NRG4 detection primers, crRNA, CRISPR compositions, kits, and applications

By designing specific primer pairs and crRNA, combining CRISPR compositions and reporter RNA, using RPA amplification and immunochromatography test strips, high specificity and high sensitivity visual detection of NRG4 in blood is achieved, solving the convenience and accuracy of NRG4 detection in patients with hematologic tumors.

CN118853658BActive Publication Date: 2025-08-26TONGJI HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI TECH
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410710201.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-03
Publication Date
2025-08-26
Estimated Expiration
2044-06-03

AI Technical Summary

Technical Problem

The prior art has failed to effectively detect the expression of NRG4 in the blood, especially in patients with hematologic tumors, and lacks convenient and accurate detection methods.

Method used

Design specific primer pairs with crRNA, combine CRISPR composition and reporter RNA, visual detection of NRG4 through RPA amplification and immunochromatography test strips, using the cleavage activity and fluorescence signal amplification technology of the CRISPR composition.

Benefits of technology

High specificity and high sensitivity detection of NRG4 is achieved, simplifying the detection process and facilitating rapid detection outside conventional laboratories.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118853658B_ABST
    Figure CN118853658B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of neuregulin 4 detection, and specifically to NRG4 detection primers, crRNA, CRISPR compositions, kits, and applications. The primer pair matches the target sequence of neuregulin 4. The NRG4 detection primers, crRNA, CRISPR compositions, kits, and applications provided in the embodiments can rapidly amplify the specific sequence of NRG4, and the amplified product can be targeted and cleaved by the CRISPR composition with high cleavage efficiency, and the cleavage product can greatly enhance the detection sensitivity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present application relates to the technical field of neuregulin 4 detection, and specifically to NRG4 detection primers, crRNA, CRISPR compositions, kits and applications. Background Art

[0002] Neuregulins 4 (NRG4) belongs to the epidermal growth factor-like protein family (epidermal growth factor, EGF), and is mainly expressed in tissues such as nerves, lungs, liver, heart and fat. NRG4 binds to the specific tyrosine kinase receptor ErbB4 on the cell membrane surface to activate downstream signaling pathways, playing an important role in epidermal cell proliferation, tissue development, synaptic growth and differentiation, and lipid metabolism. As a newly discovered adipokine, research on NRG4 has mostly focused on glucose and lipid metabolism disorders, including obesity, non-alcoholic fatty liver disease and cardiovascular disease. However, existing technologies do not provide a way to detect the expression level of NRG4 in the blood, especially for patients with hematological tumors. Summary of the Invention

[0003] The inventors of this application used the exon (LOC124903616) of NRG4 (Gene ID: 145957) as the target sequence, reverse-transcribed it into RNA, constructed crRNA, Cas enzyme and reporter RNA for targeted cleavage of the reverse-transcribed RNA, and sequentially constructed a CRISPR reaction system to achieve targeted cleavage. The cleavage product was amplified by the signal of the reporter RNA and could be combined with an immunochromatographic test strip to achieve visual detection, making the detection of NRG4 more convenient and accurate, and the detection method more convenient.

[0004] Based on this, the embodiments of the present application disclose at least the following technical solutions:

[0005] In a first aspect, the embodiments disclose a primer pair that matches a target sequence of neuregulin 4, the target sequence being shown in SEQ ID NO. 1. The primer pair comprises DNA molecules shown in SEQ ID NOs. 2-3.

[0006] In a second aspect, the embodiment discloses a crRNA as shown in SEQ ID NO.5, targeting the target sequence as shown in SEQ ID NO.1.

[0007] In a third aspect, the embodiments disclose a CRISPR composition. The CRISPR composition includes LwaCas13a protein and crRNA or a complex formed by the two. The crRNA is shown in SEQ ID NO.5 and targets the target sequence shown in SEQ ID NO.1.

[0008] In some embodiments of the third party, the CRISPR composition further comprises a fluorescent reporter RNA, 5'-FAM-UUUUU-Biotin-3'.

[0009] In a fourth aspect, the embodiments disclose a kit. The kit includes an RPA amplification reagent and a CRISPR detection reagent. The RPA amplification reagent, per 50 μL, includes 75 mM Tris, 50 mM potassium acetate, 25 mM magnesium acetate, 25 mM β-mercaptoethanol, 3.5% polyethylene glycol-2000, 2 mM ATP, 200 mM dNTPs, 20 mM polyphosphate, 50 ng / μL polyphosphate kinase, 250 nM upstream primer as shown in SEQ ID NO. 2, 250 nM downstream primer as shown in SEQ ID NO. 3, 300 ng / μL TthRecA protein, 600 ng / μL TthSSB protein, 0.26 U / μL DNA polymerase Bst3.0, and 0.1 U / μL M-MLV reverse transcriptase. The CRISPR detection reagent includes 2 μL, 7.9 ng / μL LwaCas13a, 1 μL 10 ng / μL crRNA as shown in SEQ ID NO. 5, 1.25 μL 2 μM fluorescent reporter RNA, 0.5 μL 5 U / μL T7 RNA polymerase, 0.4 μL 1 M HEPES buffer, 0.18 μL 1 M MgCl2 solution, 0.8 μL rNTP mix (25 mM ATP, 25 mM GTP, 25 mM UTP, 25 mM CTP), 1 μL RNase inhibitor (40 U / mL) and 11.87 μL enzyme-free water.

[0010] Specific RPA primers are used to amplify the NRG4 fragment, i.e., the NRG4 target sequence. This specific fragment is isothermally amplified by a recombinant polymerase to form a DNA fragment, which is then transcribed by T7 to generate a large amount of reverse transcribed RNA (target sequence RNA). The ends of the reporter RNA (ssRNA) are modified with a FAM fluorescent group and a biotin group, respectively. The combination of the probe RNA and the generation of a fluorescent signal while cutting can effectively achieve high-specificity and high-sensitivity detection of NRG4. By combining it with the visualization of enzyme-linked immunosorbent assay technology, it lays a strong foundation for disease detection to break through the constraints of conventional laboratory testing instruments and environment.

