A CeTCP14 gene regulating taro starch synthesis and its application

Abstract

The present invention relates to the field of genetic engineering technology, in particular to a method for regulating taro starch synthesis. CeTCP14 Gene and its application. The present invention provides a gene for regulating plant starch synthesis CeTCP14 The nucleotide sequence of the gene is shown in SEQ ID NO.1. CeTCP14 Gene, which can significantly reduce the starch content in taro corms and reduce the expression of starch synthesis-related genes in taro corms; overexpression in tobacco CeTCP14 The gene can significantly increase the starch content in tobacco leaves and increase the expression of starch synthesis-related genes in tobacco leaves. CeTCP14 Genes play an important role in the positive regulation of plant starch synthesis. The present invention can not only be applied to the biosynthesis of starch in taro, but also provide technical support for high-quality and high-yield cultivation and molecular breeding of taro.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, in particular to a method for regulating the synthesis of taro starch. CeTCP14 Genes and their applications. Background Art

[0002] taro[ Colocasia sculenta (L.Schott) is an annual food and vegetable crop of the genus Taro in the family Araceae, which has important edible, medicinal and ornamental values. As an important food and medicine crop, taro's underground corm is rich in starch, polysaccharides, proteins and other physiologically active ingredients. Starch is one of the most important physiologically active ingredients in taro corms. Compared with other crops, taro starch has smaller particles with a diameter of about 1~5 μm, which is easier to digest. Regular consumption has a good health care effect on the spleen and stomach. Therefore, the synthesis of starch in taro corms plays an important role in the formation of taro yield and quality.

[0003] The biosynthesis and regulation pathways of plant starch have been comprehensively and deeply studied in important crops such as rice, corn, and potatoes. Many key genes in the synthesis pathways have been discovered and verified, such as AGPase , SBE , SS , GBSS and DPE As for regulatory genes, although some transcription factor regulatory genes have been identified, such as DOF, NAC, MYB, bZIP, MADS-BOX and AP2 / EREB However, due to differences in species or temporal and spatial organization, the starch synthesis regulatory genes of many plants are still unclear. At present, the research on the function of taro genes is still relatively backward, and its genome ploidy is complex. CeTCP14 There are no reports on the research on gene regulation of starch synthesis in taro corms. Summary of the invention

[0004] In order to solve the above problems, the present invention provides a method for regulating taro starch synthesis. CeTCP14 Gene and its application. The present invention has discovered a gene that can regulate starch synthesis in taro corms. CeTCP14 Genes provide genetic resources for high-quality and high-yield cultivation and molecular breeding of taro, and CeTCP14 The molecular mechanism by which genes promote corm development through starch synthesis pathway in taro corms provides technical support.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides a method for regulating plant starch synthesis CeTCP14 The gene, the nucleotide sequence is shown in SEQ ID NO.1.

[0007] Preferably, the CeTCP14 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2.

[0008] The present invention provides the above technical solution CeTCP14 The application of genes in regulating plant starch synthesis.

[0009] Preferably, the regulation of plant starch synthesis comprises: increasing the CeTCP14 The expression of the gene promotes plant starch synthesis, or reduces the CeTCP14 The expression of the gene inhibits plant starch synthesis.

[0010] Preferably, the regulation of plant starch synthesis comprises: increasing the CeTCP14 The expression level of the gene is increased, or the expression level of the starch synthesis related gene is decreased. CeTCP14 The expression level of the gene is reduced to reduce the expression level of the starch synthesis related gene; the starch synthesis related gene includes: a gene encoding ADP-glucose pyrophosphorylase, a gene encoding starch branching enzyme SBE Gene, encoding granular starch synthase GBSS Gene, encoding starch synthase SS3 Gene encoding 4-α-glucanotransferase DPE1 One or more genes.

[0011] Preferably, the gene encoding ADP-glucose pyrophosphorylase includes AGPL1.1 Genes and / or GPS 1.1 Gene.

[0012] Preferably, the plant comprises tobacco or taro ( Colocasia Schott )plant.

[0013] The present invention provides a method for silencing the above technical solution. CeTCP14 The target sequence of the gene, the nucleotide sequence of the target sequence is shown as SEQ ID NO.3.

[0014] The present invention provides a method for overexpressing the above technical solution. CeTCP14 The recombinant vector of the gene comprises the CeTCP14 Gene.

[0015] The present invention provides the use of the recombinant vector described in the above technical solution in increasing the starch content of plants or cultivating transgenic plants with high starch content.

