlation between the time and stage of onset of the disease, the local and global correlation of the disease site, and the availability of laboratory equipment and relevant operating personnel, making them unsuitable for clinical application. ELISA methods are simple and relatively rapid, but currently commercial ELISA kits are mostly imported and expensive, making them difficult to meet the needs of large-scale clinical testing. False positives and false negatives are common, requiring repeated testing for consistent and stable results.

[0004] Considering that CIAV infection is widespread in my country, and mixed infection is serious, harmful, and concealed, it is crucial to develop an accurate, convenient, and inexpensive CIAV serological detection method that is suitable for large-scale clinical CIAV infection detection and monitoring, and is convenient for promotion and application at the grassroots level. Attention should also be paid to the detection and monitoring of CIAV infection in breeding poultry. Summary of the Invention

[0005] Purpose of the invention: The technical problem to be solved by the present invention is to provide a conserved B cell epitope RRARRPR (abbreviated as RR07) of CIAV capsid VP1 protein.

[0006] The technical problem that the present invention also aims to solve is to provide a nucleic acid molecule encoding the B cell epitope RR07 of the CIAV capsid VP1 protein.

[0007] The technical problem that the present invention also aims to solve is to provide an expression cassette, a recombinant expression vector, a recombinant strain or a CIAV infectious antibody detection system for a rapid and convenient agglutination test directly mediated by a B cell epitope and an antibody, and for qualitatively and quantitatively detecting specific antibodies induced in the host after CIAV infection.

[0008] The technical problem that the present invention also aims to solve is to provide the use of the nucleic acid or gene of the B cell epitope, the expression cassette, the recombinant expression vector, the recombinant cell, the recombinant strain or the infectious antibody detection system in the preparation of a reagent or kit for detecting CIAV infectious antibodies.

[0009] The final technical problem to be solved by the present invention is to provide a reagent or kit for qualitatively and quantitatively detecting CIAV infectious antibodies through a rapid and convenient agglutination test method directly mediated by B cell epitope-antibody.

[0010] Technical solution: In order to solve the above technical problems, the present invention provides a conserved B cell epitope of CIAV capsid VP1 protein, the amino acid sequence of which is RRARRPR, abbreviated as RR07.

[0011] The present invention also includes a nucleic acid molecule encoding the B cell epitope, and the DNA sequence of the nucleic acid or gene is AGACGAGCTCGCAGACCGAGA, abbreviated as AA21.

[0012] The present invention also includes a Peg-CIAV-VP1-AA21 gene fragment, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0013] The present invention also includes an expression cassette, a recombinant vector, a recombinant cell, a recombinant strain or a CIAV infectious antibody detection system, which contains the nucleic acid molecule or the Peg-CIAV-VP1-AA21 gene fragment.

[0014] The present invention also includes the recombinant vector, which is an expression vector pBR-Peg-CIAV-VP1-AA21 constructed by inserting the nucleic acid or gene of the B cell epitope RR07 into the Salmonella Peg pili encoding gene sequence.

[0015] The present invention also includes a method for constructing the recombinant vector, comprising the following steps: inserting the nucleic acid molecule of the B cell epitope into the Salmonella Peg pili encoding gene sequence and introducing it into a vector, or introducing the Peg-CIAV-VP1-AA21 gene fragment into a vector to construct the resulting expression vector.

[0016] The present invention also includes a method for constructing the recombinant strain, which comprises the following steps: introducing the recombinant vector into the carrier bacteria by electroporation.

[0017] The CIAV infectious antibody detection system further comprises introducing the expression vector pBR-Peg-CIAV-VP1-AA21 into the S9 vector bacteria.

[0018] The present invention also includes the use of the B cell epitope, the nucleic acid or gene of the B cell epitope, the expression cassette, the recombinant expression vector, the recombinant strain or the infectious antibody detection system in the preparation of a reagent or kit for detecting CIAV infectious antibodies.

[0019] The present invention also includes infectious antibodies that bind to the conserved B cell epitope of the CIAV capsid VP1 protein, and the infectious antibodies specifically bind to the conserved B cell epitope of the VP1 protein.