[0011] In some embodiments of the fourth aspect, the kit further comprises a nucleic acid extraction reagent comprising: 100 mM Tris-HCl, 50 mM NaCl, 0.1 mM EDTA, 0.01% SDS, 0.04% lithium dodecyl sulfate and 2% betaine.

[0012] In a fifth aspect, the embodiments also disclose a kit. This kit includes an immunochromatographic test strip, an RPA amplification reagent, and a CRISPR detection reagent. The immunochromatographic test strip comprises, in order of sample flow, a sample pad containing a colloidal gold-labeled antibody, an NC membrane containing a T-line and a C-line, and a water-absorbing filter paper. The T-line is formed by streptavidin, and the C-line is formed by a secondary antibody to the colloidal gold-labeled antibody. When the Cas13a / crRNA complex in the reaction system recognizes the target RNA sequence, it activates the incidental cleavage activity of Cas13a, which in turn cleaves the reporter RNA, generating a fluorescent signal. After reacting at 37°C for 1 hour, the reaction solution is diluted 10-fold and dripped into the sample well. If a large amount of target viral nucleic acid is present in the reaction system, the reporter group of the ssRNA will be completely cleaved, that is, the FAM will be separated from the biotin. The gold-labeled FAM antibody in the sample pad will bind to the FAM and flow to the top of the immunochromatographic test strip under the siphon effect. When passing through the quality control zone, the streptavidin on the quality control line will bind to the system biotin, resulting in color development. The cleaved FAM continues upward into the detection zone. The detection area is coated with a secondary antibody of the FAM antibody, which develops color after binding to the FAM antibody. When a small amount of target viral nucleic acid is present in the reaction system, the reporter group is not completely cut, that is, there is still some gold-labeled FAM antibody / FAM / biotin. The secondary antibody on the T line will bind to this part of FAM, and then develop color, but the color is lighter and weakly positive. When there is no target viral nucleic acid in the reaction system, the ssRNA reporter group is labeled with colloidal gold, and the streptavidin on the quality control line will bind to the biotin on the reporter group, and then develop color. The ssRNA cannot continue to flow to the detection area and is intercepted in the quality control area, while the inspection area does not develop color and is negative. By combining the above-mentioned CRISPR detection system with the test strip, visual detection of NRG4 can be achieved, and the interpretation of the test results is more convenient.

[0013] In some embodiments, the colloidal gold-labeled antibody is an anti-FITC antibody.

[0014] In a fifth aspect, the embodiments disclose the use of the primer pair described in the first aspect, the crRNA described in the second aspect, the CRISPR composition described in the third aspect, or the kit described in the fourth aspect in preparing a product having at least one of the following functions 1)-3):

[0015] 1) detecting whether the target nucleic acid is a neuregulin 4 nucleic acid;

[0016] 2) detecting whether the target nucleic acid is a neuregulin exon (LOC124903616) nucleic acid;

[0017] 3) Detecting whether the target nucleic acid as described in any of 1) to 3) is still present in the in vitro sample, optionally, the in vitro sample is selected from at least one of a blood sample, an individual sample, a tissue sample, a saliva sample, a sweat sample, a urine sample, a throat swab sample, a milk sample, a semen sample, a skin wipe sample, a stool sample, and a sputum sample.

[0018] The NRG4 detection primers, crRNA, CRISPR compositions, kits, and applications provided in the embodiments of the present application can rapidly amplify the specific sequence of NRG4, resulting in strong detection specificity. The amplified product can be targeted and cleaved by crRNA or CRISPR compositions with high cleavage efficiency, and the cleavage product can greatly enhance the specificity and sensitivity of the detection. By using reporter RNA to associate and amplify the cleavage product, visual detection on immunochromatographic test strips can be achieved, making the detection process more convenient and easy to promote and apply. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The CRISPR fluorescence detection results of crRNA1 for different concentrations of standard plasmids provided in the examples are shown.

[0020] Figure 2 The CRISPR fluorescence detection results of crRNA2 for different concentrations of standard plasmids provided in the examples are shown.

[0021] Figure 3 The CRISPR fluorescence detection results of crRNA3 for different concentrations of standard plasmids provided in the examples are shown.

[0022] Figure 4 The CRISPR fluorescence detection results of crRNA1 against NRG4 target sequences at different concentrations are provided in the examples.

[0023] Figure 5 The CRISPR fluorescence detection results of crRNA2 for different concentrations of NRG4 target sequences provided in the examples are shown.

[0024] Figure 6 The CRISPR fluorescence detection results of crRNA3 for different concentrations of NRG4 target sequences provided in the examples are shown.

[0025] Figure 7 The CRISPR detection system optimization results of different concentrations of LwaCas13a protein (A) and different concentrations of crRNA2 (B) provided in the examples.

[0026] Figure 8The electrophoresis results of RPA amplification products for the test and control groups of five different blood samples provided in the examples are shown. Lane M is a marker. Lane "Test-RPA" shows the results of RPA amplification of the five blood samples using the exon (LOC124903616) of NRG4 (Gene ID: 145957) as the target sequence. Lane "control-RPA" shows the results of RPA amplification of the five blood samples using the CDS of NRG4 as the target sequence. Lane "Acute serum 1*100, Test-RPA, Test-qPCR" shows the results of RPA amplification and qPCR amplification of a 100-fold diluted sample of acute serum using the exon of NRG4 as the target sequence. Lane "Acute serum 1*100, control-RPA, control-qPCR" shows the results of RPA amplification and qPCR amplification of a 100-fold diluted sample of acute serum using the CDS of NRG4 as the target sequence.

[0027] Figure 9 The following examples provide the results of CRISPR testing on 100-fold diluted samples of acute serum. "Test" shows the results of RPA-CRISPR testing on 100-fold diluted samples of acute serum using the exon (LOC124903616) of NRG4 (Gene ID: 145957) as the target sequence. "Control" shows the results of qPCR-CRISPR testing on 100-fold diluted samples of acute serum using the CDS of NRG4 as the target sequence.