[0016] Beneficial effect: The present invention provides a method for regulating plant starch synthesis. CeTCP14The present invention has discovered a gene that can positively regulate starch synthesis in taro corms. CeTCP14 The present invention uses VIGS technology to silence genes in taro corms. CeTCP14 Gene, can significantly reduce the starch content in taro corms, and reduce the expression of starch synthesis related genes in taro corms; in addition, overexpression in tobacco CeTCP14 The gene can significantly increase the starch content in tobacco leaves and increase the expression of starch synthesis-related genes in tobacco leaves. CeTCP14 Genes play an important role in the positive regulation of plant starch synthesis. The invention can not only be applied to the biosynthesis of starch in taro, but also provide technical support for high-quality and high-yield cultivation and molecular breeding of taro, and has important economic and social benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0018] Picture 1 The taro of Example 1 CeTCP14 The result diagram of gene cloning;

[0019] Picture 2 The taro corm of Example 2 at different developmental stages CeTCP14 Result graphs of relative gene expression, starch content, bulb longitudinal diameter, bulb transverse diameter and weight;

[0020] Picture 3 is pTRV2- of Example 3 CeTCP14 Schematic diagram of some original components of the recombinant plasmid;

[0021] Picture 4 For Example 3 CeTCP14 Virus transcription levels in gene-silenced taro corms, CeTCP14 The results of the determination of relative gene expression, starch content in taro corms and relative expression of genes related to starch synthesis;

[0022] Picture 5 The standard curve diagram of starch content determination of Example 3;

[0023] Picture 6 For Example 4 CeTCP14 Figure 1. Leaf phenotype identification results of tobacco plants with transient gene overexpression.

[0024] Picture 7 For Example 4 CeTCP14 The results of the determination of starch content in tobacco leaves with transient gene overexpression;

[0025] Picture 8For Example 4 CeTCP14 The results of measuring the expression levels of starch synthesis-related genes in tobacco leaves with transient gene overexpression. DETAILED DESCRIPTION

[0026] The present invention provides a method for regulating plant starch synthesis CeTCP14 Gene, the nucleotide sequence is shown in SEQ ID NO.1, specifically as follows:

[0027]

[0028] The present invention CeTCP14 The amino acid sequence of the protein encoded by the gene is preferably as shown in SEQ ID NO.2, specifically as follows:

[0029] MGESHQHQHNHQLLHHHPPPQPARPPAHSGRLGLTGAGEIVEVQGGHIVRSTGRKDRHSKVFTAKGPRDRRVRLSAHTAIQFYDVQDRLGYDRPSKAVDWLIKNAKTAIDELAELPPWHPTATASSSKALPPSEQESPEPETTADTAGESGKRPLPAASDPVSTFGFGTSGILPPSLESDAIVDTIKSFFPVSATTGSSSSAPI GFQSYPPDLLSRTSSHGQDLRLSLQSFQDPILLHHHAPSSTHPHRNHPTSSPSEQALFSGASTALNFDASPISWSEQNQRMVAWNAAAEAGVSGGGSGGYIFTMPPPSHAVSLHPVLGQSSFLTQRGPLQSSSSPYVRAWTDALAADHQAHAPAMHHIGPSSASAIGFAAGSFSGFHIPARIQGEEEQDGVTVKPSSAASASRH.

[0030] The present invention CeTCP14 The gene is obtained from the bulb of taro and belongs to the TCP Class Ⅱ CIN subfamily. CeTCP14 The gene is a gene that can positively regulate starch synthesis in taro corms. Overexpression of the gene in plants CeTCP14 The gene can increase the expression of starch synthesis-related genes, promote plant starch synthesis, and thus increase the starch content in plants; while reducing the CeTCP14 The expression level of the gene can reduce the expression level of starch synthesis-related genes, inhibit plant starch synthesis, and thus reduce the starch content in the plant.

[0031] Based on the above advantages, the present invention provides the above technical solution CeTCP14 The application of genes in regulating plant starch synthesis. In the present invention, the plant preferably includes tobacco or taro ( Colocasia Schott ) plants; the genus Colocasia preferably includes Colocasia [ Colocasia sculenta (L). Schott]; The regulation of plant starch synthesis preferably includes: increasing CeTCP14 The expression of the gene promotes starch synthesis in plants or reduces CeTCP14 The expression of the gene inhibits starch synthesis in taro plants or increases CeTCP14 Increase the expression of starch synthesis-related genes or reduce the expression of starch synthesis-related genes in Colocasia spp. CeTCP14 The expression level of the gene is reduced to reduce the expression level of the starch synthesis related gene of the taro plant; the starch synthesis related gene preferably includes: a gene encoding ADP-glucose pyrophosphorylase, a gene encoding starch branching enzyme SBE Gene, encoding granular starch synthase GBSS Gene, encoding starch synthase SS3 Gene encoding 4-α-glucanotransferase DPE1 One or more of the genes; the gene encoding ADP-glucose pyrophosphorylase preferably includes AGPL1.1 Genes and / or GPS 1.1 Gene.

[0032] The present invention provides a method for silencing the above technical solution. CeTCP14 The target sequence of the gene, the nucleotide sequence of the target sequence is shown in SEQ ID NO.3, and is specifically as follows:

[0033] 5'-atgggggagagccaccagcaccagcacaatcaccaactactccaccaccacccgcccccgcagcccgcacggcctccggcgcactccggtaggttgggtgggctgacgggagccggggagatcgtggaggtgcaggggggccacattgtg aggtcaaccgggcgcaaggacgccacagcaaggtgttcacggccaagggcccgagggatcgccgggtccgcctctctgcccacaccgccatccagttctacgatgtccaggacgcctcggctacgatcgccccagcaaggccgtcgat-3'. The target sequence of the present invention is based on VIGS technology silencing CeTCP14 Gene target sequences can specifically silence the CeTCP14 gene, reducing the CeTCP14 The expression level of the gene.

