Improved activity cas proteins and uses thereof

Abstract

This invention belongs to the field of nucleic acid editing, particularly the field of regularly clustered short palindromic repeats (CRISPR). Specifically, this invention provides a Cas mutant protein with broad application prospects.

Description

Technical Field

[0001] This invention relates to the field of gene editing, particularly to the field of regularly clustered short palindromic repeats (CRISPR) technology. Specifically, this invention relates to an enhanced-activity Cas protein and its applications. Background Technology

[0002] CRISPR / Cas technology is a widely used gene editing technology that uses RNA to specifically bind to target sequences on the genome and cut DNA to create double-strand breaks, using biological non-homologous end joining or homologous recombination for site-specific gene editing.

[0003] The CRISPR / Cas9 system is the most commonly used type II CRISPR system. It recognizes the 3'-NGG PAM motif and performs blunt-end cleavage on the target sequence. CRISPR / Cas Type V systems are a newly discovered class of CRISPR systems with a 5'-TTN motif, performing sticky-end cleavage on the target sequence; examples include Cpf1, C2c1, CasX, and CasY. However, the different CRISPR / Cas systems currently available each have their own advantages and disadvantages. For example, Cas9, C2c1, and CasX all require two guide RNAs, while Cpf1 only requires one and can be used for multiplex gene editing. CasX is 980 amino acids in size, while common systems like Cas9, C2c1, CasY, and Cpf1 are typically around 1300 amino acids. Furthermore, the PAM sequences of Cas9, Cpf1, CasX, and CasY are relatively complex and diverse, while C2c1 recognizes the strict 5'-TTN, making its target site easier to predict than other systems and reducing potential off-target effects.

[0004] Chinese invention patent CN111757889B discloses a Cas protein Cas12f.4, which also discloses that the protein can perform gene editing in eukaryotic cells. However, its editing activity is not high. In order to improve the editing efficiency of the protein, this application optimizes the protein and improves its editing efficiency in eukaryotic cells. Summary of the Invention

[0005] Through extensive experimentation and repeated exploration, the inventors of this application improved the editing activity of the Cas12f.4 protein (referred to as Cas12i3 or Cas12i.3 in this application) by site-directed mutation, thus expanding its application scope.

[0006] Cas effector protein

[0007] On one hand, the present invention provides an activity-enhanced Cas mutant protein, wherein the mutant protein, compared with the amino acid sequence of the parental Cas protein, has a mutation at any one or any few of the following amino acid sites (e.g., any 2, any 3, any 4, any 5, any 6, any 7, any 8, or any 9) corresponding to the amino acid sequence shown in SEQ ID No. 1: position 328, position 369, position 398, position 432, position 433, position 941, position 942, position 945, or position 964.

[0008] In one embodiment, the Cas mutant protein has a mutation at the 328th amino acid site; furthermore, in addition to the mutation at the 328th amino acid site, it also includes any 1, any 2, any 3, any 4, any 5, any 6, any 7, or any 8 amino acid sites selected from the 369th, 398th, 432nd, 433rd, 941st, 942nd, 945th, or 964th amino acid sites.

[0009] In one embodiment, the Cas mutant protein has a mutation at the 369th amino acid site; furthermore, in addition to the mutation at the 369th amino acid site, it also includes any 1, any 2, any 3, any 4, any 5, any 6, any 7, or any 8 amino acid sites selected from the 328th, 398th, 432nd, 433rd, 941st, 942nd, 945th, or 964th amino acid sites.

[0010] In one embodiment, the Cas mutant protein has a mutation at the aforementioned amino acid position 328; furthermore, in addition to the mutation at position 328, it also includes any one or any number (e.g., any two, three, or four) amino acid mutations selected from the aforementioned amino acid positions 369, 433, 942, or 945. For example, simultaneous mutations at positions 328 and 369, simultaneous mutations at positions 328 and 433, simultaneous mutations at positions 328, 369, and 433, or simultaneous mutations at positions 328, 369, 433, 942, and 945.

[0011] In other embodiments, the Cas mutant protein has a mutation at the aforementioned amino acid position 369; furthermore, in addition to the mutation at amino acid position 369, it also includes any one or more (e.g., any two or three) amino acid mutations selected from the aforementioned amino acid positions 433, 942, or 945. For example, simultaneous mutations at positions 369 and 433, simultaneous mutations at positions 369 and 942, simultaneous mutations at positions 369 and 945, or simultaneous mutations at positions 369, 433, 942, and 945.

[0012] In other embodiments, the Cas mutant protein has a mutation at the aforementioned amino acid position 433; furthermore, in addition to the mutation at amino acid position 433, it also includes any one or two amino acid mutations selected from the aforementioned amino acid positions 942 or 945. For example, both positions 433 and 942 are mutated simultaneously, or both positions 433 and 945 are mutated simultaneously.

[0013] In one embodiment, the 328th amino acid is mutated to a non-E amino acid, such as A, V, G, L, Q, F, W, Y, D, S, K, N, M, T, C, P, H, R, I; preferably, R.

[0014] In one embodiment, the 369th amino acid is mutated to a non-N amino acid, such as A, V, G, L, Q, F, W, Y, D, S, E, K, M, T, C, P, H, R, I; preferably, R.