[0028] Figure 10 The sensitivity test results of the CRISPR immunochromatographic test strips provided in the examples. From left to right: negative control, 0.15 copies / μL, 1.5 copies / μL, and 15.2 copies / μL of the standard plasmid pET-32a-NRG4. DETAILED DESCRIPTION

[0029] In order to make the purpose, technical solutions and advantages of this application more clearly understood, the present application is further described in detail below with reference to the following examples. It should be understood that the specific examples described herein are merely for the purpose of explaining this application and are not intended to limit this application. Reagents not described in detail in this application are all conventional reagents and can be obtained from commercial channels; methods not specifically described in detail are all conventional experimental methods and can be obtained from the prior art.

[0030] The following examples involve reagents and materials:

[0031] Fluorescent reporter RNA (5'-FAM-UUUUU-Biotin-3') was synthesized by Sangon Biotech (Shanghai) Co., Ltd., and DNA and oligonucleotide chains were synthesized by Qingdao Qingke Biotechnology Co., Ltd. Tris(2-carboxyethyl)phosphine (TCEP) and ethylenediaminetetraacetic acid (EDTA) were purchased from Sigma. Double-distilled water, anhydrous potassium dioxide, NaCl, Trion X-100, bovine serum albumin (BSA), and phosphate-buffered saline (PBS) were purchased from Sangon Biotech (Shanghai). Streptavidin (SA) and protein A were purchased from Solarbio. Anti-FAM mouse IgG antibody was purchased from Abcam. Sodium citrate solution, chloroauric acid solution, sample pad, conjugate pad, nitrocellulose membrane, absorbent pad, and PVC substrate were all provided by Huada Ruier Co., Ltd. The TIANamp Virus DNA / RNA Kit was purchased from Tiangen Biotechnology Co., Ltd. The FSQ201 ReverTraAce kit was purchased from Toyobo Biotechnology Co., Ltd. RNase inhibitor, New England Biolabs, M0314L. Single-stranded binding protein TthSSB, catalog number: 70032Z500UG, Thermo Scientific TM Tth RecA protein, C5005, Xinhai Gene. Polyphosphate kinase, ProSpec, Catalog No. ENZ-266, 100 IU. DNA polymerase Bst3.0, 1600 U, XY9A3901, Beijing Xinyu Biotechnology Co., Ltd. M-MLV reverse transcriptase, 10 KU, JN0014, Biolabs. T7 RNA polymerase, Catalog No. YT409, 1000 U, Biolabs. All other reagents not listed are commercially available.

[0032] The following embodiments involve the following instruments:

[0033] PCR instrument (USA M&A, ABI); ice machine (SANYO); clean bench (Harbin Donglian); electronic balance (Sartorius); electrophoresis apparatus and electrophoresis tank (Beijing Liuyi Instrument Factory); gel imaging system (US, NucleoTech); dark box UV transilluminator (ZF-90, Shanghai Gucun Electro-Optical Instrument Factory); temperature-controlled shaker (Harbin Donglian, Zhichu); ultra-micro-spectrophotometer DS-11 (USA - Denovix); gel scanner (GelScanner 2100XL); small centrifuge (Beijing Bolihang Instrument Co., Ltd.); medium centrifuge (Eppendorf Centr The equipment used was a 5804R (ifuge5804R); a large centrifuge (HITACHI CR21GIII); an ATS high-pressure cell disruptor; Bio-Rad NGC and GE Healthcare protein chromatography system purifiers; GE Healthcare molecular sieves; Millipore ultrafiltration centrifuge tubes (Shanghai Junsheng Biotechnology Co., Ltd.); a protein gel electrophoresis tank (BIO-RAD, USA); a CFX96 Touch fluorescence quantitative PCR instrument (BIO-RAD, USA); a small-volume ultrasonic disruptor; and an ultralow-temperature refrigerator (Legaci™ Refregeration System). An HR8000 immunoassay quantitative analyzer (Wuhan Guanrui Biotechnology Co., Ltd.) was used.

[0034] Construction of NRG4 target sequence standard plasmid

[0035] After extensive screening, the inventors selected the exon (LOC124903616) of NRG4 (Gene ID: 145957) as the target sequence. It was found that the exon as the target sequence (SEQ ID NO. 1) for target sequence synthesis not only had high PCR synthesis efficiency, but also greatly improved the subsequent detection sensitivity. The primer pair designed based on the target sequence was NRG4-F1 (GG CTCGAG TAATACGACTCACTATAGtttgtgcagtggcagtattg, SEQ ID NO.2, the underline is the XhoI restriction site, the bold is the T7 promoter sequence) and NRG4-R1 (CC GGATCCtcttttaagaaatgtctattcagattac, SEQ ID NO. 3, underlined BamHI restriction site). The pET-32a plasmid (Beijing Qiyan Biotechnology) was double-digested with XhoI and BamHI to recover the large fragment, which was then ligated to the fusion gene fragment. In a 20 μL reaction system, the ratio of target sequence fragment to pET-32a vector large fragment was 10:1. 300 units of T4 DNA ligase were added, and the ligation was carried out overnight at 16°C. 5 μL of the ligation product was directly transformed into competent E. coli host bacteria BL21 (DE3), plated on ampicillin-resistant plates, and cultured overnight at 37°C to obtain the engineered bacteria for further screening. Ampicillin resistance screening was performed, and the positive clone pET-32a-SUMO-NRG4 was obtained. The plasmid was extracted and identified using restriction endonucleases. The positive transformants were sequenced using universal primers, and the cloned sequences were completely consistent with the designed sequences. The positive clones were inoculated and cultured, and the standard plasmid pET-32a-NRG4 was extracted from them.