[0034] Based on the above advantages, the present invention preferably also provides a method for silencing the above technical solution. CeTCP14 The VIGS viral vector of the gene comprises the target sequence described in the above technical solution. In the present invention, the backbone vector of the VIGS viral vector preferably comprises a pTRV2 vector; the target sequence is preferably located in the pTRV2 vector EcoR Ⅰ and BamH Between the restriction sites of Ⅰ.

[0035] Based on the above advantages, the present invention preferably provides a method for silencing the above technical solution. CeTCP14 The genetically engineered bacteria include the VIGS virus vector described in the above technical solution. In the present invention, the initial bacteria of the engineered bacteria preferably include Agrobacterium, further preferably include Agrobacterium tumefaciens, and more preferably Agrobacterium tumefaciens GV3101.

[0036] Based on the above advantages, the present invention preferably provides a method for silencing the above technical solution. CeTCP14 The infection solution of the gene preferably includes the engineered bacteria described in the above technical solution. In the present invention, the infection solution preferably also includes engineered bacteria containing auxiliary vectors; the initial bacteria of the engineered bacteria containing auxiliary vectors preferably include Agrobacterium, further preferably include Agrobacterium tumefaciens, and more preferably Agrobacterium tumefaciens GV3101; the auxiliary vector preferably includes the pTRV1 vector.

[0037] Based on the above advantages, the present invention provides a method for overexpressing the above technical solution. CeTCP14 The recombinant vector of the gene comprises the CeTCP14 In the present invention, the starting vector of the recombinant vector preferably includes the pCAMBIA1300 vector; CeTCP14 The gene is preferably located in the pCAMBIA1300 vector PST Ⅰ and Kpn Between the restriction sites.

[0038] Based on the above advantages, the present invention provides the use of the recombinant vector described in the above technical solution in increasing the starch content of plants or cultivating transgenic plants with high starch content.

[0039] To further illustrate the present invention, a CeTCP14 protein for regulating taro starch synthesis and its application provided by the present invention are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0040] Example 1 CeTCP14 Gene cloning

[0041] 1. Samples were collected from the roots, stems, leaves, flowers, petioles and corms of Ganyu No. 2 taro, and the samples were frozen at -80°C. RNA was then extracted from various tissues of the taro according to the instructions of the Polysaccharide and Polyphenol Plant RNA Extraction Kit of Nanjing Novezan Company, and finally the RNA was mixed at equal concentrations.

[0042] 2. Then, the mixed RNA obtained in step 1 was used as a template according to the reverse transcription kit Hifair Ⅲ 1 of Shanghai Yisheng Biological Company. stStrand cDNA Synthesis Kit (Genomic DNA Digestion Enhanced Edition) Instructions Reverse transcription to synthesize first-strand cDNA.

[0043] 3. Using the first-strand cDNA obtained in step 2 as a template, use the high-fidelity enzyme 2×Hieff canace Plus PCR Master Mix (containing electrophoresis indicator dye) from Shanghai Yisheng Biotechnology Co., Ltd. CeTCP14 The gene fragment was amplified by PCR. The PCR amplification system was: 19 µL of ultrapure water without RNAse, 2 µL of forward primer (10 µM), 2 µL of reverse primer (10 µM), 25 µL of 2×Hieff canace Plus PCR Master Mix (containing electrophoresis indicator dye), and 2 µL of template (100 ng / µL). The reaction conditions for PCR amplification were: 98°C pre-denaturation for 3 min; 98°C denaturation for 10 s, 59°C annealing for 20 s, 72°C extension for 1 min15 s, for a total of 34 cycles; and finally 72°C final extension for 5 min. The primer sequences were as follows: forward primer: 5'-atgggggagagccaccag-3', SEQ ID NO.4; reverse primer: 5'-tcaatggcgagaagcagaggc-3', SEQ ID NO.5.

[0044] 4. The size of the PCR amplification product obtained in step 3 is 1230 bp. The specific cloning results are as follows: Picture 1 The PCR amplification product was sequenced, and the result showed that the nucleotide sequence of the PCR amplification product was as shown in SEQ ID NO.1; and the gene was named according to its sequence in the taro TCP transcription factor gene family. CeTCP14 ; The protein encoded by this gene is named CeTCP14 protein, and the amino acid sequence of the protein is shown in SEQ ID NO.2.

[0045] Example 2 CeTCP14 Relative gene expression analysis

[0046] 1. The corms of taro plants of Ganyu No. 2 and Ganyu No. 4 at three different developmental stages were sampled respectively, and the RNA of the taro corms at three different developmental stages was extracted according to the instructions of the polysaccharide and polyphenol plant RNA extraction kit of Nanjing Novezan Company; the three different developmental stages were the early stage of taro corm expansion (denoted as S1), the middle stage of expansion (denoted as S2) and the late stage of expansion (denoted as S3); Ganyu No. 2 and Ganyu No. 4 were both disclosed in the literature [Pan Rao, Zeng Rongbin, Li Huiying, et al. Effects of drought stress during taro period on physiological characteristics of taro leaves and taro quality and yield [J]. Journal of Jiangxi Agricultural University, 2023, 45(05): 1183-1195. DOI: 10.13836 / j.jjau.2023109.].

