Combined molecular markers and detection primer sets for resistance to visceral sarcoidosis in Cynoglossus semilaevis and their applications

Abstract

The present invention belongs to the technical field of molecular breeding of aquatic animals, and specifically relates to a combined molecular marker and a detection primer set for the resistance trait of half-smooth tongue sole to visceral sarcoidosis and an application thereof. The combined molecular marker is a P located upstream of Phosphoinositide-3-kinase, regulatory subunit 3b in the genome of half-smooth tongue sole. 879 site and P downstream of the E3 ubiquitin‑protein ligase TRIM8 818 The combined molecular markers and KASP detection primers of the present invention can be used to detect the genotype of the corresponding locus and to screen breeding materials of half-smooth tongue sole, which is of great significance for accelerating the breeding of half-smooth tongue sole resistant to visceral sarcoidosis.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular breeding of aquatic animals, and particularly relates to a combined molecular marker and a detection primer set for the resistance trait of Semilaevis semilaevis to visceral sarcoidosis and an application thereof. Background Art

[0002] Cynoglossus semilaevis Cynoglossus semilaevis ) is an important marine economic aquaculture fish in northern and southeastern my country. In recent years, marine mycobacterium ( Mycobacterium marinum ) causes huge economic losses to the farming industry of Semi-smooth Tongue Sole. The disease mainly attacks the internal organs of fish, causing nodules to form, and ultimately leading to organ dysfunction and high mortality. The prevalence of visceral sarcoidosis not only reduces the output and economic benefits of aquaculture, but also increases the cost of management and treatment. At present, the prevention and control of visceral sarcoidosis mainly relies on antibiotic treatment and environmental control. However, marine mycobacteria have strong drug resistance and environmental adaptability, which makes traditional prevention and control methods limited in effect. Faced with these challenges, finding more effective prevention and control measures has become an urgent task in the field of aquaculture.

[0003] Molecular marker technology plays an increasingly important role in aquatic genetic breeding. Through molecular markers, individuals with excellent traits can be quickly and accurately identified and selected, thereby accelerating the breeding process and improving breeding efficiency. Especially in disease-resistant breeding, molecular markers can help researchers locate and identify key genes or genomic regions related to disease resistance, providing an important basis for molecular breeding. Genome-wide association studies (GWAS) are commonly used molecular marker development methods, through which a large number of single nucleotide polymorphisms (SNPs) associated with target traits can be discovered. These molecular markers not only provide new tools for disease-resistant breeding, but also lay the foundation for a deeper understanding of disease resistance mechanisms.

[0004] KASP (Kompetitive Allele Specific PCR) is a high-throughput genotyping technology based on competitive allele-specific PCR. Compared with traditional genotyping methods, KASP has the advantages of high sensitivity, high specificity and high throughput, and is suitable for genotyping and marker-assisted selection of large-scale samples. Using KASP detection technology, individuals carrying specific disease-resistant molecular markers can be quickly screened out, thereby improving breeding efficiency and accuracy. In the research on breeding for visceral sarcoidosis resistance in half-smooth tongue sole, the development and application of a molecular marker system based on KASP detection will not only help accelerate the selection of disease-resistant varieties, but also provide reference and reference for disease-resistant breeding of other aquatic animals. Summary of the invention

[0005] The invention aims to provide a combined molecular marker for the resistance trait of Semilaevis semilaevis to visceral sarcoidosis, a KASP detection primer set and application thereof.

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] A combined molecular marker for resistance to visceral sarcoidosis in Cynoglossus semilaevis, the combined molecular marker being P located upstream of Phosphoinositide-3-kinase, regulatory subunit 3b in the genome of Cynoglossus semilaevis 879 site and P downstream of E3ubiquitin-protein ligase TRIM8 818 Location.

[0008] The P 879 The locus is located at base 33,214,879 of chromosome 1 of the semi-smooth tongue sole genome, and the genotype of the locus is G / T; the P 818 The site is located at base 18,051,818 of chromosome 12 of the semilaevis genome, and the genotype of the site is A / C.

[0009] An application of the combined molecular markers for the resistance traits of Semilaevis semilaevis to visceral sarcoidosis, and an application of the combined molecular markers in molecular breeding of Semilaevis semilaevis for visceral sarcoidosis.