[0036] Establishment of the CRISPR / Cas13a detection system for NRG4

[0037] In order to improve the sensitivity, specificity and accuracy of nucleic acid detection based on the CRISPR / Cas system, which can be applied to instant testing, the present invention provides a nucleic acid detection kit based on the CRISPR / Cas13a system, which includes an RPA amplification reagent and a CRISPR detection reagent. The RPA reagent amplifies the sample to be tested and can rapidly expand the copy number of the target sequence of the sample to be tested. The CRISPR detection reagent includes: T7 RNA polymerase, rNTP, LwaCas13a, crRNA, reporter RNA, RNase inhibitor, MgCl2 and HEPES buffer. T7 RNA polymerase is used to polymerize the target sequence obtained by RPA amplification to obtain RNA containing the target sequence. The crRNA includes an anchor sequence for binding to the LwaCas13a protein and a guide sequence for targeting the target sequence of the NRG4 gene. The crRNA binds to the LwaCas13a protein to target the cleavage target sequence and simultaneously cuts the reporter RNA, prompting the fluorescent group (e.g., FAM) and the fluorescence quenching group (e.g., biotin) at both ends of the reporter RNA to separate, thereby generating fluorescence. Furthermore, by detecting fluorescent signals, high-specificity and high-sensitivity detection can be effectively achieved, and by combining it with the visualization of enzyme-linked immunosorbent assay technology, it lays a strong foundation for disease detection to break through the constraints of conventional laboratory testing instruments and environment.

[0038] Among them, the crRNA sequence in the CRISPR detection reagent has an important influence on the cleavage activity and detection of the target sequence.

[0039] 1. Synthetic crRNA

[0040] The present invention is based on the human NRG4 gene target sequence (SEQ ID NO.1), and designs crRNA based on its near 3' end region, screening out crRNA with good cleavage activity as a detection crRNA (https: / / cas13design.nygenome.org / ). In order to improve the specificity of Cas13a protein shearing, the present invention extends the traditional 23bp guide sequence. The inventors have verified through experiments that extending the length of 20bp to 65bp can still make crRNA have strong cleavage activity.

[0041] Table 1 crRNA

[0042]

[0043] 2. CRISPR / Cas13a cleavage activity

[0044] The CRISPR / Cas13a detection system was prepared as follows: 2 μL LwaCas13a (63.3 ng / μL, Z03486-1 mg, GenScript), 1 μL crRNA (10 ng / μL, as shown in Table 1), 1.25 μL fluorescent reporter RNA (2 μM), 0.5 μL T7 RNA polymerase (5 U / μL), 0.4 μL HEPES buffer (1 M), 0.18 μL MgCl2 solution (1 M), 0.8 μL rNTP mix (25 mM ATP, GTP, UTP, CTP), 1 μL RNase inhibitor (40 U / mL) and 11.87 μL enzyme-free water, with a total volume of 19 μL.

[0045] Sample: standard plasmid pET-32a-NRG4 or in vitro synthesized NRG4 target sequence (with T7 promoter sequence at the 5' end).

[0046] Detection: The above CRISPR / Cas13a detection system was used as a detection system for one reaction, and the corresponding detection system was configured according to the number of tests. The configured detection system was transferred to a 96-well ELISA plate, and 1 μL of standard plasmid pET-32a-NRG4 or NRG4 target sequence was added to each reaction system. The reaction was incubated at 37°C, and the fluorescence intensity was collected using a multifunctional microplate reader. The fluorescence signal was collected under the conditions of Ex / Em=485 / 520nm for each reaction well every 3 minutes (Gain=650), and the detection time was 30 minutes. Using this reaction system, the cleavage activity and detection limit of the CRISPR / Cas13a detection system were evaluated respectively.

[0047] 3. Detection limit evaluation

[0048] Based on the measured concentration of the standard plasmid pET-32a-NRG4 or the NRG4 target sequence, the copy number / μL was calculated as 6.02×10 23 ×DNA content (ng / μL) × 10 -9 / (660×number of bases). Then 1×10 -7 ng / μL, 1×10 -8 ng / μL and 1×10 -9 ng / μL standard plasmid pET-32a-NRG4 are 15.2 copies / μL, 1.5 copies / μL and 0.15 copies / μL respectively. -7 ng / μL, 1×10 -8 ng / μL and 1×10 -9 The copy numbers of the NRG4 target sequence at ng / μL were 729.7 copies / μL, 72.9 copies / μL, and 7.3 copies / μL, respectively. The standard plasmid pET-32a-NRG4 or NRG4 target sequence was added to the CRISPR / Cas13a detection system described above. Each experiment was repeated three times. A negative control with water as the template was also set up. The fluorescence values ​​at 30 minutes of detection were compared. Results with statistically significant differences compared to the negative control were considered positive (P<0.05), while those without statistically significant differences were considered negative (P>0.05). The lowest concentration at which the fluorescence value was statistically different from the negative control was the detection limit of this method.

[0049] like Figures 1 to 3 The following are CRISPR / Cas13a detection curves for the standard plasmid pET-32a-NRG4 at different copy numbers. As can be seen, the CRISPR / Cas13a detection system can detect fluorescence values ​​significantly different from the negative control group for the reverse transcription products recovered from the standard plasmid pET-32a-NRG4 at these different copy numbers. Among them, crRNA2 has the highest fluorescence intensity and the highest sensitivity.

[0050] like Figures 4-6 Shown are CRISPR / Cas13a detection curves for NRG4 target sequences with varying copy numbers. As can be seen, the CRISPR / Cas13a detection system was able to detect NRG4 target sequences with varying copy numbers, with fluorescence values ​​significantly different from those of the negative control group. Among them, crRNA2 showed the highest increase in fluorescence intensity, the highest fluorescence intensity, and the highest sensitivity.

[0051] NRG4 RPA-CRISPR / Cas13a detection system

[0052] Based on this, the embodiment provides a crRNA as shown in SEQ ID NO. 5. The crRNA targets the target sequence of NRG4, and the target sequence is shown in SEQ ID NO. 1.