[0020] The present invention also includes a reagent or kit for detecting CIAV infectious antibodies, which includes the conserved B cell epitope of the VP1 protein or the expression cassette, recombinant expression vector, recombinant strain or infectious antibody detection system.

[0021] The rapid and convenient agglutination test detection method based on direct mediation of conserved B cell epitopes of VP1 protein and antibodies of the present invention can qualitatively and quantitatively detect specific antibodies induced in a host after CIAV infection.

[0022] Beneficial Effects: Compared with existing technologies, the present invention has the following significant advantages: The CIAV-specific B-cell epitope RR07 described in the present invention is derived from the CIAV capsid VP1 protein and is displayed using Salmonella Peg pili. An indirect agglutination test verifies that the vector bacteria express Peg pili and that the conserved CIAV B-cell epitope RR07 is functionally displayed on its bacterial surface. The B-cell epitope RR07 recognizes and binds to specific infectious antibodies against this epitope, thereby enabling specific, sensitive, and rapid detection of CIAV infectious antibodies. The CIAV infectious antibody detection system has good specificity and does not cross-react with other avian virus-positive sera (including SPF chicken serum infected with reticuloendotheliosis virus (REV), SPF chicken serum infected with J subgroup avian leukosis virus (ALV-J), SPF chicken serum infected with K subgroup avian leukosis virus (ALV-K), positive chicken serum infected with infectious bronchitis virus (IBV), positive chicken serum infected with avian influenza virus (AIV), positive chicken serum infected with Marek's disease virus (MDV), positive chicken serum infected with infectious bursal disease virus (IBDV), and positive chicken serum of Salmonella typhimurium). The present invention can detect specific infectious antibodies on the 5th day after SPF chickens are artificially infected with CIAV, with good sensitivity, and can implement quantitative testing of infectious antibody titers. In view of the advantages of the present invention such as specificity, sensitivity, rapidity, convenience, low cost, and qualitative and quantitative testing, it is expected to become an important technology and platform for early diagnosis of CIAV infection and detection, monitoring and evaluation. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 , Chicken infectious anemia virus (CIAV) capsid VP1 protein homology alignment results, the black line frame highlights the predicted conserved B cell epitope RR07;

[0024] Figure 2 Schematic diagram of the spatial structure of the conserved RR07 epitope exposed on the surface of the CIAV capsid VP1 protein. The VP1 capsid protein is a multimeric protein. The left figure shows an elevational view of the VP1 trimer (shown in three colors), in which the RR07 epitope (red mesh structure) is exposed on the surface of the VP1 trimer. The right figure shows a top-down view rotated 90° counterclockwise along the horizontal axis, visualizing the exposure of the RR07 epitope on the VP1 trimer surface.

[0025] Figure 3Gel electrophoresis of nucleic acid amplified by PCR of the chimeric gene Peg-CIAV-VP1-AA21. Lane M is the Trans2K Plus II DNA Marker, lane 1 is the PCR amplification product of the peg operon gene, and the template DNA is from the Salmonella pullorum standard strain CVCC 526, which serves as a positive control; lane 2 is the PCR amplification product of Peg-CIAV-VP1-AA21; lane 3 is the genome of the avian pathogenic Escherichia coli isolate APEC-XM, which serves as a negative control.

[0026] Figure 4 , electrophoresis diagram of restriction enzyme digestion identification of the recombinant expression vector pBR-Peg-CIAV-VP1-AA21. Lane M is Trans 2K Plus II DNA Marker, lane 1 is the pBR-Peg-CIAV-VP1-AA21 circular plasmid; lane 2 is the NheI and BamHI double enzyme digestion product of pBR-Peg-CIAV-VP1-AA21.

[0027] Figure 5 , plasmid schematic diagram of the recombinant plasmid expression vector pBR-Peg-CIAV-VP1-AA21.