[0047] 2. Use the RNA obtained in step 1 as a template and follow the reverse transcription kit Hifair Ⅲ1 of Yisheng Biotechnology Co., Ltd. st Strand cDNA Synthesis Kit (Genomic DNA Digestion Enhanced Edition) Instructions Reverse transcription to synthesize first-strand cDNA.

[0048] 3. Taro Actin The gene was used as an internal reference and analyzed using the fluorescence quantitative PCR kit Hieff UNICONUniversal Blue qPCR SYBR Green Master Mix from Yisheng Biotechnology Co., Ltd. CeTCP14 The relative expression of genes in taro corms. The primers for fluorescence quantitative PCR are as follows: qP_ CeTCP14 _F: 5'-ccacaccgccatccagtt-3', SEQ ID NO.6; qP_ CeTCP14 _R: 5'-cgagctcgtctatggcgg-3', SEQ ID NO.7; Actin _F: 5'-ctagtggtcgcacaacaggt-3', SEQ ID NO.8; Actin _R: 5'-ttcacgctcagcagtggtag-3', SEQ IDNO.9;

[0049] The fluorescence quantitative reaction system was: Hieff UNICON Universal Blue qPCR SYBR Green MasterMix 10 µL, forward primer (10 µM) 0.4 µL, reverse primer (10 µM) 0.4 µL, RNase-free ultrapure water 7.2 µL and cDNA template 2 µL; the fluorescence quantitative PCR reaction program included: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 10 s, annealing at 60°C for 30 s, for a total of 39 cycles, and the melting curve was between 65 and 95°C, with an increase of 0.5°C every 5 s.

[0050] 4. Fluorescence quantitative results such as Picture 2 As shown in A, where the ordinate represents CeTCP14 The relative expression of genes, the horizontal axis represents the corms of taro at different developmental stages; different letters represent significant differences, and those with one identical letter are not significantly different, and those with different letters are significantly different, with a significance level of 0.05. In addition, the starch content, corm longitudinal diameter, corm transverse diameter and corm weight of taro corms at three different developmental stages were measured. The results are shown in Picture 2 B~E in the above; the method for determining the starch content is anthrone colorimetry.

[0051] Depend on Picture 2 As can be seen from the A in the figure, taro CeTCP14 The relative expression of the gene in the corms of Ganyu 2 at three different developmental stages gradually increased, with the highest expression abundance in the S3 period. In the S3 period, the corms of Ganyu 4 did not expand. CeTCP14 The relative expression level of the gene was significantly lower than that of Ganyu 2, indicating CeTCP14 The gene is highly expressed in the late stage of taro corm development, which is also the period of starch accumulation (e.g. Picture 2 (as shown in B~E in the figure) CeTCP14 The gene is closely associated with increased starch content.

[0052] Example 3 CeTCP14 VIGS silencing of gene expression

[0053] 1. pTRV2- CeTCP14 Construction of silent expression vector

[0054] (1) Total RNA was extracted from the tubers of Ganyu No. 2 taro and reverse transcribed into cDNA. Then, the cDNA was used as a template and the pTRV2_ CeTCP14 _F and pTRV2_ CeTCP14 _R composed of homologous recombination primers for PCR amplification, to obtain CeTCP14 The PCR amplification product of the gene-specific fragment (shown in SEQ ID NO.3) was prepared by PCR reaction system: 2× Hieffcanace Plus PCR Master Mix (containing electrophoresis indicator dye) 10 μL, pTRV2_ CeTCP14 _F (10 µM) 0.4 µL, pTRV2_ CeTCP14_R (10 µM) 0.4 µL, RNase-free ultrapure water 7.2 µL and cDNA template 2 µL; PCR reaction conditions: 98°C pre-denaturation for 3 min; 98°C denaturation for 10 s, 59°C renaturation for 20 s, 72°C extension for 1 min15 s, a total of 34 cycles; and finally 72°C final extension for 5 min. The primer sequences are as follows: pTRV2_ CeTCP14 _F: 5'-gtgagtaaggttaccgaattcatgggggagagccaccag-3', SEQ ID NO. 10; pTRV2_ CeTCP14 _R: 5'-cgtgagctcggtaccggatccatcgacggccttgctggg-3', SEQ ID NO. 11.

[0055] (2) Use restriction enzymes from NEB (New England Biolabs) EcoR Ⅰ and BamH ⅠDouble restriction enzyme digestion vector pTRV2, double restriction enzyme digestion reaction system: rCutSmart Buffer 5 µL, EcoR Ⅰ 1 µL, BamH Ⅰ 1 µL, pTRV2 vector plasmid 3 µL and RNase-free ultrapure water 40 µL. Double enzyme digestion reaction conditions: 37℃ digestion for 6 h, 65℃ enzyme inactivation for 20 min

[0056] (3) Use Tiangen Biotechnology's agarose gel DNA recovery kit (enhanced) to recover the 342 bp PCR amplification product of step (1) and the 9639 bp vector backbone of step (2).