[0053] Cas13a protein only needs the guidance of a mature crRNA to achieve specific shearing of single-stranded RNA, and the 3' end of the target has a PFS (protospacer flanking site) recognition site. According to the crRNA obtained above, in combination with Cas protein, Cas enzyme and reporter RNA, a CRISPR detection reaction system is constructed in sequence to achieve targeted cutting. In order to obtain the best detection effect, the embodiment optimizes the concentration of Cas protein and crRNA in the CRISPR detection reaction system, and evaluates the specificity and sensitivity of the CRISPR detection reaction system.

[0054] 1. CRISPR detection system optimization

[0055] (1) Determination of the optimal LwaCas13a protein concentration

[0056] The purified LwaCas13a protein (63.3 ng / μL, Z03486-1 mg, GenScript) was serially diluted by 2-fold gradients (63.3 ng / μL, 31.65 ng / μL, 15.8 ng / μL, 7.9 ng / μL, 3.95 ng / μL, 1.97 ng / μL, 0.98 ng / μL, 0.49 ng / μL) for a total of 8 concentration gradients to prepare the detection system: 2 μL LwaCas13a, 1 μL crRNA2 (10 ng / μL, as shown in Table 1), 1.25 μL fluorescent reporter RNA (2 μM), 0.5 μL T7 RNA polymerase (5 U / μL), 0.4 μL HEPES buffer (1 M), 0.18 μL MgCl2 solution (1 M), 0.8 μL rNTP mix (25 mM ATP, GTP, UTP, CTP), 1 μL RNAse inhibitor (40 U / mL) and 11.87 μL enzyme-free water for a total volume of 19 μL.

[0057] Sample: 1 μL 1×10 -9 ng / μL NRG4 target sequence.

[0058] After thorough mixing, the reaction system was added to a fluorescent quantitative PCR tube and tested on a machine under the same conditions as above.

[0059] The results are as follows Figure 7As shown in A: When the concentration of LwaCas13a protein is 7.9 ng / μL, the fluorescence intensity does not decrease significantly compared with the high concentration LwaCas13a protein but is higher than the low concentration LwaCas13a protein.

[0060] (2) Determination of optimal crRNA concentration

[0061] crRNA2 was diluted in a 2-fold gradient (20 ng / μL, 10 ng / μL, 5 ng / μL, 2.5 ng / μL, 1.25 ng / μL), for a total of 7 concentration gradients.

[0062] Prepare the detection system: 2 μL LwaCas13a (7.9 ng / μL), 1 μL crRNA2, 1.25 μL fluorescent reporter RNA (2 μM), 0.5 μL T7 RNA polymerase (5 U / μL), 0.4 μL HEPES buffer (1 M), 0.18 μL MgCl2 solution (1 M), 0.8 μL rNTP mix (25 mM ATP, GTP, UTP, CTP), 1 μL RNase inhibitor (40 U / mL) and 11.87 μL enzyme-free water, with a total volume of 19 μL.

[0063] Sample: 1 μL 1×10 -9 ng / μL NRG4 target sequence.

[0064] After thorough mixing, the reaction system was added to a fluorescent quantitative PCR tube and tested on a machine under the same conditions as above.

[0065] The results are as follows Figure 7 As shown in B: When the crRNA2 concentration is 10 ng / μL, the fluorescence intensity does not decrease significantly compared with the high concentration crRNA2 protein but is higher than the low concentration crRNA2 protein.

[0066] (3) Determination of the detection reaction system

[0067] Based on the above optimization results, the CRISPR detection reaction system was obtained as follows:

[0068] 2 μL LwaCas13a (7.9 ng / μL), 1 μL crRNA2 (10 ng / μL), 1.25 μL fluorescent reporter RNA (2 μM), 0.5 μL T7 RNA polymerase (5 U / μL), 0.4 μL HEPES buffer (1 M), 0.18 μL MgCl2 solution (1 M), 0.8 μL rNTPmix (25 mM ATP, GTP, UTP, CTP), 1 μL RNase inhibitor (40 U / mL) and 11.87 μL enzyme-free water, with a total volume of 19 μL.

[0069] Testing of clinical blood samples and comparison with other methods

[0070] 1. Selection of NRG4 target sequence

[0071] After extensive screening, the inventors selected an exon (LOC124903616) of NRG4 (Gene ID: 145957) as a target sequence. They found that using this exon as the target sequence (SEQ ID NO. 1) for target sequence synthesis not only improved PCR synthesis efficiency but also significantly enhanced subsequent detection sensitivity. As a control, the inventors also selected the CDS sequence of NRG4 (Gene ID: 145957) as a target sequence (NM_138573.4, CCDS: CCDS10288.1, shown in SEQ ID NO. 7).

[0072] 2. RPA amplification of target sequences

[0073] The emerging recombinase polymerase amplification (RPA) technology can shorten detection time to 15-30 minutes and is considered a potential alternative to PCR for nucleic acid detection. This embodiment utilizes RPA as an amplification system to achieve large-scale amplification of the target sequence of the NRG4 gene in a blood sample.

[0074] In some embodiments, the RPA amplification reagent in 50 μL includes 75 mM Tris, 50 mM potassium acetate, 25 mM magnesium acetate, 25 mM β-mercaptoethanol, 3.5% polyethylene glycol-2000, 2 mM ATP, 200 mM dNTPs, 20 mM polyphosphate, 50 ng / μL polyphosphate kinase, 250 nM upstream primer as shown in SEQ ID NO.2, 250 nM downstream primer shown in SEQ ID NO.3, 300 ng / μL TthRecA protein, 600 ng / μL TthSSB protein, 0.26 U / μL DNA polymerase Bst3.0 and 0.1 U / μL M-MLV reverse transcriptase.

[0075] In some embodiments, the RPA amplification reagent is used to amplify the target sequence of the experimental group (Test). The RPA amplification system has high reaction sensitivity and specificity. The embodiment designs and synthesizes RPA primer pairs RPA primer pair NRG4-RPA-F ( TAATACGACTCACTATAGTTTGTGCAGTGGCAGTATTG, SEQ ID NO.8, the underline is the T7 promoter sequence) and NRG4-RPA-R (TCTTTTAAGAAATGTCTATTCAGATTAC, SEQ ID NO.9) can effectively amplify the target sequence of the NRG4 gene.