[0028] Figure 6Figure 1 shows the agglutination reaction results of the S9 vector control system (S9+pBR-Peg) and the detection system (S9+pBR-Peg-CIAV-VP1-AA21) that functionally displays the conserved B cell epitope RR07 of CIAV on the surface of S9 bacteria with sera infected with different pathogens. A: The serum of healthy SPF chickens (not infected with chicken infectious anemia virus) did not agglutinate with the control system and the detection system; B: The serum of healthy SPF mice did not agglutinate with the control system and the detection system; C: The serum of SPF chickens artificially infected with CIAV did not agglutinate with the control system, but agglutinated with the detection system; D: The serum of clinical CIAV-positive chickens did not agglutinate with the control system, but agglutinated with the detection system; E: The serum of SPF chickens infected with reticuloendotheliosis virus (REV) did not agglutinate with the control system and the detection system; F: The serum of SPF chickens infected with avian leukosis virus subgroup J (ALV-J) did not agglutinate with the control system and the detection system; G: The serum of SPF chicken infected with avian leukosis virus subgroup K (ALV-K) did not agglutinate with the control system or the detection system; H: The serum of positive chicken infected with infectious bronchitis virus (IBV) did not agglutinate with the control system or the detection system; I: The serum of positive chicken infected with avian influenza virus (AIV) did not agglutinate with the control system or the detection system; J: The serum of positive chicken infected with Marek's virus (MDV) did not agglutinate with the control system or the detection system; K: The serum of positive chicken infected with infectious bursal disease virus (IBDV) did not agglutinate with the control system or the detection system; L: The positive serum of Salmonella typhimurium did not agglutinate with the control system or the detection system.

[0029] Figure 7 A detection system for functionally displaying the conserved B cell epitope RR07 on the bacterial surface was used to qualitatively and quantitatively test serum from chickens artificially infected with CIAV. The horizontal axis represents the time (days) of CIAV infection, and the vertical axis represents the infectious antibody and agglutination titer in the infected chickens. DETAILED DESCRIPTION

[0030] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are intended to describe specific specific embodiments and are not intended to limit the scope of protection of the present invention. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the examples, any methods, equipment, and materials of the prior art that are similar or equivalent to the methods, equipment, and materials described in the examples of the present invention may also be used to implement the present invention based on the prior art knowledge of those skilled in the art and the description of the present invention.

[0031] Example 1 Prediction and Screening of Conserved B Cell Epitopes of Chicken Infectious Anemia Virus (CIAV) Capsid VP1 Protein

[0032] The European Protein Database (Uniprot, https: / / www.uniprot.org / ) to search the amino acid sequence of the capsid VP1 protein of chicken infectious anemia virus and obtained 6 protein sequences screened by UniprotKB, with accession numbers: P54088, P54090, P54087, Q9IZU5, Q99153 and P54089. Using the Uniprot online alignment tool ( https: / / www.uniprot.org / align / ) compared the above sequences and the results were as follows Figure 1 As shown, it shows that VP1 protein is conserved in CIAV capsid protein. In order to further clarify whether the above conserved VP1 protein contains consistent conserved B cell epitopes, the B cell epitope prediction tool (Bepipred Linear Epitope Prediction 2.0, http: / / tools.iedb.org / bcell / ) B-cell epitopes contained in the CIAV VP1 protein (reference sequence Uniprot accession number: P54088) were predicted. This database scores each amino acid residue. Residues with a score greater than 0.5 are considered antigenic, and residues with scores greater than 0.5 are considered B-cell epitopes. The prediction results are shown in Table 1. Comprehensive analysis of the conserved regions of the VP1 protein and the predicted B-cell epitopes revealed a completely conserved B-cell epitope region in the CIAV VP1 protein with the highest overall score: amino acid positions 3-9 of the VP1 sequence: RRARRPR, abbreviated as RR07. Sequences that were not conserved or had low scores were not considered optimized epitope antigens and were not further validated.

[0033] Table 1 Prediction results of B cell epitope sequences of CIAV VP1 protein

[0034]

[0035]

[0036] Considering that VP1 protein belongs to the viral capsid protein, other protein components may shield the predicted epitope in spatial conformation during the viral assembly process, making it difficult to expose the epitope and thus unable to produce a good immune response. http: / / tools.iedb.org / bcell / ) predicts VP1 of CIAV The protein (reference sequence Uniprot accession number: P54088) was used for AlphaFold 2 protein structure prediction. The AlphaFold2 integrated platform ColabFoldv1.5.5 was used to predict the protein structure of VP1 protein homotrimer (test website: https: / / colab.research.google.com / github / sokrypton / ColabFold / blob / main / AlphaFold2.ipynb? authuser=1), Further analysis and results are as follows Figure 2 As shown, the predicted RR07 epitope (highlighted by the red mesh structure) is spatially exposed on the surface of the VP1 trimer protein (i.e., the outermost surface of the viral capsid), without any other structural shielding, and the hydrophilic amino acid residues have good surface exposure.