[0057] (4) Connect the PCR amplification product recovered in step (3) with the vector backbone to obtain the recombinant plasmid pTRV2- CeTCP14 , some components such as Picture 3 shown.

[0058] 2. pTRV2- CeTCP14 Obtained from Silent Taro Corm

[0059] 1) Recombinant plasmid pTRV2- CeTCP14 Introduce Agrobacterium tumefaciens GV3101 to obtain recombinant Agrobacterium 1, resuspend the recombinant Agrobacterium in VIGS solution, and obtain OD 600 =0.8 bacterial solution. 2) Introduce plasmid pTRV1 into Agrobacterium GV3101 to obtain recombinant Agrobacterium 2, resuspend the recombinant Agrobacterium with VIGS solution, and obtain OD 600=0.8 bacterial solution. 3) Introduce plasmid PTRV2 into Agrobacterium GV3101 to obtain recombinant Agrobacterium 3, resuspend the recombinant Agrobacterium with VIGS solution, and obtain OD 600 =0.8 bacterial solution. The preparation method of VIGS resuspension solution is: add 10 mM 2-morpholineethanesulfonic acid, 200 µM acetosyringone and 10 mM MgCl2 to MS culture medium. 4) Prepare two infection solutions respectively: mix the bacterial solution obtained in step 1) and the bacterial solution obtained in step 2) in equal volumes to obtain the infection solution of the test group; then mix the bacterial solution obtained in step 3) and the bacterial solution obtained in step 2) in equal volumes to obtain the infection solution of the negative control group, and the mixed bacterial solution is revived in the dark for 4~6 h. 5) Dig up mature and fresh Ganyu No. 2 taro corms, select small corms with a diameter of 2~4 cm, wash the surface soil with distilled water, and then point the small corms on the substrate soil, culture at 25℃ and 2000Lx light intensity (16 h light / 8 h dark), and keep the soil moist. When green buds emerge from the surface of the small corms and drill out of the soil layer, they can be used for VIGS infection solution infection. 6) Use a sterilized toothpick to poke a small hole on the surface of the taro corms with green buds obtained in step 5), and then divide them into two groups and immerse them in the infection solution of the test group and the infection solution of the negative control group obtained in step 4), and then place them in a vacuum pump for 20 minutes of vacuum treatment. Then wipe the infection solution on the surface of the taro corms with sterilized filter paper, and then bury them in sterilized matrix soil and culture them at 25℃ and 2000Lx light intensity (16 h light / 8 h dark). 7) After 5 days, dig out the taro corms of the negative control group and the test group from the sterile soil, wash the surface soil with distilled water, peel off the skin, and sample the flesh of the corms for determining the tuber starch content and extracting total RNA. 8) Take the tuber sample from step 7), extract total RNA and reverse transcribe it into cDNA, use cDNA as template, and use primers pTVR1_F / pTRV1_R and pTRV2_F / pTRV2_R to perform reverse transcription on untreated, pTRV-free and pTRV- CeTCP14 The TRV1 and TRV2 viral transcription products in the treated corms were identified by PCR. pTVR1_F: 5'-cgtgttgcatttcgatgaa-3', SEQ ID NO.12; pTRV1_R: 5'-gacaacgccacgattaagt-3', SEQ ID NO.13; pTRV2_F: 5'-tgtcaacaaagatggacattgttac-3', SEQ ID NO.14; pTRV2_R: 5'-acacggatctacttaaagaa-3', SEQ ID NO.15;

[0060] The PCR product was subjected to agarose gel electrophoresis. If a specific band was obtained, the bulb sample to be tested was identified as positive. Picture 4 As shown in A in the figure, Untreated is the untreated group. No target band was detected in the untreated bulbs, and the PCR product of the bulbs treated with no load was 198 bp. CeTCP14 The gene-silenced fragment was inserted into the pTRV2 vector, so pTRV- CeTCP14 The PCR product of the treated bulblets was 480 bp.

[0061] 9) Take the bulb sample identified as VIGS positive in step 8), extract total RNA, and detect it using the method in Example 2 CeTCP14 The expression of genes in VIGS silenced bulbs. Picture 4 As shown in B, ** indicates P <0.01. Compared with pTRV-unloaded treatment, pTRV- CeTCP14 In the treated taro corm CeTCP14 The relative gene expression level decreased significantly.

[0062] 3. pTRV- CeTCP14 Determination of starch content in the corm of Taro

[0063] The starch content of VIGS-infected taro corms was determined using the anthrone colorimetric method. First, the tuber samples frozen in liquid nitrogen were taken and ground into fine powder using a high-speed sample grinder. 0.5 g of each sample was weighed into a 10 ml centrifuge tube, and 5-6 ml of 80% ethanol solution was added. The tuber was incubated in a water bath at 80°C for 30 min. After the solution was cooled to room temperature, it was centrifuged at 3500 rpm for 10 min. The supernatant was transferred to a 25 ml volumetric flask, and the operation was repeated twice. Then add 2 ml of distilled water to the precipitate, gelatinize in a boiling water bath for 15 min, add 2 ml of 9.2 mol / L HClO4 after cooling, oscillate and mix for 15 min, then add 4 ml of distilled water, mix, centrifuge at 4000 rpm for 10 min, and transfer the supernatant to a 50 ml volumetric flask; then add 2 ml of 4.6 mol / L HClO4 to the precipitate, oscillate and extract for 15 min, add 5 ml of distilled water, mix and centrifuge for 10 min, and combine the supernatants; then wash the precipitate twice with distilled water, 5-6 ml each time, centrifuge at 4000 rpm for 10 min, combine the supernatants into a volumetric flask, and make up to the mark with distilled water.