[0010] When P 879 Site and P 818 When the genotype combination of the locus is G / G and A / C, it is a Semilaevis semilaevis individual with stronger resistance to visceral sarcoidosis.

[0011] A primer set for detecting the combined molecular markers of the resistance trait of Cynoglossus semilaevis to visceral sarcoidosis, the primer set is composed of a detection P 879 Primer set for locus genotype and detection P 818 Primer set composition for locus genotyping:

[0012] The detection P 879 The primer sets for locus genotyping are as follows:

[0013] 33,214,879F1: GAAGGTGACCAAGTTCATGC TTATTGAAACCTGCATCAGAAAAAGG;

[0014] 33,214,879F2: GAAGGTCGGAGTCAACGGAT TTATTGAAACCTGCATCAGAAAAAGT;

[0015] 33,214,879R:TATGGTTCTACGTAGATAATGAGCAAATC;

[0016] The detection P 818 The primer sets for locus genotyping are as follows:

[0017] 18,051,818F1: GAAGGTGACCAAGTTCATGC TGATTTGCACTTGTCTCCTCTTATCC;

[0018] 18,051,818F2: GAAGGTCGGAGTCAACGGAT TGATTTGCACTTGTCTCCTCTTATCA;

[0019] 18,051,818R:AGGTTTCCACCTGCTCAAACTCAAATCAC.

[0020] The SNP site corresponding to the 3' end of the primer set 33,214,879F1 / 33,214,879F2 is the upstream P of Phosphoinositide-3-kinase, regulatory subunit 3b in the genome of Semilaevis semilaevis. 879 The site (corresponding to the 100th nucleotide of SEQ ID NO.1 in the sequence listing), wherein the underlined portion of the 33,214,879F1 primer is a FAM fluorescence-specific label sequence, and the underlined portion of the 33,214,879F2 primer is a HEX fluorescence-specific label sequence.

[0021] The SNP site corresponding to the 3' end of the primer set 18,051,818F1 / 18,051,818F2 is a P downstream of the E3 ubiquitin-protein ligase TRIM8 in the semilaevis genome. 818 Site (corresponding to the 100th nucleotide of SEQ ID NO.2 in the sequence listing), wherein the underlined portion of the 18,051,818F1 primer is a FAM fluorescent specific label sequence, and the underlined portion of the 18,051,818F2 primer is a HEX fluorescent specific label sequence.

[0022] An application of a primer set for combined molecular markers of half-smooth tongue sole resistance to visceral sarcoidosis, and an application of the primer set in the preparation of a kit for detecting half-smooth tongue sole resistance to visceral sarcoidosis.

[0023] A kit comprises the primer set.

[0024] The molecular marker combination, primer set or kit is used in the molecular detection of resistance traits of Semilaevis semilaevis to visceral sarcoidosis.

[0025] Application of the molecular marker combination, primer set or kit in molecular genetic breeding of Semilaevis semilaevis.

[0026] The molecular marker combination, primer set or kit is used in the breeding of Cynoglossus semilaevis resistant to visceral sarcoidosis.

[0027] A method for detecting the resistance of Cynoglossus semilaevis to visceral sarcoidosis:

[0028] (1) Obtaining genomic DNA of the sample to be tested;

[0029] (2) using the genomic DNA as a template and performing PCR amplification using the primer set;

[0030] (3) Collect the fluorescent signals generated by each reaction well, determine the genotype of the SNP marker site based on the type of fluorescent signal, and then determine the resistance of Semilaevis semilaevis to visceral sarcoidosis.

[0031] P 879 Fluorescence detection of genotype at the locus:

[0032] If only FAM fluorescence is detected, then P 879 The locus is homozygous for the G / G genotype;

[0033] If only HEX fluorescence is detected, P 879 The locus is T / T homozygous genotype;

[0034] If both FAM and HEX fluorescence are detected, P 879 The locus is G / T heterozygous.

[0035] P 818 Fluorescence detection of genotype at the locus:

[0036] If only FAM fluorescence is detected, then P 818 The locus is C / C homozygous genotype;

[0037] If only HEX fluorescence is detected, P 818 The locus is A / A homozygous genotype;

[0038] If both FAM and HEX fluorescence are detected, P 818 The locus is A / C heterozygous.