[0015] In one embodiment, the 398th amino acid is mutated to a non-F amino acid, such as A, V, G, L, Q, N, W, Y, D, S, E, K, M, T, C, P, H, R, I; preferably, R.

[0016] In one embodiment, the 432nd amino acid is mutated to a non-Q amino acid, such as A, V, G, L, F, N, W, Y, D, S, E, K, M, T, C, P, H, R, I; preferably, R.

[0017] In one embodiment, the 433rd amino acid is mutated to a non-S amino acid, such as A, V, G, L, Q, F, W, Y, D, N, E, K, M, T, C, P, H, R, I; preferably, R.

[0018] In one embodiment, the 941st amino acid is mutated to a non-N amino acid, such as A, V, G, L, Q, F, W, Y, D, S, E, K, M, T, C, P, H, R, I; preferably, R.

[0019] In one embodiment, the 942nd amino acid is mutated to a non-K amino acid, such as A, V, G, L, Q, F, W, Y, D, S, E, N, M, T, C, P, H, R, I; preferably, R.

[0020] In one embodiment, the 945th amino acid is mutated to a non-N amino acid, such as A, V, G, L, Q, F, W, Y, D, S, E, K, M, T, C, P, H, R, I; preferably, R.

[0021] In one embodiment, the 964th amino acid is mutated to a non-D amino acid, such as A, V, G, L, Q, F, W, Y, N, S, E, K, M, T, C, P, H, R, I; preferably, R.

[0022] In one embodiment, the amino acid sequence of the parental Cas protein has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 1.

[0023] In some embodiments, the parental Cas protein is a natural wild-type Cas protein; in other embodiments, the parental Cas protein is an engineered Cas protein.

[0024] In one embodiment, the parental Cas protein is a Cas12 family Cas protein, preferably a Cas12i family Cas protein, such as Cas12i1, Cas12i2, or Cas12i3.

[0025] In one embodiment, the amino acid sequence of the Cas12 family Cas protein has at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% or 100% sequence identity with SEQ ID No. 1.

[0026] Cas proteins or Cas12i proteins from various organisms can be used as parental Cas proteins. In some embodiments, the parental Cas protein or Cas12i protein has nuclease activity. In some embodiments, the parental Cas protein is a nuclease, i.e., cleaving both strands of a target double-stranded nucleic acid (e.g., double-stranded DNA). In some embodiments, the parental Cas protein is a cleavage enzyme, i.e., cleaving a single strand of a target double-stranded nucleic acid (e.g., double-stranded DNA).

[0027] In one embodiment, the Cas mutant protein is selected from any group I-III below:

[0028] I. A Cas mutant protein obtained by mutating the amino acid sequence shown in SEQ ID No. 1 at any of the following amino acid sites (e.g., any 2, any 3, any 4, any 5, any 6, any 7, any 8, or any 9): position 328, position 369, position 398, position 432, position 433, position 941, position 942, position 945, or position 964;

[0029] II. A Cas mutant protein having the mutation site described in I, compared to the Cas mutant protein described in I; and having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity compared to the Cas mutant protein described in I;

[0030] III. Compared with the Cas mutant protein described in I, it has the mutation site described in I; and compared with the Cas mutant protein described in I, it has a sequence of one or more amino acid substitutions, deletions, or additions; the one or more amino acids include substitutions, deletions, or additions of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids.

[0031] This application found that when the above-mentioned amino acid sites are mutated to positively charged amino acids such as R, H or K, or mutated to polar uncharged amino acids such as M, F, P, A, W, I, V, L, the editing activity of Cas protein can be significantly improved; when mutated to some nonpolar uncharged amino acids such as Q, C or Y, the editing activity of Cas protein can also be significantly improved.

[0032] Those skilled in the art will understand that the structure of a protein can be altered without adversely affecting its activity and function. For example, one or more conserved amino acid substitutions can be introduced into the amino acid sequence of a protein without adversely affecting the activity and / or three-dimensional structure of the protein molecule. Examples and implementations of conserved amino acid substitutions are familiar to those skilled in the art. Specifically, an amino acid residue can be substituted with another amino acid residue belonging to the same group as the site to be substituted, i.e., replacing another nonpolar amino acid residue with a nonpolar amino acid residue, replacing another polar uncharged amino acid residue with a polar uncharged amino acid residue, replacing another basic amino acid residue with a basic amino acid residue, and replacing another acidic amino acid residue with an acidic amino acid residue. Such substituted amino acid residues may or may not be encoded by the genetic code. Conservative substitutions, where an amino acid is replaced by another amino acid belonging to the same group, fall within the scope of this invention, provided that the substitution does not lead to inactivation of the protein's biological activity. Therefore, the proteins of this invention can contain one or more conserved substitutions in their amino acid sequence, preferably generated by substitutions according to Table 1. Furthermore, this invention also covers proteins that also contain one or more other nonconservative substitutions, provided that such nonconservative substitutions do not significantly affect the desired function and biological activity of the proteins of this invention.