[0064] Dilute the starch extract obtained by distilled water 25 times and take 2 ml into a 10 ml centrifuge tube and perform the same operation as the standard tube. Perform the operation on the standard tube and sample tube according to the reagent usage in Table 1, and then place them in a 100℃ water bath and heat them for 10 minutes. After taking them out, cool them to room temperature with tap water and measure the absorbance at a wavelength of 620 nm (optical path 0.5 cm). Draw a standard curve with absorbance as the ordinate and glucose content as the abscissa, and calculate the starch content according to formula I.

[0065] Formula I;

[0066] In formula I, C: the amount of glucose in the sample test tube obtained from the standard curve (µg); Vt: the total volume of the sample extract (ml); n: the dilution factor; W: the dry weight of the sample (mg); Vs: the sampling volume during the measurement (ml); 1000: the conversion factor, 1mg=1000µg.

[0067] Determine the standard curve as Picture 5 As shown, the standard curve is: y=0.00198+0.00111x, R 2 =0.9976. The starch content determination results are as follows Picture 4 As shown in C, ** indicates P <0.05. Compared with pTRV-unloaded treatment, pTRV- CeTCP14 The starch content in taro corms decreased significantly under the treatment.

[0068] Table 1 Preparation of standard curve

[0069]

[0070] 4. pTRV- CeTCP14 Analysis of the expression of starch metabolism-related genes in the corms of Silent Colocasia esculenta

[0071] a. Take the taro corm sample in step 9) of step 2 above, extract the total RNA of the taro corm according to the method in Example 2, then reverse transcribe and synthesize the first-strand cDNA, and Actin The gene was used as an internal reference to detect the expression of genes related to taro starch synthesis.

[0072] b. Screening the transcriptome data of Ganyu 2 taro tubers identified differentially expressed starch metabolism-related genes in taro tubers, including the gene EVM0007090.1 encoding ADP-glucose pyrophosphorylase ( CeAGPL1.1 ) and EVM0014895.1 ( CeAGPS1.1 ), the gene EVM0024297.1 encoding starch branching enzyme ( CeSBE), the gene EVM0018773.1 encoding granular starch synthase ( CeGBSS ), encoding starch synthase EVM0022361.1 ( CeSS3 ) and the gene encoding 4-α-glucanotransferase EVM0020065.1 ( CeDPE1 ); The fluorescent quantitative primers for the above genes are designed as follows:

[0073] qP_CeAGPL1.1_F: 5'-acccgaagaacgtggcag-3', SEQ ID NO.16;

[0074] qP_CeAGPL1.1_R: 5'-ggggaacagcaggctcag-3', SEQ ID NO.17;

[0075] qP_CeAGPS1.1_F: 5'-gagaagggccaccgcttt-3', SEQ ID NO.18;

[0076] qP_CeAGPS1.1_R: 5'-tcccttgccctctcgtca-3', SEQ ID NO.19;

[0077] qP_CeSBE_F: 5'-catcgcagggatccgctt-3', SEQ ID NO. 20;

[0078] qP_CeSBE_R: 5'-tggcacccttcctcgaga-3', SEQ ID NO. 21;

[0079] qP_CeGBSS_F: 5'-gggtttgcctcctgcctt-3', SEQ ID NO. 22;

[0080] qP_CeGBSS_R: 5'-ccggtatcccatgcgtcc-3', SEQ ID NO. 23;

[0081] qP_CeSS3_F: 5'-gcacaaggtctggagcca-3', SEQ ID NO. 24;

[0082] qP_CeSS3_R: 5'-ttgctccatcacccgctg-3', SEQ ID NO. 25;

[0083] qP_CeDPE1_F: 5'-tttcgacgtcggggttgg-3', SEQ ID NO. 26;

[0084] qP_CeDPE1_R: 5'-tggagagaggtcgggtgg-3', SEQ ID NO. 27.

[0085] The above fluorescence quantitative PCR reaction system and procedure are consistent with those in Example 2.

[0086] The results are as follows Picture 4 D~I in the figure, * indicates P <0.05, ** indicates P <0.01, *** indicates P <0.001. Compared with the pTRV empty vector treatment, the above key genes involved in starch synthesis were all in the pTRV- CeTCP14 The expression of taro corms was significantly downregulated under the treatment, and this conclusion was consistent with the results of starch content determination.