[0076] As a control, the CDS target sequence of NRG4 was amplified by RPA using the RPA system. The upstream primer NRG4-F3' was designed as follows: TAATACGACTCACTATAG atgccaacagatcacgaagag, the underline is the T7 promoter sequence, SEQ ID NO. 10. Downstream primer NRG4-R3': tcagtgttgttcatgactgtgg, SEQ ID NO. 11.

[0077] In one embodiment, a nucleic acid release agent was used to dilute 5 blood samples (5 mL of fasting peripheral venous blood in the morning, centrifuged at 3000 rpm for 10 minutes) from 2 patients with acute myeloid leukemia and 3 patients with chronic myeloid leukemia at a volume of 1:20 to 20 mL. The samples were incubated at 89°C for 20 minutes, and then centrifuged at 2000 rpm and 4°C for 10 minutes after an ice bath. The nucleic acid release agent contained 100 mM Tris-HCl, 50 mM NaCl, 0.1 mM EDTA, 0.01% SDS, 0.04% lithium dodecyl sulfate (LLS), and 2% betaine. The supernatant was added to the amplification reaction system and reacted in a constant temperature water bath at 61°C for 30 minutes. The amplified products were collected and identified by electrophoresis. The amplification reaction system (50 μL) contained: 75 mM Tris, 50 mM potassium acetate, 25 mM magnesium acetate, 25 mM β-mercaptoethanol, 3.5% polyethylene glycol-2000, 2 mM ATP, 200 mM dNTPs, 20 mM polyphosphate, 50 ng / μL polyphosphate kinase, 250 nM each of upstream and downstream primers, 300 ng / μL TthRecA protein (SEQ ID NO. 1, (Accession No. BAW01838)), 600 ng / μL TthSSB protein, and 0.26 U / μL DNA polymerase Bst3.0.

[0078] The results are as follows Figure 8 As shown, both the test group (Test-RPA) and the control group (Control-RPA) were able to amplify the sample diluted 1:20 after extraction. However, the concentration of the target sequence such as SEQ ID NO. 1 amplified by the test group was higher than that of the control group.

[0079] 3. RPA-CRISPR and qPCR amplification of target sequences

[0080] Acute serum 1 was used as the sample for RPA and qPCR amplification of the extracted sample at a 1:20 dilution. Sample processing was as follows: The positive blood sample was diluted 1:100 with the same nucleic acid release reagent to prepare a solution. After pretreatment, the sample was used for RPA-CRISPR and qPCR testing.

[0081] RPA amplification:

[0082] The supernatant was added to the amplification reaction system and reacted in a thermostatic water bath at 61°C for 30 min. The amplified products were collected and identified by electrophoresis. The RPA amplification reagent (50 μL) included 75 mM Tris, 50 mM potassium acetate, 25 mM magnesium acetate, 25 mM β-mercaptoethanol, 3.5% polyethylene glycol-2000, 2 mM ATP, 200 mM dNTPs, 20 mM polyphosphate, 50 ng / μL polyphosphate kinase, 250 nM upstream primer of SEQ ID NO. 2, 250 nM downstream primer of SEQ ID NO. 3, 300 ng / μL TthRecA protein, 600 ng / μL TthSSB protein, 0.26 U / μL DNA polymerase Bst3.0, and 0.1 U / μL M-MLV reverse transcriptase.

[0083] CRISPR Assays:

[0084] 2μL LwaCas13a (7.9ng / μL), 1μL crRNA2 (10ng / μL), 1.25μL fluorescent reporter RNA (2μM), 0.5μL T7 RNA polymerase (5U / μL), 0.4μL HEPES buffer (1M), 0.18μL MgCl2 solution (1M), 0.8μL rNTPmix (25mMATP, GTP, UTP, CTP), 1μL RNase inhibitor (40U / mL) and 11.87μL enzyme-free water, total volume 19μL. Take 1μL RPA amplification product, incubate at 37°C, use a multifunctional microplate reader to collect fluorescence intensity, and collect fluorescence signals (Gain=650) under the conditions of Ex / Em=485 / 520nm for each reaction well every 3min, and the detection time is 30min. Using this reaction system, the cleavage activity of the CRISPR / Cas13a detection system was evaluated respectively.

[0085] qPCR detection: SYBR Green qPCR was used. The qPCR reaction system (10 μL) contained: 5 μL 2× SYBR Real-Time qPCR Master Mix, 0.25 μL 10 μM upstream primer NRG4-F4' (atgccaacagatcacgaagag, SEQ ID NO. 12), 0.25 μL 10 μM downstream primer NRG4-R3', 3.5 μL double-distilled water, and 1 μL sample. The reaction program was 94°C for 4 min, followed by 40 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s.

[0086] The results are as follows Figure 8 As shown in the lanes (Test-RPA, Test-qPCR, control-RPA, control-qPCR), the RPA amplification method can effectively amplify the target sequence in a 100-fold diluted acute blood sample, while qPCR cannot effectively amplify the target sequence in the control group. Furthermore, the experimental group can effectively amplify a 1×100 acute serum sample, while the control group cannot. This demonstrates that the target sequence and amplification system used in the experimental group can effectively amplify the NRG4 gene, thereby improving its detection sensitivity.

[0087] In addition, CRISPR detection was performed on the amplified products of RPA and qPCR. Figure 9 As shown, the amplification product of RPA amplification can be detected by CRISPR, while the amplification product of qPCR cannot be detected by CRISPR, which once again shows that the present invention uses NRG4 exon as the target sequence and uses RPA as the amplification system to improve the detection sensitivity of NRG4.