[0033] Conservative amino acid substitutions can occur at one or more predicted non-essential amino acid residues. “Non-essential” amino acid residues are those that can be altered (deleted, substituted, or replaced) without changing biological activity, while “essential” amino acid residues are required for biological activity. A “conservative amino acid substitution” is a substitution in which an amino acid residue is replaced by an amino acid residue with a similar side chain. Amino acid substitutions can occur in the non-conservative regions of the aforementioned Cas mutant protein. Generally, such substitutions are not performed on conserved amino acid residues, or on amino acid residues located within conserved motifs, where such residues are required for protein activity. However, those skilled in the art will understand that functional variants may have fewer conserved or non-conserved alterations in conserved regions.

[0034] Table 1

[0035] The initial residues Representative substitution Preferred replacement Ala(A) Val; Leu; Ile Val Arg(R) Lys;Gln;Asn Lys Asn(N) Gln; His; Lys; Arg Gln Asp(D) Glu Glu Cys(C) Ser Ser Gln(Q) Asn Asn Glu(E) Asp Asp Gly(G) Pro; Ala Ala His(H) Asn; Gln; Lys; Arg Arg Ile(I) Leu; Val; Met; Ala; Phe Leu Leu(L) Ile; Val; Met; Ala; Phe Ile Lys(K) Arg;Gln;Asn Arg Met(M) Leu; Phe; Ile Leu Phe(F) Leu; Val; Ile; Ala; Tyr Leu Pro(P) Ala Ala Ser(S) Thr Thr Thr(T) Ser Ser Trp(W) Tyr; Phe Tyr Tyr(Y) Trp; Phe; Thr; Ser Phe Val(V) Ile; Leu; Met; Phe; Ala Leu

[0036] As is well known in the art, one or more amino acid residues can be altered (replaced, deleted, truncated, or inserted) from the N and / or C ends of a protein while retaining its functional activity. Therefore, proteins that have one or more amino acid residues altered from their N and / or C ends while retaining their desired functional activity are also within the scope of this invention. These alterations can include those introduced by modern molecular methods such as PCR, which includes PCR amplification that alters or lengthens the protein-coding sequence by means of oligonucleotides containing amino acid-coding sequences used in the PCR amplification.

[0037] It should be recognized that proteins can be altered in various ways, including amino acid substitutions, deletions, truncations, and insertions, and methods for such operations are generally known in the art. For example, amino acid sequence variants of the aforementioned proteins can be prepared by mutating DNA. This can also be accomplished through other forms of mutagenesis and / or directed evolution, for example, using known mutagenesis, recombination, and / or shuffling methods, combined with relevant screening methods, to perform single or multiple amino acid substitutions, deletions, and / or insertions.

[0038] Those skilled in the art will understand that these minor amino acid changes in the Cas protein of this invention can occur (e.g., naturally occurring mutations) or be generated (e.g., using r-DNA technology) without loss of protein function or activity. If these mutations occur in the catalytic domain, active site, or other functional domains of the protein, the properties of the polypeptide may be altered, but the polypeptide may retain its activity. If the mutations are not located near the catalytic domain, active site, or other functional domains, a smaller impact can be expected.

[0039] Those skilled in the art can identify the essential amino acids of the Cas mutant protein of the present invention using methods known in the art, such as localized mutagenesis, protein evolution, or bioinformatics analysis. The catalytic domains, active sites, or other functional domains of the protein can also be determined through physical structural analysis, such as by techniques like nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, combined with mutations in presumed key site amino acids.

[0040] In this invention, amino acid residues can be represented by a single letter or by three letters, for example: alanine (Ala, A), valine (Val, V), glycine (Gly, G), leucine (Leu, L), glutamic acid (Gln, Q), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), asparagine (Asn, N), glutamic acid (Glu, E), lysine (Lys, K), methionine (Met, M), serine (Ser, S), threonine (Thr, T), cysteine ​​(Cys, C), proline (Pro, P), isoleucine (Ile, I), histidine (His, H), and arginine (Arg, R).

[0041] The term "AxxB" indicates that amino acid A at position xx is changed to amino acid B. For example, E328R means that E at position 328 is mutated to R. When multiple amino acid sites are mutated simultaneously, it can be expressed in a form similar to E328R-N369R. For example, E328R-N369R represents that E at position 328 is mutated to R and N at position 369 is mutated to R.

[0042] The specific amino acid positions (numbers) within the protein described in this invention are determined using standard sequence alignment tools by comparing the amino acid sequence of the target protein with SEQ ID No. 1. For example, the Smith-Waterman algorithm or the CLUSTALW2 algorithm can be used to align two sequences, with the sequence considered aligned when the alignment score is the highest. The alignment score can be calculated according to the method described in Wilbur, WJ and Lipman, DJ (1983) Rapid similarity searches of nucleic acid and protein data banks. Proc. Natl. Acad. Sci. USA, 80:726-730. In the ClustalW2 (1.82) algorithm, the default parameters are preferably used: protein gap opening penalty = 10.0; protein gap extension penalty = 0.2; protein matrix = Gonnet; protein / DNA end gap = -1; protein / DNA GAPDIST = 4. The AlignX program (part of the vectorNTI group) is preferably used with default parameters suitable for multiple alignments (gap opening penalty: 10; gap extension penalty: 0.05) to determine the position of specific amino acids in the protein of the present invention by comparing the amino acid sequence of the protein with SEQ ID No. 1.

[0043] The biological functions of the Cas protein include, but are not limited to, activities that bind to guide RNA, endonuclease activities, and activities that bind to and cleave specific sites of target sequences under the guidance of guide RNA, including but not limited to Cis cleavage activities and Trans cleavage activities.