[0087] Example 4 CeTCP14 Transient overexpression of

[0088] 1. Recombinant vector

[0089] Overexpression CeTCP14 The recombinant vector pCAMBIA1300- CeTCP14 The construction method is as follows:

[0090] Total RNA was extracted from the tubers of Ganyu No. 2 taro and reverse transcribed into cDNA. Then, the cDNA was used as a template and the pCAMBIA1300_ CeTCP14 _F and pCAMBIA1300_ CeTCP14 _R primer pair was used for PCR amplification to obtain the amplified product; the primer sequences are as follows: pCAMBIA1300_ CeTCP14 _F: 5'-gactctagaaagcttctgcagatgggggagagccaccagca-3', SEQ ID NO. 28; pCAMBIA1300_ CeTCP14 _R: 5'-gcccttgctcaccatggtaccatggcgagaagcagaggcag-3', SEQ ID NO.29; using restriction endonuclease PST Ⅰ and Kpn Ⅰ Double restriction enzyme digestion of vector pCAMBIA1300 to obtain a linearized vector; connect the amplified product and the linearized vector to obtain a recombinant vector pCAMBIA1300- CeTCP14 .

[0091] 2. Recombinant Agrobacterium

[0092] The recombinant vector pCAMBIA1300- CeTCP14 The recombinant Agrobacterium pCAMBIA1300- CeTCP14 -GV3101.

[0093] 3. Agrobacterium-mediated transient overexpression in tobacco leaves

[0094] (1) Activation of Agrobacterium: Activate pCAMBIA1300- CeTCP14 -GV3101 and pCAMBIA1300 were streaked overnight, and then well-growing plaques were selected and added to 10 mL of LB liquid culture medium containing 50 µg / mL kanamycin and 25 µg / mL rifampicin antibiotics, and the culture was shaken at 28°C and 200 rpm.

[0095] (2) Expand the culture of the strain: Take 200 µL of the Agrobacterium from step (1) and add it to 50 mL of LB liquid culture medium (containing 50 µg / mL kanamycin and 25 µg / mL rifampicin antibiotics). Continue to culture at 28°C and 200 rpm until the OD reaches 0. 600 =0.8.

[0096] (3) Add 50 ml of Agrobacterium that has been shaken overnight to an appropriate concentration into a centrifuge tube, centrifuge at 6000 rpm for 8 min, remove the supernatant, and add the invasion dye to dilute the bacterial solution to OD 600 The infection solution is MS liquid culture medium, and contains only 10 mM magnesium chloride, 10 mM 2-morpholineethanesulfonic acid and 200 µM acetosyringone.

[0097] (4) Use a 1 mL needle-free disposable syringe to draw up the mixed infection solution and inject the bacterial solution from the back of the tobacco leaves. After the injection, place the leaves in the dark for 12 to 16 hours, then transfer to 8 hours of darkness / 16 hours of light and culture at 25°C for 2 to 3 days.

[0098] 4. CeTCP14 Phenotypic identification of tobacco leaves with transient gene overexpression

[0099] The tobacco leaves were placed under GFP green fluorescence (LUYOR-3280RB fluorescent flashlight) with an excitation wavelength of 520-530 nm for observation 2-3 days after infection. Picture 6 As shown, it can be found that compared with the uninfected tobacco leaves group (NC), the tobacco leaves of the pCAMBIA1300 empty vector infection group (PC) showed very strong green fluorescence signals. CeTCP14 Infection group (OE- CeTCP14) in tobacco leaves, green fluorescence signals were also observed, indicating that transient overexpression in tobacco leaves reached the overexpression level. CeTCP14 The effect of genes.

[0100] 5. CeTCP14 Analysis of relative gene expression

[0101] The fluorescence quantitative method in step 3 of Example 2 was used to quantify the pCAMBIA1300 empty-infected group (CK) and pCAMBIA1300- CeTCP14 Infection group (OE-TCP14) tobacco leaves CeTCP14 The relative expression of genes was analyzed, and the results are shown in Table 2. It can be found that compared with the CK control, transient overexpression CeTCP14 Genes in tobacco samples CeTCP14 The relative expression of genes increased significantly.

[0102] Table 2 CeTCP14 Relative expression

[0103]

[0104] 6. Determination of starch content in transient overexpression tobacco leaves

[0105] The starch content of transiently overexpressed tobacco leaves was determined using the starch determination method in step 3 of Example 3. The results are as follows: Figure 7 As shown, ** indicates P <0.01. Figure 7 It can be seen that compared with CK, transient overexpression CeTCP14 The starch content in tobacco leaves with the gene was significantly increased, indicating CeTCP14 Genes that promote starch accumulation.