[0039] The present invention provides a combined molecular marker for the resistance of Cynoglossus semilaevis to visceral sarcoidosis, a KASP detection primer and an application thereof. 879site and P downstream of E3ubiquitin-protein ligase TRIM8 818 Among them, P 879 The SNP genotype of the site is G / T, P 818 The SNP genotype of the site is A / C. 879 Site and P 818 When the genotype combinations of the locus were G / G and A / C, the half-smooth tongue sole had a stronger resistance to visceral sarcoidosis. 879 Site and P 818 When the genotype combination of the locus is other types, the resistance to visceral sarcoidosis is weak. This combination of molecular markers and KASP detection primers can be used to detect P 879 Site and P 818 The locus genotype is used for the screening of breeding materials of half-lazy tongue sole, which is of great significance for the breeding of new half-lazy tongue sole strains resistant to visceral sarcoidosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 P 879 Site and P 818 Manhattan plot of locus GWAS analysis.

[0041] Figure 2 200 half-smooth tongue soles P provided by the embodiment of the present invention 879 Results of fluorescence detection of locus genotypes. Yellow represents negative quality control, blue represents individuals with genotype G / G, and red represents individuals with genotype G / T.

[0042] Figure 3 200 half-smooth tongue soles P provided by the embodiment of the present invention 818 Results of fluorescence detection of locus genotypes. Yellow represents negative control, blue represents individuals with genotype A / C, and red represents individuals with genotype A / A. DETAILED DESCRIPTION

[0043] The following embodiments are provided to further illustrate the present invention rather than to limit the present invention.

[0044] The combined molecular marker of the present invention is located in the upstream of Phosphoinositide-3-kinase, regulatory subunit 3b of the semi-smooth tongue sole genome. 879 site and P downstream of the E3 ubiquitin-protein ligase TRIM8 818 P 879 The locus is a G / T type SNP marker, P 818 The site is an A / C type SNP marker. This combined molecular marker is detected using KASP genotyping technology.879 Site and P 818 When the genotype combinations of the locus were G / G and A / C, the half-smooth tongue sole had a stronger resistance to visceral sarcoidosis. 879 Site and P 818 When the genotype combination of the locus is other types, the resistance to visceral sarcoidosis is weak. The combined molecular markers and KASP detection primers can be used to detect the genotypes of the corresponding loci and to screen breeding materials of half-smooth tongue sole, which is of great significance for accelerating the breeding of half-smooth tongue sole resistant to visceral sarcoidosis.

[0045] Example 1

[0046] Obtaining molecular markers related to resistance to visceral sarcoidosis in Semilaevis semilaevis.

[0047] (1) Sample collection and trait testing of Cynoglossus semilaevis

[0048] 1500 Cynoglossus semilaevis (14.53 ± 1.71 g) were purchased from Yantai Haiyang Yellow Sea Aquatic Products Co., Ltd. for visceral sarcoidosis resistance trait testing. Before the trait testing began, the experimental fish were temporarily kept in a sterile seawater culture tank for 7 days, the seawater temperature was controlled at 25 ± 3 °C, and the compound feed was fed twice a day. 100 μL of 5×10 6 All half-smooth tongue soles were infected with marine mycobacterium at CFU / mL by intraperitoneal injection. Fin ray tissues of dying individuals were collected every day during the experiment and stored at -80°C. After the experiment lasted for 22 days, no dead individuals were found. The resistance of half-smooth tongue sole to visceral sarcoidosis was then defined as a binary state (dead or alive). At the end of the experiment, a total of 682 susceptible materials and 275 resistant materials were collected, totaling 957 materials.

[0049] (2) Genome-wide association study (GWAS) to identify SNPs associated with resistance to visceral sarcoidosis in Cynoglossus semilaevis

[0050] 150 susceptible materials and 150 resistant materials were selected for DNA extraction. After extraction, the second-generation resequencing Illumina library was constructed and sequenced with the PE150 strategy. The sequencing volume of each sample was 5Gb. The original sequence was filtered by FastQC (v 0.12.1) and all clean reads were aligned with the reference genome of Cynoglossus semilaevis. GATK (v 3.8) was used to search for SNPs for each sample, and the minimum allele frequency (MAF) > 5% and missing data < 20% were used as the filtering thresholds to screen high-quality SNPs. The EMMAX mixed linear model was used to perform association analysis on all SNP loci, and the candidate loci screened by the trait association analysis were corrected using Bonrroni.