[0088] NRG4 detection kit

[0089] By combining the aforementioned CRISPR detection system with a test strip, NRG4 can be visually detected, making the interpretation of test results more convenient. The working process involves the following: When the Cas13a / crRNA complex in the reaction system recognizes the target sequence RNA, it activates the incidental cleavage activity of Cas13a, which in turn cleaves the reporter RNA, generating a fluorescent signal. After reacting at 37°C for 1 hour, the reaction solution is diluted 10-fold and dripped into the sample well. If a large amount of target viral nucleic acid is present in the reaction system, the reporter group of the ssRNA will be completely cleaved, meaning that the FAM will be separated from the biotin. The gold-labeled FAM antibody in the sample pad will bind to the FAM and flow to the top of the immunochromatographic test strip via a siphon effect. When passing through the quality control zone, the streptavidin on the quality control line will bind to the system biotin, resulting in color development. The cleaved FAM continues upward into the detection zone. The detection zone is coated with a secondary antibody against the FAM antibody, which binds to the FAM antibody and develops color. When a small amount of target viral nucleic acid is present in the reaction system, the reporter group is not completely cleaved, meaning that some gold-labeled FAM antibody / FAM / biotin remains. The secondary antibody on the T line will bind to this portion of FAM, resulting in color development, but the color is lighter, indicating a weak positive result. When the target viral nucleic acid is absent from the reaction system, the ssRNA reporter group is labeled with colloidal gold, and streptavidin on the quality control line will bind to the biotin on the reporter group, resulting in color development. The ssRNA cannot continue to flow to the detection zone and is retained in the quality control zone, while the detection zone does not develop color and is negative.

[0090] Based on this, the embodiment discloses a detection kit for NRG4. The detection kit includes a CRISPR detection reagent and an immunochromatographic test paper. The immunochromatographic test paper includes a sample pad containing a colloidal gold-labeled antibody, an NC membrane containing a T line and a C line, and a water-absorbing filter paper in the direction of sample flow, wherein the T line is formed by streptavidin, and the C line is formed by the secondary antibody of the colloidal gold-labeled antibody. The CRISPR reagent includes 2μL LwaCas13a (7.9ng / μL), 1μL crRNA2 (10ng / μL), 1.25μL fluorescent reporter RNA (2μM), 0.5μL T7 RNA polymerase (5U / μL), 0.4μL HEPES buffer (1M), 0.18μL MgCl2 solution (1M), 0.8μL rNTP mix (25mM ATP, GTP, UTP, CTP), 1μL RNase inhibitor (40U / mL) and 11.87μL enzyme-free water, with a total volume of 19μL. The two ends of the reporter RNA are respectively labeled with biotin and a group capable of binding to the colloidal gold labeled antibody.

[0091] In some embodiments, the preparation process of the immunochromatographic test paper specifically includes:

[0092] 1. Coating of anti-FHM antibody and streptavidin protein

[0093] The anti-FHM antibody and streptavidin protein were coated on a nitrocellulose (NC) membrane and dried at room temperature. The coated NC membrane and desiccant were placed in an aluminum foil bag and stored in a dark place at 4°C for later use.

[0094] 2. Assembly of immunochromatographic test strips

[0095] (1) Optimal concentration of colloidal gold-labeled anti-FAM mouse IgG antibody

[0096] The MEY stability test was used to determine the optimal labeling amount of anti-FAM mouse IgG antibody and colloidal gold. 100 μL of colloidal gold solution (20 nm colloidal gold particles) was added to the enzyme-labeled wells. Then, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, and 14 ng / μL of anti-FAM mouse IgG antibody were added. Mix well and let stand for 5 minutes. Then, 20 μL of 10% sodium chloride solution was added and the solution was left to stand for 15 minutes. As the amount of monoclonal antibody added increased, the color of the colloidal gold gradually changed from purple-black to red and stabilized. The optimal labeling amount was 8 ng / μL, indicating that the concentration closest to the natural color of the colloidal gold was the most suitable.

[0097] (2) Optimal pH value for colloidal gold-labeled anti-FAM mouse IgG antibody

[0098] Take a microplate and add 100 μL of colloidal gold solution and the optimal concentration of anti-FAM mouse IgG antibody determined above to the first seven sections. Then, add 5 μL, 7 μL, 9 μL, 11 μL, 13 μL, 15 μL, and 17 μL of 0.01 mol / L K2CO3 solution, sequentially from front to back. Let stand at room temperature for 15 minutes. Scan the plate using a microplate reader to obtain the colloidal gold visible light OD520 value. The optimal pH for labeling is the pH corresponding to the maximum OD520 value. This means that adding 13 μL of 0.01 mol / L K2CO3 per milliliter of colloidal gold is the optimal pH for labeling.

[0099] (3) Determination of protein A and streptavidin coating concentrations and gold-labeled antibody spray volume

[0100] Ensure that the test line (T) of the immunochromatographic test strip maintains color within a certain range, and that the ratio of the test line (T) to the control line (C) varies proportionally. The optimal reaction conditions established are: the test line (T) is coated with protein A at a concentration of 0.12 mg / mL, sprayed at a concentration of 1 μL / cm; the control line (C) is coated with streptavidin at a concentration of 1 mg / mL, sprayed at a concentration of 1 μL / cm; and the gold-labeled antibody is sprayed onto the sample pad at a volume of 3.5 μL / cm. At this point, the T and C lines of a positive result exhibit moderate color development and a consistent proportional variation.

[0101] (4) Assembly of immunochromatographic test strips

[0102] Based on the conditions explored above, protein A and streptavidin were coated onto nitrocellulose (NC) membrane using a colloidal gold production system. The membrane was dried at room temperature, and the coated NC membrane and desiccant were placed in an aluminum foil bag and stored in a dark place at 4°C until ready for use. From top to bottom, the sample pad, gold pad, nitrocellulose membrane (NC membrane), and absorbent paper were connected end to end and affixed to a PVC base. Immunochromatographic test strips were cut to the appropriate size using a colloidal gold production system. The immunochromatographic test strips and desiccant were placed in an aluminum foil bag and stored in a dark place at 4°C until ready for use.