[0044] In this invention, "Cas mutant protein" can also be referred to as mutated Cas protein or Cas protein variant.

[0045] The present invention also provides a fusion protein comprising the Cas mutant protein as described above and other modified portions.

[0046] In one embodiment, the modified portion is selected from other proteins or peptides, detectable markers, or any combination thereof.

[0047] In one embodiment, the modified portion is selected from epitope tags, reporter gene sequences, nuclear localization signal (NLS) sequences, targeting portions, transcriptional activation domains (e.g., VP64), transcriptional repression domains (e.g., KRAB or SID domains), nuclease domains (e.g., Fok1), and domains having activities selected from: nucleotide deaminase, methyltransferase activity, demethylase, transcriptional activation activity, transcriptional repression activity, transcriptional release factor activity, histone modification activity, nuclease activity, single-stranded RNA cleavage activity, double-stranded RNA cleavage activity, single-stranded DNA cleavage activity, double-stranded DNA cleavage activity, and nucleic acid binding activity; and any combination thereof. The NLS sequences are well known to those skilled in the art, and examples include, but are not limited to, the SV40 large T antigen, EGL-13, c-Myc, and TUS protein.

[0048] In one embodiment, the NLS sequence is located at, near, or close to the end (e.g., N-terminus, C-terminus, or both ends) of the Cas protein of the present invention.

[0049] The epitope tag is well known to those skilled in the art, including but not limited to His, V5, FLAG, HA, Myc, VSV-G, Trx, etc., and those skilled in the art can choose other suitable epitope tags (e.g., for purification, detection, or tracing).

[0050] The reporter gene sequences are well known to those skilled in the art, and examples include, but are not limited to, GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP, etc.

[0051] In one embodiment, the fusion protein of the present invention includes a domain capable of binding to DNA molecules or intracellular molecules, such as maltose-binding protein (MBP), the DNA-binding domain (DBD) of Lex A, the DBD of GAL4, etc.

[0052] In one embodiment, the fusion protein of the present invention contains a detectable marker, such as a fluorescent dye, such as FITC or DAPI.

[0053] In one embodiment, the Cas protein of the present invention is optionally coupled, conjugated, or fused to the modified portion via a linker.

[0054] In one embodiment, the modified portion is directly connected to the N-terminus or C-terminus of the Cas protein of the present invention.

[0055] In one embodiment, the modified portion is attached to the N-terminus or C-terminus of the Cas protein of the present invention via a linker. Such linkers are well known in the art, and examples include, but are not limited to, linkers containing one or more (e.g., 1, 2, 3, 4, or 5) amino acids (e.g., Glu or Ser) or amino acid derivatives (e.g., Ahx, β-Ala, GABA, or Ava), or PEG, etc.

[0056] The Cas protein, protein derivative, or fusion protein of the present invention is not limited by the manner of its production. For example, it can be produced by genetic engineering methods (recombinant technology) or by chemical synthesis methods.

[0057] Nucleic acid of Cas protein

[0058] On the other hand, the present invention provides an isolated polynucleotide comprising:

[0059] (a) A multinucleotide sequence encoding the Cas mutant protein or fusion protein of the present invention;

[0060] Alternatively, a polynucleotide complementary to the polynucleotide described in (a).

[0061] In one embodiment, the nucleotide sequence is codon-optimized for expression in prokaryotic cells. In another embodiment, the nucleotide sequence is codon-optimized for expression in eukaryotic cells.

[0062] In one embodiment, the cell is an animal cell, such as a mammalian cell.

[0063] In one embodiment, the cell is a human cell.

[0064] In one embodiment, the cell is a plant cell, such as the cell of a cultivated plant (e.g., cassava, corn, sorghum, wheat, or rice), algae, tree, or vegetable.

[0065] In one embodiment, the polynucleotide is preferably single-stranded or double-stranded.

[0066] Guide RNA (gRNA)

[0067] On the other hand, the present invention provides a gRNA comprising a first segment and a second segment; the first segment is also referred to as a "backbone region", "protein binding region", "protein binding sequence", or "direct repeat sequence"; the second segment is also referred to as a "target sequence for targeting nucleic acids", "target segment for targeting nucleic acids", or "guide sequence for targeting target sequences".

[0068] The first segment of the gRNA can interact with the Cas protein of the present invention, thereby enabling the Cas protein and gRNA to form a complex.

[0069] In a preferred embodiment, the first segment is a repeating sequence in the same direction as described above.

[0070] The target sequence or target region of the nucleic acid targeted by this invention comprises a nucleotide sequence complementary to a sequence in the target nucleic acid. In other words, the target sequence or target region of the nucleic acid targeted by this invention interacts with the target nucleic acid in a sequence-specific manner through hybridization (i.e., base pairing). Therefore, the target sequence or target region of the nucleic acid can be altered or modified to hybridize with any desired sequence within the target nucleic acid. The nucleic acid is selected from DNA or RNA.

[0071] The percentage of complementarity between the target sequence or target region of the target nucleic acid and the target sequence of the target nucleic acid may be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%).