[0051] (3) Mining of molecular markers related to anti-visceral sarcoidosis

[0052] The SNP sites obtained by genome-wide association analysis were p The values ​​were arranged to screen the SNP sites significantly associated with resistance to visceral sarcoidosis. The results showed that the P upstream of Phosphoinositide-3-kinase, regulatory subunit 3b in the genome of Semi-smooth Tongue Sole 879 site and P downstream of the E3 ubiquitin-protein ligase TRIM8 818 The locus was significantly associated with anti-mycobacterial traits, P 879 Site and P 818 Site p The values ​​are 5.37E-07 and 2.33E-06 respectively. 879 Site and P 818 The site and upstream and downstream sequences are shown in SEQ ID NO.1 and SEQ ID NO.2, and [] is the marked SNP site.

[0053] The sequence shown in SEQ ID NO.1 is as follows:

[0054] TCTGACCTAAAAGGCCAATTTAACACTTTCCACCACATAAATGTACAATATACCCAGTTTGGATGCTCAGGGGAATATTGAAACCTGCATCAGAAAAAG[G / T]GTGCAGGATTTGCTCATTATCTACGTAGAACCATAATGACAGGGTTTACCATCAGAGAACTGCAAAAAAAAAAAAAAATGTAGCTATATATCAATGCTGC.

[0055] The sequence shown in SEQ ID NO.2 is as follows:

[0056] GTTGCCCCCTCCTTTGGTCAGCTGGTGTCCTGCCAGTCTATTCTTGGCCCCTTTTATCTTCCCCTGTTCCTAATAAGATTTGCACTTGTCTCCTCTTATC[C / A]TTCTTCTGTGATTTGAGTTTGAGCAGGTGGAAACCTTCTCTTACCGTATGTGCAGCTACAACTCTGCACAATTTAATTCAGTGGGTTCAGTAAGTGCTTT.

[0057] GWAS analysis results showed that when individual P 879 Site and P818 When the genotypes of the loci were G / G and A / C, the half-smooth tongue sole had a stronger resistance to visceral sarcoidosis. 879 Site and P 818 When the genotype combination of the locus is other types, the resistance to visceral sarcoidosis is weaker.

[0058] Example 2

[0059] Design of primers for detecting KASP molecular marker loci for resistance of Semilaevis semilaevis to visceral sarcoidosis.

[0060] According to the P upstream of Phosphoinositide-3-kinase, regulatory subunit 3b in the genome of Cynoglossus semilaevis, 879 site and P downstream of the E3 ubiquitin-protein ligase TRIM8 818 Specific KASP primer sets were designed based on the upstream and downstream sequences of the site.

[0061] Detection of P 879 The sequences of the primer combinations for locus genotyping are as follows:

[0062] 33,214,879F1: GAAGGTGACCAAGTTCATGC TTATTGAAACCTGCATCAGAAAAAGG(SEQ IDNO.3);

[0063] 33,214,879F2: GAAGGTCGGAGTCAACGGAT TTATTGAAACCTGCATCAGAAAAAGT(SEQ IDNO.4);

[0064] 33,214,879R:TATGGTTCTACGTAGATAATGAGCAAATC (SEQ ID NO. 5).

[0065] The 3' end of primers 33214879F1 / 33214879F2 corresponds to the SNP site located upstream of Phosphoinositide-3-kinase, regulatory subunit 3b in the genome of Cynoglossus semilaevis. 879 Site, wherein the underlined portion of the primer 33,214,879F1 is a FAM fluorescent specific label sequence, and the underlined portion of the primer 33214879F2 is a HEX fluorescent specific label sequence.

[0066] Detection of P 818 The sequences of the primer combinations for locus genotyping are as follows:

[0067] 18,051,818F1: GAAGGTGACCAAGTTCATGCTGATTTGCACTTGTCTCCTCTATCC(SEQ IDNO.6);

[0068] 18,051,818F2: GAAGGTCGGAGTCAACGGAT TGATTTGCACTTGTCTCCTCTATCA(SEQ IDNO.7);

[0069] 18,051,818R: AGGTTTCCACCTGCTCAAACTCAAATCAC (SEQ ID NO. 8).