[0106] 7. Analysis of the expression of starch synthesis-related genes in transiently overexpressed tobacco leaves

[0107] The same method as in Example 2 was used to extract total RNA from tobacco leaves, and then reverse transcribed to synthesize first-strand cDNA. NtActin Gene was used as internal reference to detect the expression of starch synthesis related genes, including gene NtAGPL1.1 (XM_016597192.1), NtAGPS1.1 (XM_016594199.1), Nb (XM_016654315.1), Nbq (XM_016577487.1), NtS3 (XM_016632243.1) and NtDPE1 (XM_016626765.1). The primer sequences are as follows: <h2 style=";text-align:left;direction:ltr">

[0108] <h2 style=";text-align:left;direction:ltr"> qP_NtActin_F:5'-tggcatcacactttctacaa-3',SEQ ID NO.30;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0109] <h2 style=";text-align:left;direction:ltr"> qP_NtActin_R:5'-caacggaatctctcagctcc-3',SEQ ID NO.31;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0110] <h2 style=";text-align:left;direction:ltr"> qP_NtAGPL1.1_F:5'-tggccattacccggggta-3',SEQ ID NO.32;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0111] <h2 style=";text-align:left;direction:ltr"> qP_NtAGPL1.1_R:5'-ccggaagccaaacccctt-3',SEQ ID NO.33;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0112] <h2 style=";text-align:left;direction:ltr"> qP_NtAGPS1.1_F:5'-acagcgacaatgttcaagaagc-3',SEQ ID NO.34;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0113] <h2 style=";text-align:left;direction:ltr"> qP_NtAGPS1.1_R:5'-ttggaggacaaccaagttccaa-3',SEQ ID NO.35;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0114] <h2 style=";text-align:left;direction:ltr"> qP_NtSBE_F:5'-gcggaaagtcatgatcaagctc-3',SEQ ID NO.36;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0115] <h2 style=";text-align:left;direction:ltr"> qP_NtSBE_R:5'-gggaaatcaatccactcaggt-3',SEQ ID NO.37;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0116] <h2 style=";text-align:left;direction:ltr"> qP_NtGBSS_F:5'-ccctcgcgtttgctgaga-3',SEQ ID NO.38;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0117] <h2 style=";text-align:left;direction:ltr"> qP_NtGBSS_R:5'-ccccttcaacaccggctt-3',SEQ ID NO.39;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0118] <h2 style=";text-align:left;direction:ltr"> qP_NtSS3_F:5'-tcacgcggctttggagtt-3',SEQ ID NO.40;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0119] <h2 style=";text-align:left;direction:ltr"> qP_NtSS3_R:5'-ccacgcaacaggagcact-3',SEQ ID NO.41;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0120] qP_NtDPE1_F: 5'-agtgaagctggtcaactatggg-3', SEQ ID NO.42;

[0121] qP_NtDPE1_R: 5'-acagcccaaaatccagcaaatc-3', SEQ ID NO. 43.

[0122] The results are as follows Figure 8 As shown, * indicates P <0.05, ** indicates P <0.01. It can be found that VIGS silencing CeTCP14 The same thing is that the starch synthesis-related genes mentioned above are transiently overexpressed CeTCP14 Up-regulated expression in tobacco leaves indicates overexpression CeTCP14 The gene can promote starch accumulation by upregulating the expression of starch synthesis-related genes.

[0123] In summary, silence in taro corms CeTCP14 Gene reduces starch content in bulbs and is transiently overexpressed in tobacco leaves CeTCP14 The gene can increase the starch content, and this process is achieved by positively regulating starch synthesis-related genes, indicating that CeTCP14 Genes play an important role in regulating the synthesis of taro starch. The invention can not only be applied to the biosynthesis of taro starch, but also provide technical support for high-quality and high-yield cultivation and molecular breeding of taro, and has important economic and social benefits.

[0124] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. CeTCP14 Application of genes in regulating plant starch synthesis, the CeTCP14 The nucleotide sequence of the gene is shown in SEQ ID NO.

1. CeTCP14 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2; the plant is tobacco or taro ( Colocasia Schott )plant.

2. The use according to claim 1, characterized in that: The regulating plant starch synthesis comprises: increasing the CeTCP14 The expression of the gene promotes plant starch synthesis, or reduces the CeTCP14 The expression of the gene inhibits plant starch synthesis.

3. The use according to claim 1, characterized in that: The regulating plant starch synthesis comprises: increasing the CeTCP14 The expression level of the gene is increased, or the expression level of the starch synthesis related gene is decreased. CeTCP14 The expression level of the gene is reduced to reduce the expression level of the starch synthesis related gene; the starch synthesis related gene includes: a gene encoding ADP-glucose pyrophosphorylase, a gene encoding starch branching enzyme SBE Gene, encoding granular starch synthase GBSS Gene, encoding starch synthase SS3 Gene encoding 4-α-glucanotransferase DPE1 One or more genes.

4. The use according to claim 3, characterized in that: The gene encoding ADP-glucose pyrophosphorylase includes AGPL1.1 Genes and / or GPS1.1 Gene.

5. The use according to claim 1, characterized in that: The taro plant is taro [ Colocasia sculenta (L).Schott].

6. Use of a recombinant vector for increasing starch content in plants or cultivating transgenic plants with high starch content, wherein the recombinant vector is an overexpression vector. CeTCP14 A recombinant vector of a gene, the recombinant vector comprising CeTCP14 gene; CeTCP14 The nucleotide sequence of the gene is shown in SEQ ID NO.

1. CeTCP14 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2; the plant is tobacco or taro ( Colocasia Schott )plant.

7. The use according to claim 6, characterized in that: The taro plant is taro [ Colocasia sculenta (L).Schott].

Images