[0037] Example 2 Construction of Peg pili expression vector expressing the conserved B cell epitope RR07 of VP1 protein of CIAV and verification of its functional expression

[0038] The DNA sequence of the predicted and preferred conserved B cell epitope RR07 on the VP1 protein, AGACGAGCTCGCAGACCGAGA (AA21), was inserted into the Peg fimbriae gene sequence of Salmonella pullorum to construct the expression vector pBR-Peg-CIAV-VP1-AA21. The vector was then introduced into the vector bacteria for amplification and expression, and the functional expression of the RR07 epitope on the surface of the vector bacteria was verified. The specific implementation procedures are as follows:

[0039] A chimeric gene consisting of peg (reference sequence: Salmonella enterica SP strain, GenBank accession numbers CP077668.1, 1831920-1827125) and VP1-AA21 was synthesized by Nanjing Qingke Biotechnology Co., Ltd. The AATTACACTCTGAATTCAAGTAAGTTTGAA site in the peg operon gene sequence was replaced by VP1-AA21. The resulting chimeric gene was named Peg-CIAV-VP1-AA21. The gene sequence of Peg-CIAV-VP1-AA21 is as follows: (SEQ ID NO. 1)

[0040]

[0041]

[0042]

[0043]

[0044] The primer information for peg operon amplification is as follows: upstream primer SP Peg Up: 5'-CGC GCTAGC ATGAAACGTTCACTTATTGCTGCT-3' downstream primer SP Peg Down: 5'-CGT GGATCCTTAATTATAAGATACCACGATTAATGC-3', the underlined sequences represent NheI and BamHI restriction enzyme sites, respectively. The above primers were synthesized by Nanjing Qingke Biotechnology Co., Ltd. The chimeric gene Peg-CIAV-VP1-AA21 was used as a template (1 μL, containing 1 ng of the chimeric gene), the genome of the standard strain of Salmonella pullorum CVCC 526 (purchased from China Veterinary Drug Administration, China Veterinary Microbial Culture Collection Center) was used as a positive control, and the genome of the avian pathogenic Escherichia coli isolate APEC-XM (Liu Jiaqi, Wu Hucong, Yin Yi, Zhang Dong, Xia Pengpeng, Ren Wenkai, Zhu Guoqiang. Study on the construction of a mouse model of neonatal Escherichia coli meningitis caused by avian Escherichia coli [J]. China Poultry, 2019, 41(10): 26-30.) was used as a negative control. PCR amplification was performed using the upstream and downstream primers SP Peg Up / Down. The amplification system was: 2 μL of pfu high-fidelity DNA Polymerase (Beijing Quanshijin Biotechnology Co., Ltd.), 10 μL of 5×pfu DNA polymerase buffer, and dNTPs 5μL, 2μL of upstream and downstream primers (10mM), 2μL of chimeric gene or APEC-XM genome or CVCC 526 genome (250ng / μL), 27μL of ultrapure water. After mixing the above system evenly, PCR amplification was performed using a thermal cycler (Bio-Red). The program was as follows: pre-denaturation at 94℃ for 5min, amplification stage for a total of 30 cycles, including denaturation at 94℃ for 30s, annealing at 52℃ for 30s and extension at 72℃ for 5min, further amplification at 72℃ for 10min, and the temperature was lowered to 12℃ after the amplification was completed. A 1% agarose gel was prepared, electrophoresed at 110V for 45min, stained with ethidium bromide, and imaged under a UV imager. The PCR results were as follows. Figure 3 As shown, the amplified product size of the positive control is 4850 bp; the PCR product of Peg-CIAV-VP1-AA21 is 4841 bp; and no amplified band was found in the negative control. The PCR amplified product (4841 bp) of the PCR product of Peg-CIAV-VP1-AA21 was recovered using a universal DNA purification kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.).