[0070] The 3' end of primers 18,051,818F1 / 18,051,818F2 corresponds to the SNP site located downstream of the E3 ubiquitin-protein ligase TRIM8 in the semilaevis genome. 818 Site, wherein the underlined portion of the 18,051,818F1 primer is a FAM fluorescence-specific tag sequence, and the underlined portion of the 18,051,818F2 primer is a HEX fluorescence-specific tag sequence.

[0071] Example 3

[0072] KASP detection of KASP molecular marker loci for resistance to visceral sarcoidosis in Cynoglossus semilaevis.

[0073] The method for detecting the combined molecular marker KASP using the primer set designed in the above Example 2 comprises the following steps:

[0074] (1) Extraction of genomic DNA from Cynoglossus semilaevis

[0075] The dorsal fin tissue of Cynoglossus semilaevis was cut and the genomic DNA of Cynoglossus semilaevis was extracted using the Marine Animal Genome Extraction Kit (Takara, Japan).

[0076] (2) Establishment of KASP genotyping amplification system

[0077] Phosphoinositide-3-kinase, regulatory subunit 3b upstream of the Cynoglossus semilaevis genome 879 site and P downstream of the E3 ubiquitin-protein ligase TRIM8 818 The KASP amplification system for site detection is shown in Table 1. FLU-ARMS for KASP 2x PCR Mix was purchased from Guangzhou Good Biotechnology Co., Ltd., and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0078] Table 1. KASP amplification system for detecting SNP sites in the genome of Cynoglossus semilaevis

[0079]

[0080] (3) KASP genotyping amplification procedure

[0081] KASP genotyping was performed using a QS1 real-time fluorescence quantitative PCR instrument (Thermo Fisher Scientific, USA). The amplification conditions are shown in the following table:

[0082] Table 2. KASP genotyping amplification program

[0083]

[0084] (4) Plate reading test

[0085] After the amplification program is completed, the amplified products on the PCR plate are directly scanned. The FAM excitation wavelength is 485nm, the emission wavelength is 520nm, the HEX excitation wavelength is 528nm, the emission wavelength is 560nm, and the system reference fluorescence ROX excitation wavelength is 575nm, and the emission wavelength is 610nm.

[0086] P 879 If only FAM fluorescence is detected in the amplification product of the site SNP, it is marked as a G / G homozygous genotype; if only HEX fluorescence is detected in the amplification product, it is marked as a T / T homozygous genotype; if both FAM and HEX fluorescence are detected, it is marked as a G / T heterozygous genotype.

[0087] P 818 If only FAM fluorescence is detected in the amplification product of the site SNP, it is marked as a C / C homozygous genotype; if only HEX fluorescence is detected in the amplification product, it is marked as an A / A homozygous genotype; if both FAM and HEX fluorescence are detected, it is marked as an A / C heterozygous genotype.

[0088] Phosphoinositide-3-kinase, regulatory subunit 3b upstream of the Cynoglossus semilaevis genome 879 site and P downstream of the E3 ubiquitin-protein ligase TRIM8 818 The genotype combinations of the locus are G / G and A / C, which have a stronger resistance to visceral sarcoidosis. 879 Site and P 818 When the genotype combination of the locus is other types, the resistance to visceral sarcoidosis is weaker.

[0089] Example 4

[0090] Validation of KASP molecular marker for resistance to visceral sarcoidosis in Cynoglossus semilaevis.

[0091] 500 Cynoglossus semilaevis individuals were collected, and the resistance of each Cynoglossus semilaevis individual to visceral sarcoidosis was tested using the method in Example 1. A total of 332 susceptible individuals and 168 resistant individuals to visceral sarcoidosis were obtained from the resistance test.

[0092] Using the primer set in Example 2 and the KASP genotyping detection method in Example 3, 100 disease-resistant individuals (numbered T01-T100) and 100 disease-susceptible individuals (numbered S01-S100) were tested for P 879 Site and P 818 Locus genotype detection (Table 3). 879 The results of site genotype fluorescence detection are as follows Figure 1 As shown, P 818 The results of site genotype fluorescence detection are as follows Figure 2 As shown, P 879 Site and P 818 The statistical results of locus genotype and visceral sarcoidosis resistance traits are as follows Figure 3 shown.