[0072] The "backbone region," "protein-binding region," "protein-binding sequence," or "direct repeat sequence" of the gRNA of this invention can interact with CRISPR proteins (or Cas proteins). The gRNA of this invention guides the interacting Cas protein to a specific nucleotide sequence within the target nucleic acid through the targeting sequence of the target nucleic acid.

[0073] Preferably, the guide RNA comprises a first segment and a second segment in the 5' to 3' direction.

[0074] In this invention, the second segment can also be understood as a guide sequence for hybridization with the target sequence.

[0075] The gRNA of the present invention can form a complex with the Cas protein.

[0076] carrier

[0077] The present invention also provides a carrier comprising, as described above, a Cas mutant protein, an isolated nucleic acid molecule or a polynucleotide; preferably, it further comprises a regulatory element operatively linked thereto.

[0078] In one embodiment, the regulatory element is selected from one or more of the following: enhancers, transposons, promoters, terminators, leader sequences, polyadenylation sequences, and marker genes.

[0079] In one embodiment, the vector includes a cloning vector, an expression vector, a shuttle vector, and an integration vector.

[0080] In some implementations, the vectors included in the system are viral vectors (e.g., retroviral vectors, lentiviral vectors, adenovirus vectors, adeno-associated vectors, and herpes simplex vectors), and may also be plasmids, viruses, granules, bacteriophages, etc., which are well known to those skilled in the art.

[0081] CRISPR system

[0082] The present invention provides an engineered, non-naturally occurring vector system, or a CRISPR-Cas system, comprising a Cas mutant protein or a nucleic acid sequence encoding the Cas mutant protein and a nucleic acid encoding one or more guide RNAs.

[0083] In one embodiment, the nucleic acid sequence encoding the Cas mutant protein and the nucleic acid encoding one or more guide RNAs are artificially synthesized.

[0084] In one embodiment, the nucleic acid sequence encoding the Cas mutant protein and the nucleic acid encoding one or more guide RNAs do not coexist naturally.

[0085] The one or more guide RNAs target one or more target sequences in the cell. The one or more target sequences hybridize to the genomic loci of a DNA molecule encoding one or more gene products and guide the Cas protein to the genomic locus of the DNA molecule of the one or more gene products. Once the Cas protein reaches the target sequence location, it modifies, edits, or cuts the target sequence, thereby altering or modifying the expression of the one or more gene products.

[0086] The cells of this invention include one or more of animals, plants, or microorganisms.

[0087] In some embodiments, the Cas protein is codon-optimized for expression in cells.

[0088] In some embodiments, the Cas protein directs cleavage of one or both strands at the target sequence location.

[0089] The present invention also provides an engineered, non-naturally occurring carrier system, which may include one or more carriers, the one or more carriers comprising:

[0090] a) A first regulatory element, which is operatively linked to the gRNA.

[0091] b) A second regulatory element operatively linked to the Cas protein;

[0092] Components (a) and (b) are located on the same or different carriers in the system.

[0093] The first and second regulatory elements include promoters (e.g., constitutive or inducible promoters), enhancers (e.g., 35S promoters or 35S enhanced promoters), internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and polyU sequences).

[0094] In some implementations, the vector in the system is a viral vector (e.g., a retroviral vector, lentiviral vector, adenovirus vector, adeno-associated vector, and herpes simplex vector), or it can be a plasmid, virus, granule, bacteriophage, or other type known to those skilled in the art.

[0095] In some embodiments, the system provided herein is a delivery system. In some embodiments, the delivery system is a nanoparticle, liposome, exosome, microbubble, or gene gun.

[0096] In one embodiment, the target sequence is a DNA or RNA sequence derived from prokaryotic or eukaryotic cells. In another embodiment, the target sequence is a non-naturally occurring DNA or RNA sequence.

[0097] In one embodiment, the target sequence is present within the cell. In another embodiment, the target sequence is present in the cell nucleus or cytoplasm (e.g., organelles). In one embodiment, the cell is a eukaryotic cell. In other embodiments, the cell is a prokaryotic cell.

[0098] In one embodiment, the Cas protein is linked to one or more NLS sequences. In one embodiment, the fusion protein comprises one or more NLS sequences. In one embodiment, the NLS sequence is linked to the N-terminus or C-terminus of the protein. In one embodiment, the NLS sequence is fused to the N-terminus or C-terminus of the protein.

[0099] On the other hand, the present invention relates to an engineered CRISPR system comprising the aforementioned Cas protein and one or more guide RNAs, wherein the guide RNA comprises a homologous repeat sequence and a spacer sequence capable of hybridizing with a target nucleic acid, and the Cas protein is capable of binding the guide RNA and targeting a target nucleic acid sequence complementary to the spacer sequence.

[0100] Protein-nucleic acid complexes / compositions

[0101] On the other hand, the present invention provides a complex or composition comprising:

[0102] (i) Protein components selected from: the aforementioned Cas proteins, derived proteins, or fusion proteins, and any combination thereof; and

[0103] (ii) A nucleic acid component comprising (a) a guide sequence capable of hybridizing with a target sequence; and (b) a unidirectional repeat sequence capable of binding to the Cas protein of the present invention.

[0104] The protein components and nucleic acid components combine to form a complex.

[0105] In one embodiment, the nucleic acid component is a guide RNA in a CRISPR-Cas system.