[0045] The PCR amplification product of Peg-CIAV-VP1-AA21 and the pBR322 plasmid DNA were double-digested with NheI and BamHI restriction endonucleases (NEB), and then the linear DNA fragments were ligated with T4 DNA ligase (NEB) in a 16°C metal bath overnight. The next day, the ligation product was transformed into S9 competent cells (Zhu Guoqiang, Yang Bin, Yang Yang, Meng Xia, Xia Pengpeng, Duan Qiangde, Zhu Xiaofang, An inert carrier Salmonella and its potential application, national invention patent, patent number: ZL201910424369.8), and resistance screening was carried out by coating solid culture medium containing 100 μg / mL ampicillin. A single colony was picked from the plate and inoculated into LB liquid medium containing 100 μg / mL ampicillin and grown to the stationary phase. The recombinant plasmid DNA was extracted and recovered and then digested with two restriction endonucleases, NheI and BamHI, and then identified by electrophoresis. The method was as follows: a 1% agarose gel was prepared, electrophoresed at 110V for 45 minutes, and then stained with ethidium bromide and imaged under a UV imager. The results were as follows: Figure 4 As shown, the double enzyme digestion product of the recombinant plasmid pBR-Peg-CIAV-VP1-AA21 contains a 4215bp linear vector and a 4841bp Peg-CIAV-VP1-AA21 linear DNA fragment, which is consistent with the expected size. The schematic diagram of the expression recombinant vector pBR-Peg-CIAV-VP1-AA21 plasmid DNA is shown in Figure 5 shown.

[0046] The S9 engineered bacteria carrying the recombinant expression plasmid pBR-Peg-CIAV-VP1-AA21 were grown in LB liquid medium containing 100 μg / mL ampicillin to the plateau phase, centrifuged at 4000 rpm for 5 min, and the supernatant was discarded. The suspension was resuspended with an equal volume of sterile saline, and centrifuged and washed twice in this manner to prepare a bacterial suspension (final concentration 1×10 10CFU / mL). The bacterial suspension of the recombinant S9 vector bacteria (S9+pBR-Peg-CIAV-VP1-AA21) carrying the above-mentioned recombinant plasmid was subjected to agglutination tests with CIAV-negative serum (10 copies of SPF chicken serum, collected by our laboratory), serum of SPF chicken infected with Salmonella pullorum (10 copies, infected and collected by our laboratory, the infected strain was the standard strain of Salmonella pullorum CVCC 526), ​​and serum of SPF chicken infected with CIAV (10 copies, infected and collected by our laboratory, the infected strain was CIAV-SDAU-1 strain, provided by Shandong Agricultural University). Bacterial suspensions of S9 vector bacteria carrying the pBR-Peg plasmid (S9+pBR-Peg) and S9 vector bacteria carrying the blank pBR322 plasmid (S9+pBR322) were used as negative controls of the detection system. The methods for obtaining and constructing the above strains are completely consistent with the methods described in the Chinese invention patent "Inert carrier indirect agglutination test detection system and its application, patent number: ZL202010400163.4". The results of the agglutination test are shown in Table 2. The bacterial suspensions of all strains did not react with the negative serum of SPF chickens; the S9+pBR322 bacterial suspension did not react with the serum of SPF chickens infected with Salmonella pullorum, while the S9+pBR-Peg and S9+pBR-Peg-CIAV-VP1-AA21 bacterial suspensions both underwent agglutination reactions with the above sera, proving that the Peg pili in S9+pBR-Peg and S9+pBR-Peg-CIAV-VP1-AA21 bacteria were functionally expressed on the surface of the S9 strain; the S9+pBR-Peg-CIAV-VP1-AA21 bacterial suspension showed obvious agglutination with the serum of SPF chickens artificially infected with CIAV, showing agglutinated particles and a clear background; while the S9+pBR322 and S9+pBR-Peg bacterial suspensions did not undergo agglutination with the CIAV positive serum, without agglutinated particles, and the background was turbid. The results indicate that the conserved B cell epitope RR07 from the CIAV capsid VP1 protein can be expressed on the bacterial surface through Peg pili and can specifically detect infectious antibodies against CIAV.