[0093] Table 3. P of 100 Cynoglossus semilaevis 879 Site and P 818 Locus genotype detection results and disease resistance trait statistics

[0095] Note: + represents stronger resistance, - represents weaker resistance.

[0096] The above description is only a preferred embodiment of the present invention, and it should be clearly pointed out that these preferred embodiments should not be regarded as limiting the present invention. The scope of protection of the present invention shall be based on the scope defined by the attached claims. For ordinary technicians in this field, various improvements and modifications can still be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as part of the scope of protection of the present invention. For example, the adjustment of specific parameters, the combination of different technical features, and the optimization of the process flow, as long as they do not deviate from the core idea of ​​the present invention, all belong to the protection scope of the present invention.

Claims

1. A combined molecular marker for resistance of Cynoglossus semilaevis to visceral sarcoidosis, characterized in that: The combined molecular marker is the sequence shown in SEQ ID NO.1 and SEQ ID NO.2, wherein the 100th nucleotide base in SEQ ID NO.1 is G / T, referred to as P 879 The nucleotide base at position 100 in SEQ ID NO.2 is A / C, referred to as P 818 Location.

2. A primer set for detecting the combined molecular marker of the resistance trait of Cynoglossus semilaevis to visceral sarcoidosis according to claim 1, characterized in that: Primer set consists of detection P 879 Primer set for locus genotype and detection P 818 Primer set composition for locus genotyping: The detection P 879 The primer sets for locus genotyping are as follows: 33,214,879F1: GAAGGTGACCAAGTTCATGC TTATTGAAACCTGCATCAGAAAAAGG; 33,214,879F2: GAAGGTCGGAGTCAACGGAT TTATTGAAACCTGCATCAGAAAAAGT; 33,214,879R:TATGGTTCTACGTAGATAATGAGCAAATC; The detection P 818 The primer sets for locus genotyping are as follows: 18,051,818F1: GAAGGTGACCAAGTTCATGC TGATTTGCACTTGTCTCCTCTTATCC; 18,051,818F2: GAAGGTCGGAGTCAACGGAT TGATTTGCACTTGTCTCCTCTTATCA; 18,051,818R:AGGTTTCCACCTGCTCAAACTCAAATCAC.

3. Use of a primer set for combined molecular markers of resistance traits of Cynoglossus semilaevis to visceral sarcoidosis according to claim 2, characterized in that: The primer set is used in preparing a kit for detecting the resistance trait of Semilaevis semilaevis to visceral sarcoidosis.

4. A kit, characterized in that: Comprising the primer set of claim 2.

5. Use of the combined molecular markers for resistance to visceral sarcoidosis in Cynoglossus semilaevis according to claim 1, characterized in that: The application of the combined molecular marker in molecular breeding of Semilaevis semilaevis for visceral sarcoidosis.

6. The use of a combination of molecular markers for resistance traits of Cynoglossus semilaevis to visceral sarcoidosis according to claim 5, characterized in that: (1) Obtaining genomic DNA of the sample to be tested; (2) using genomic DNA as a template and performing PCR amplification using the primer set described in claim 2; (3) Collect the fluorescent signals generated by each reaction well, determine the genotype of the SNP marker site based on the type of fluorescent signal, and then determine the resistance of Semilaevis semilaevis to visceral sarcoidosis; P 879 If only FAM fluorescence is detected, then P 879 The locus is homozygous for the G / G genotype; If only HEX fluorescence is detected, P 879 The locus is T / T homozygous genotype; If both FAM and HEX fluorescence are detected, P 879 The locus is G / T heterozygous; The underlined portion of primer 33,214,879F1 is the FAM fluorescent specific tag sequence, and the underlined portion of primer 33214879F2 is the HEX fluorescent specific tag sequence; P 818 Fluorescence detection of genotype at the locus: If only FAM fluorescence is detected, then P 818 The locus is C / C homozygous genotype; If only HEX fluorescence is detected, P 818 The locus is A / A homozygous genotype; If both FAM and HEX fluorescence are detected, P 818 The locus is A / C heterozygous; The underlined portion of the primer 18,051,818F1 is the FAM fluorescent specific tag sequence, and the underlined portion of the primer 18,051,818F2 is the HEX fluorescent specific tag sequence; When P 879 Site and P 818 When the genotype combination of the locus is G / G and A / C, it means that the resistance to visceral sarcoidosis is strong.

Images