[0106] In one embodiment, the complex or composition is non-natural or modified. In one embodiment, at least one component of the complex or composition is non-natural or modified. In one embodiment, the first component is non-natural or modified; and / or, the second component is non-natural or modified.

[0107] Activated CRISPR complex

[0108] On the other hand, the present invention also provides an activated CRISPR complex comprising: (1) a protein component selected from the Cas protein, derived protein, or fusion protein of the present invention, and any combination thereof; (2) a gRNA comprising (a) a guide sequence capable of hybridizing with a target sequence; and (b) a homologous repeat sequence capable of binding to the Cas protein of the present invention; and (3) a target sequence bound to the gRNA. Preferably, the binding is a binding between the target sequence of the target nucleic acid on the gRNA and the target nucleic acid.

[0109] The term “activated CRISPR complex”, “activated complex”, or “ternary complex” used in this article refers to the complex formed by the binding or modification of the Cas protein, gRNA, and target nucleic acid in the CRISPR system.

[0110] The Cas protein and gRNA of this invention can form a binary complex, which is activated upon binding to a nucleic acid substrate to form an activated CRISPR complex. The nucleic acid substrate is complementary to the spacer sequence (or, in other words, the guide sequence for hybridization with the target nucleic acid) in the gRNA. In some embodiments, the spacer sequence of the gRNA perfectly matches the target substrate. In other embodiments, the spacer sequence of the gRNA partially (continuously or discontinuously) matches the target substrate.

[0111] In a preferred embodiment, the activated CRISPR complex can exhibit side-branch nuclease cleavage activity, which refers to the non-specific or random cleavage activity of the activated CRISPR complex on single-stranded nucleic acids, also known in the art as trans cleavage activity.

[0112] Delivery and delivery composition

[0113] The Cas proteins, gRNAs, fusion proteins, nucleic acid molecules, vectors, systems, complexes, and compositions of the present invention can be delivered by any method known in the art. Such methods include, but are not limited to, electroporation, lipid transfection, nuclear transfection, microinjection, acoustic pore effect, gene gun, calcium phosphate-mediated transfection, cationic transfection, liposome transfection, dendritic transfection, heat shock transfection, nuclear transfection, magnetic transfection, lipid transfection, puncture transfection, optical transfection, reagent-enhanced nucleic acid uptake, and delivery via liposomes, immunoliposomes, viral particles, artificial viruses, etc.

[0114] Therefore, in another aspect, the present invention provides a delivery composition comprising a delivery vector and selected from one or more of the following: the Cas protein, fusion protein, nucleic acid molecule, vector, system, complex and composition of the present invention.

[0115] In one embodiment, the delivery carrier is a particle.

[0116] In one embodiment, the delivery vector is selected from lipid particles, sugar particles, metal particles, protein particles, liposomes, exosomes, microvesicles, gene guns, or viral vectors (e.g., replication-defective retroviruses, lentiviruses, adenoviruses, or adeno-associated viruses).

[0117] host cells

[0118] The present invention also relates to an in vitro, ex vivo, or in vivo cell or cell line or its progeny, said cell or cell line or its progeny comprising: the Cas protein of the present invention, a fusion protein, a nucleic acid molecule, a protein-nucleic acid complex, an activated CRISPR complex, a vector, or the delivery composition of the present invention.

[0119] In some implementations, the cell is a prokaryotic cell.

[0120] In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is a non-human mammalian cell, such as cells of non-human primates, cattle, sheep, pigs, dogs, monkeys, rabbits, or rodents (e.g., rats or mice). In some embodiments, the cell is a non-mammalian eukaryotic cell, such as cells of poultry (e.g., chickens), fish, or crustaceans (e.g., clams, shrimp). In some embodiments, the cell is a plant cell, such as cells of monocotyledonous or dicotyledonous plants, or cells of cultivated plants or food crops such as cassava, corn, sorghum, soybeans, wheat, oats, or rice, such as algae, trees, or productive plants, fruits, or vegetables (e.g., trees such as citrus trees, nut trees; nightshade plants, cotton, tobacco, tomatoes, grapes, coffee, cocoa, etc.).

[0121] In some implementations, the cell is a stem cell or stem cell line.

[0122] In some cases, the host cells of the present invention contain genetic or genomic modifications that are not present in their wild type.

[0123] Gene editing methods and applications

[0124] The Cas mutant protein, nucleic acid, the above-described composition, the above-described CRISPR / Cas system, the above-described vector system, the above-described delivery composition, or the above-described activated CRISPR complex or the above-described host cell of the present invention can be used for any or more of the following purposes: targeting and / or editing target nucleic acids; cleaving double-stranded DNA, single-stranded DNA, or single-stranded RNA; non-specifically cleaving and / or degrading side-branched nucleic acids; non-specifically cleaving single-stranded nucleic acids; nucleic acid detection; detecting nucleic acids in target samples; specifically editing double-stranded nucleic acids; base editing double-stranded nucleic acids; base editing single-stranded nucleic acids. In other embodiments, they can also be used to prepare reagents or kits for any or more of the above purposes.

[0125] The present invention also provides the use of the above-mentioned Cas protein, nucleic acid, the above-mentioned composition, the above-mentioned CIRSPR / Cas system, the above-mentioned vector system, the above-mentioned delivery composition, or the above-mentioned activated CRISPR complex in gene editing, gene targeting, or gene cutting; or, in the preparation of reagents or kits for gene editing, gene targeting, or gene cutting.