[0047] In the above-mentioned CIAV infectious antibody detection system, S9+pBR322 does not express Peg pili, and its bacterial suspension serves as a blank control; S9+pBR-Peg bacterial suspensions are all negative control systems. The S9+pBR-Peg-CIAV-VP1-AA21 antibody detection system is based on S9+pBR-Peg and only adds the RR07 epitope. It specifically recognizes and binds to specific antibodies infected with CIAV, eliminates non-specific false positive reactions in the detection system, and thus ensures accurate diagnosis of individuals; S9+pBR-Peg-CIAV-VP1-AA21 recombinant bacterial suspension serves as a CIAV-specific antibody detection system, which can specifically recognize and bind to infectious antibodies against consistent conserved B cell epitopes in CIAV.

[0048] Table 2 Functional verification of the expression of CIAV conserved B cell epitope RR07 on the surface of vector bacteria S9

[0049]

[0050] Note: “-” represents negative agglutination reaction; “+” represents positive agglutination reaction

[0051] Example 3 Specificity and sensitivity testing of infectivity detection technology using functionally displayed expression of the CIAV conserved B cell epitope RR07 on the surface of bacterial cell S9

[0052] Based on the functional verification of the CIAV conserved B cell epitope RR07 displayed on the surface of the vector bacteria S9, the specificity and sensitivity of the CIAV infectious antibody detection system were further tested. The specific implementation procedures are as follows:

[0053] According to the same method as in Example 2, the control system S9 + pBR-Peg bacterial suspension and the CIAV infectious antibody detection system S9 + pBR-Peg-CIAV-VP1-AA21 bacterial suspension were prepared, with a concentration of 1×10 10CFU / mL. The above bacterial suspension was subjected to agglutination tests with sera from different background sources to verify the specificity of the infectious antibody detection system. The sera involved in the test included: 100 samples of healthy SPF chicken sera (collected by this laboratory), 20 samples of SPF chicken sera infected with CIAV (infected and collected by this laboratory, the infectious strain was CIAV-SDAU-1 strain, which was provided by Shandong Agricultural University), 10 samples of CIAV clinically positive chicken sera (provided by Yangzhou University), 10 samples of SPF chicken sera infected with reticuloendotheliosis virus (REV) (infected and collected by this laboratory, the infectious strain was REV SNV strain, which is preserved in our laboratory), 10 sera from SPF chickens infected with avian leukosis virus subgroup J (ALV-J) (provided by Shandong Agricultural University), 10 sera from SPF chickens infected with avian leukosis virus subgroup K (ALV-K) (provided by Yangzhou University), 10 sera from chickens positive for infectious bronchitis virus (IBV) (provided by Yangzhou University), 10 sera from chickens positive for avian influenza virus (AIV) (provided by Yangzhou University), 10 sera from chickens positive for Marek's virus (MDV) (provided by Yangzhou University), 10 sera from chickens positive for infectious bursal disease virus (IBDV) (provided by Yangzhou University), and 10 sera from Salmonella typhimurium (provided by Yangzhou University).

[0054] The results are shown in Table 3 and Figure 6 As shown, the CIAV infectious antibody detection system S9+pBR-Peg-CIAV-VP1-AA21 only agglutinated with the sera of SPF chickens infected with CIAV and the sera of CIAV clinically positive chickens, but did not produce nonspecific reactions or cross reactions with sera infected with other pathogens.

[0055] Table 3 Specificity verification of infectious antibody detection system

[0056]

[0057]

[0058] Note: “-” represents negative agglutination reaction; “+” represents positive agglutination reaction