[0103] 3. Sensitivity testing of CRISPR immunochromatographic test strips

[0104] CRISPR / Cas13a cleavage reactions were performed on the standard plasmid pET-32a-NRG4 at 15.2, 1.5, and 0.15 copies / μL, respectively (detection system as above). The reaction products were detected using immunochromatographic strips. Color changes on the strips were observed visually. Alternatively, colorimetric analysis using Gelpro image analysis software was performed, and the difference between colorimetric values ​​and visual observation was compared to test the sensitivity of the immunochromatographic strips. DEPC water was used as a negative control.

[0105] like Figure 10 As shown, the T line of the standard plasmid with a copy number of 1.5 / μL can be clearly read. It can be seen that the CRISPR immunochromatographic test paper provided in this application can sensitively detect NRG4.

[0106] The above is only a preferred specific implementation method of the present application, but the scope of protection of the present application is not limited thereto. Any changes or replacements that can be easily thought of by any technician familiar with this technical field within the technical scope disclosed in this application should be covered by the scope of protection of the present application.

Claims

1. The crRNA as shown in SEQ ID NO: 5, targeting the target sequence as shown in SEQ ID NO:

1.

2. A CRISPR composition comprising LwaCas13a protein, crRNA and a fluorescent reporter RNA; the crRNA is as shown in SEQ ID NO: 5, the crRNA targets the target sequence as shown in SEQ ID NO: 1, and the fluorescent reporter RNA is 5'-FAM-UUUUU-Biotin-3'.

3. A kit comprising: RPA amplification reagent, wherein 50 μL of the RPA amplification reagent includes 75 mM Tris, 50 mM potassium acetate, 25 mM magnesium acetate, 25 mM β-mercaptoethanol, 3.5% polyethylene glycol-2000, 2 mM ATP, 200 mM dNTPs, 20 mM polyphosphate, 50 ng / μL polyphosphate kinase, 250 nM upstream primer of SEQ ID NO: 2, 250 nM downstream primer of SEQ ID NO: 3, 300 ng / μL TthRecA protein, 600 ng / μL TthSSB protein, 0.26 U / μL DNA polymerase Bst3.0, and 0.26 U / μL M-MLV reverse transcriptase; CRISPR detection reagent, which includes, per 19 μL, 2 μL 7.9 ng / μL LwaCas13a, 1 μL 10 ng / μL crRNA as shown in SEQ ID NO: 5, 1.25 μL 2 μM fluorescent reporter RNA, 0.5 μL 5 U / μL T7 RNA polymerase, 0.4 μL 1 M HEPES buffer, 0.18 μL 1 M MgCl2 solution, 0.8 μL rNTP mix, 1 μL 40 U / mL RNase inhibitor, and 11.87 μL enzyme-free water, wherein the rNTP mix is ​​a solution containing 25 mM ATP, 25 mM GTP, 25 mM UTP, and 25 mM CTP.

4. The kit according to claim 3, further comprising a nucleic acid extraction reagent, wherein the nucleic acid extraction reagent comprises: 100 mM Tris-HCl, 50 mM NaCl, 0.1 mM EDTA, 0.01% SDS, 0.04% lithium dodecyl sulfate, and 2% betaine.

5. A kit comprising: An immunochromatographic test paper, comprising, in order according to the sample flow direction, a sample pad containing a colloidal gold-labeled anti-FAM mouse IgG antibody, an NC membrane containing a T line and a C line, and a water-absorbing filter paper, wherein the T line is formed by streptavidin and the C line is formed by a secondary antibody of the colloidal gold-labeled antibody; RPA amplification reagent, wherein 50 μL of the RPA amplification reagent includes 75 mM Tris, 50 mM potassium acetate, 25 mM magnesium acetate, 25 mM β-mercaptoethanol, 3.5% polyethylene glycol-2000, 2 mM ATP, 200 mM dNTPs, 20 mM polyphosphate, 50 ng / μL polyphosphate kinase, 250 nM upstream primer of SEQ ID NO: 2, 250 nM downstream primer of SEQ ID NO: 3, 300 ng / μL TthRecA protein, 600 ng / μL TthSSB protein, 0.26 U / μL DNA polymerase Bst3.0, and 0.1 U / μL M-MLV reverse transcriptase; CRISPR detection reagent, which includes, per 19 μL, 2 μL of 7.9 ng / μL LwaCas13a, 1 μL of 10 ng / μL crRNA as shown in SEQ ID NO: 5, 1.25 μL of 2 μM fluorescent reporter RNA, 0.5 μL of 5 U / μL T7 RNA polymerase, 0.4 μL of 1 M HEPES buffer, 0.18 μL of 1 M MgCl2 solution, 0.8 μL of rNTP mix, 1 μL of 40 U / mL RNase inhibitor, and 11.87 μL of enzyme-free water, wherein the rNTP mix is ​​a solution containing 25 mM ATP, 25 mM GTP, 25 mM UTP, and 25 mM CTP.

6. The kit according to claim 5, further comprising a nucleic acid extraction reagent, wherein the nucleic acid extraction reagent comprises: 100 mM Tris-HCl, 50 mM NaCl, 0.1 mM EDTA, 0.01% SDS, 0.04% lithium dodecyl sulfate, and 2% betaine.

7. Use of the crRNA according to claim 1, the CRISPR composition according to claim 2, or the kit according to any one of claims 3 to 6 in the preparation of a product having at least one of the following functions 1)-2): 1) detecting whether the target nucleic acid is a neuregulin 4 nucleic acid; 2) Detecting whether the in vitro sample contains the target nucleic acid described in 1).

8. The use according to claim 7, wherein the in vitro sample is selected from at least one of a blood sample, a personal sample, a tissue sample, a saliva sample, a sweat sample, a urine sample, a throat swab sample, a milk sample, a semen sample, a skin wipe sample, a stool sample, and a sputum sample.

Citation Information

Patent Citations

  • Use of NRG4, or inhibitors thereof, in the treatment of colon and pancreatic cancers

    US20040005622A1