[0126] In one embodiment, the gene editing, gene targeting, or gene cutting is performed intracellularly and / or extracellularly.

[0127] The present invention also provides a method for editing, targeting, or cleaving a target nucleic acid, the method comprising contacting the target nucleic acid with the aforementioned Cas protein, nucleic acid, the aforementioned composition, the aforementioned CIRSPR / Cas system, the aforementioned vector system, the aforementioned delivery composition, or the aforementioned activated CRISPR complex. In one embodiment, the method comprises editing, targeting, or cleaving the target nucleic acid intracellularly or extracellularly.

[0128] The gene editing or editing of target nucleic acids includes modifying genes, knocking out genes, altering the expression of gene products, repairing mutations, and / or inserting polynucleotides, and gene mutations.

[0129] The editing can be performed in prokaryotic and / or eukaryotic cells.

[0130] On the other hand, the present invention also provides the use of the above-mentioned Cas protein, nucleic acid, the above-mentioned composition, the above-mentioned CIRSPR / Cas system, the above-mentioned carrier system, the above-mentioned delivery composition or the above-mentioned activated CRISPR complex in nucleic acid detection, or in the preparation of reagents or kits for nucleic acid detection.

[0131] On the other hand, the present invention also provides a method for cleaving single-stranded nucleic acids, the method comprising contacting a nucleic acid population with the aforementioned Cas protein and gRNA, wherein the nucleic acid population comprises a target nucleic acid and a plurality of non-target single-stranded nucleic acids, and the Cas protein cleaving the plurality of non-target single-stranded nucleic acids.

[0132] The gRNA can bind to the Cas protein.

[0133] The gRNA can target the target nucleic acid.

[0134] The contact can be outside the body, outside the body, or inside the cells within the body.

[0135] Preferably, the cleavage of the single-stranded nucleic acid is non-specific.

[0136] On the other hand, the present invention also provides the use of the above-described Cas protein, nucleic acid, the above-described composition, the above-described CIRSPR / Cas system, the above-described carrier system, the above-described delivery composition, or the above-described activated CRISPR complex in the non-specific cleavage of single-stranded nucleic acids, or in the preparation of reagents or kits for the non-specific cleavage of single-stranded nucleic acids.

[0137] On the other hand, the present invention also provides a kit for gene editing, gene targeting or gene cutting, the kit comprising the above-mentioned Cas protein, gRNA, nucleic acid, the above-mentioned composition, the above-mentioned CIRSPR / Cas system, the above-mentioned vector system, the above-mentioned delivery composition, the above-mentioned activated CRISPR complex or the above-mentioned host cell.

[0138] On the other hand, the present invention also provides a kit for detecting target nucleic acids in a sample, the kit comprising: (a) a Cas protein, or a nucleic acid encoding the Cas protein; (b) a guide RNA, or a nucleic acid encoding the guide RNA, or a precursor RNA containing the guide RNA, or a nucleic acid encoding the precursor RNA; and (c) a single-stranded nucleic acid detector that is single-stranded and does not hybridize with the guide RNA.

[0139] As is known in the art, precursor RNA can be cleaved or processed into the aforementioned mature guide RNA.

[0140] On the other hand, the invention provides the use of the above-mentioned Cas protein, nucleic acid, composition, CRISPR / Cas system, vector system, delivery composition, activated CRISPR complex, or host cell in the preparation of formulations or kits, wherein the formulations or kits are used for:

[0141] (i) Gene or genome editing;

[0142] (ii) Target nucleic acid detection and / or diagnosis;

[0143] (iii) Editing target sequences in target loci to modify biological or non-human organisms;

[0144] (iv) Treatment of the disease;

[0145] (iv) Targeting target genes.

[0146] Preferably, the above-mentioned gene or genome editing is performed intracellularly or extracellularly.

[0147] Preferably, the target nucleic acid detection and / or diagnosis is performed in vitro.

[0148] Preferably, the treatment of the disease is to treat symptoms caused by defects in the target sequence at the target locus.

[0149] In another aspect, the present invention provides a method for detecting target nucleic acids in a sample, the method comprising contacting the sample with the Cas protein, gRNA (guide RNA) and a single-stranded nucleic acid detector, the gRNA including a region binding to the Cas protein and a guide sequence for hybridization with the target nucleic acid; detecting a detectable signal generated by the single-stranded nucleic acid detector by the Cas protein cleaving the single-stranded nucleic acid detector, thereby detecting the target nucleic acid; the single-stranded nucleic acid detector not hybridizing with the gRNA.

[0150] Methods for specifically modifying target nucleic acids

[0151] On the other hand, the present invention also provides a method for specifically modifying target nucleic acids, the method comprising: contacting the target nucleic acid with the above-mentioned Cas protein, nucleic acid, the above-mentioned composition, the above-mentioned CIRSPR / Cas system, the above-mentioned vector system, the above-mentioned delivery composition or the above-mentioned activated CRISPR complex.

[0152] This specific modification can occur in vivo or in vitro.

[0153] This specific modification can occur either inside or outside the cell.

[0154] In some cases, the cells are selected from prokaryotic or eukaryotic cells, such as animal cells, plant cells, or microbial cells.