[0059] To clarify the sensitivity of the test of the present invention, the present invention uses the CIAV-SDAU-1 strain (this strain is preserved by this laboratory) to infect 10 one-day-old SPF chickens, and the above-mentioned chicken serum is collected by jugular vein blood collection one day before infection (day 0) as a negative control. From the 5th, 7th, 14th and 21st days after infection, all chickens are collected by jugular vein blood collection and serum is prepared, and then the CIAV capsid VP1 protein B cell epitope-oriented infectious antibody detection system (S9+pBR-Peg-CIAV-VP1-AA21) is used for quantitative testing. The test method is as follows: the above-mentioned serum is subjected to 2 n Serial dilution: Add 10 μL of sterile saline to each well of a 96-well plate, then pipette 10 μL of serum into the first well of each column, mix thoroughly with sterile saline, then add 10 μL of diluted serum to the next well, and repeat this cycle to dilute to 2 12 The serum of each dilution was compared with the control system S9+pBR-Peg bacterial suspension and the CIAV infectious antibody detection system S9+pBR-Peg-CIAV-VP1-AA21 bacterial suspension (both at a concentration of 1×10 10 CFU / mL) were used for agglutination test, and the last dilution at which agglutinated particles appeared was used as the titer of the serum infectious antibody. The positive rate of the agglutination test is shown in Table 4. In the artificially infected chickens, infectious antibodies can be detected as early as the 5th day. This sensitivity is significantly higher than that of traditional serological detection technology. With the increase of the immunization time, the positive rate of the agglutination test gradually increases. The quantitative test results are shown in Table 4. Figure 7 As shown, on the 21st day after immunization, the infectious antibody titer reached 1:16.

[0060] Table 4 Sensitivity validation of the Peg-CIAV-VP1-AA21 infectious antibody detection system

[0061]

[0062]

[0063] Therefore, the CIAV infectious antibody test method of the present invention has good specificity and sensitivity. Compared with the results reported by current detection methods for CIAV (PCR, ELISA, etc.), the sensitivity of the present invention is significantly improved and the specific infectious antibody titer can be quantitatively detected.

Claims

1. A conserved B cell epitope peptide of the capsid VP1 protein of chicken infectious anemia virus, characterized in that: The amino acid sequence of the B cell epitope peptide is RRARRPR.

2. A nucleic acid molecule encoding the B cell epitope peptide according to claim 1, characterized in that: The DNA sequence of the nucleic acid molecule is AGACGAGCTCGCAGACCGAGA.

3. A Peg-CIAV-VP1-AA21 A gene fragment, characterized in that The nucleotide sequence is shown in SEQ ID NO.

1.

4. An expression cassette, a recombinant vector, a recombinant cell or a recombinant strain, characterized in that: It comprises the nucleic acid molecule according to claim 2 or the nucleic acid molecule according to claim 3 Peg-CIAV-VP1-AA21 Gene fragment.

5. The method for constructing the recombinant vector according to claim 4, characterized in that: The steps include: inserting the nucleic acid molecule of the B cell epitope peptide described in claim 2 into the gene sequence encoding the Salmonella Peg pili and introducing it into the vector or inserting the nucleic acid molecule of the B cell epitope peptide described in claim 3 into the vector encoding the Salmonella Peg pili and introducing it into the vector. Peg-CIAV-VP1-AA21 The gene fragment is introduced into the vector to construct the resulting expression vector.

6. The method for constructing the recombinant strain according to claim 4, characterized in that: The method comprises the following steps: introducing the recombinant vector into the carrier bacteria by means of electrotransformation.

7. A chicken infectious anemia virus infectious antibody detection system, characterized in that: The detection system comprises the expression cassette, recombinant vector, recombinant cell or recombinant strain according to claim 4.

8. The B cell epitope peptide according to claim 1, the nucleic acid molecule of the B cell epitope peptide according to claim 2, the Peg-CIAV-VP1-AA21 Use of the gene fragment, the expression cassette, recombinant vector, recombinant cell or recombinant strain described in claim 4, and the chicken infectious anemia virus infectious antibody detection system described in claim 7 in the preparation of a reagent or kit for detecting chicken infectious anemia virus infectious antibodies.

9. A reagent or kit for detecting infectious antibodies of chicken infectious anemia virus, characterized in that: The reagent or kit comprises the conserved B cell epitope peptide of VP1 protein according to claim 1, the Peg-CIAV-VP1- AA21 A gene fragment, an expression cassette, a recombinant vector, a recombinant cell, a recombinant strain as described in claim 4 or a chicken infectious anemia virus infectious antibody detection system as described in claim 7.

Images