[0155] In one embodiment, the modification refers to a break in the target sequence, such as a single-strand / double-strand break in DNA or a single-strand break in RNA.

[0156] In some cases, the method further includes contacting the target nucleic acid with a donor polynucleotide, wherein the donor polynucleotide, a portion of the donor polynucleotide, a copy of the donor polynucleotide, or a portion of a copy of the donor polynucleotide is integrated into the target nucleic acid.

[0157] In one embodiment, the modification further includes inserting an editing template (e.g., exogenous nucleic acid) into the break.

[0158] In one embodiment, the method further includes contacting the editing template with the target nucleic acid or delivering it to a cell containing the target nucleic acid. In this embodiment, the method repairs the broken target gene by homologous recombination with a foreign template polynucleotide; in some embodiments, the repair results in a mutation, including the insertion, deletion, or substitution of one or more nucleotides of the target gene; in other embodiments, the mutation results in a change in one or more amino acids in a protein expressed from a gene containing the target sequence.

[0159] Detection (non-specific cutting)

[0160] On the other hand, the present invention provides a method for detecting target nucleic acids in a sample, the method comprising contacting the sample with the above-mentioned Cas protein, nucleic acid, the above-mentioned composition, the above-mentioned CIRSPR / Cas system, the above-mentioned carrier system, the above-mentioned delivery composition or the above-mentioned activated CRISPR complex and a single-stranded nucleic acid detector; detecting a detectable signal generated by the single-stranded nucleic acid detector by the Cas protein cleaving the single-stranded nucleic acid, thereby detecting the target nucleic acid.

[0161] In this invention, the target nucleic acid includes ribonucleotides or deoxyribonucleotides; including single-stranded nucleic acids and double-stranded nucleic acids, such as single-stranded DNA, double-stranded DNA, single-stranded RNA, and double-stranded RNA.

[0162] In one embodiment, the target nucleic acid is derived from samples such as viruses, bacteria, microorganisms, soil, water sources, humans, animals, and plants. Preferably, the target nucleic acid is a product enriched or amplified by methods such as PCR, NASBA, RPA, SDA, LAMP, HAD, NEAR, MDA, RCA, LCR, and RAM.

[0163] In one embodiment, the target nucleic acid is viral nucleic acid, bacterial nucleic acid, disease-related specific nucleic acid, such as specific mutation sites or SNP sites, or nucleic acids that differ from controls; preferably, the virus is a plant virus or animal virus, such as papillomavirus, hepatocyte DNA virus, herpesvirus, adenovirus, poxvirus, parvovirus, or coronavirus; preferably, the virus is a coronavirus, preferably SARS, SARS-CoV2 (COVID-19), HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, or Mers-Cov.

[0164] In this invention, the gRNA has at least a 50% match with the target sequence on the target nucleic acid, preferably at least 60%, preferably at least 70%, preferably at least 80%, and preferably at least 90%.

[0165] In one implementation, when the target sequence contains one or more signature sites (such as specific mutation sites or SNPs), the signature sites perfectly match the gRNA.

[0166] In one embodiment, the detection method may include one or more gRNAs with different guide sequences that target different target sequences.

[0167] In this invention, the single-stranded nucleic acid detector includes, but is not limited to, single-stranded DNA, single-stranded RNA, DNA-RNA hybrids, nucleic acid analogs, base modifiers, and single-stranded nucleic acid detectors containing base-free spacers; "nucleic acid analogs" include, but are not limited to: locked nucleic acids, bridging nucleic acids, morpholine nucleic acids, ethylene glycol nucleic acids, hexitol nucleic acids, threonine nucleic acids, arabinose nucleic acids, 2'-oxymethyl RNA, 2'-methoxyacetyl RNA, 2'-fluoroRNA, 2'-aminoRNA, 4'-thioRNA, and combinations thereof, including optional ribonucleotide or deoxyribonucleotide residues.

[0168] In this invention, the detectable signal is achieved through the following methods: vision-based detection, sensor-based detection, color detection, fluorescence signal-based detection, gold nanoparticle-based detection, fluorescence polarization, colloidal phase transition / dispersion, electrochemical detection, and semiconductor-based detection.

[0169] In this invention, preferably, a fluorescent group and a quenching group are respectively disposed at both ends of the single-stranded nucleic acid detector, so that the single-stranded nucleic acid detector can exhibit a detectable fluorescent signal after being cleaved. The fluorescent group is selected from one or any combination of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, or LC RED460; the quenching group is selected from one or any combination of BHQ1, BHQ2, BHQ3, Dabcy1, or Tamra.

[0170] In other embodiments, different labeling molecules are set at the 5' and 3' ends of the single-stranded nucleic acid detector, and the colloidal gold test results of the single-stranded nucleic acid detector before and after being cleaved by the Cas protein are detected by colloidal gold detection. The single-stranded nucleic acid detector will show different color development results on the colloidal gold detection line and control line before and after being cleaved by the Cas protein.

[0171] In some implementations, the method for detecting target nucleic acids may further include comparing the level of a detectable signal with a reference signal level, and determining the amount of target nucleic acid in the sample based on the level of the detectable signal.

[0172] In some implementations, the method for detecting target nucleic acids may also include using RNA reporter nucleic acids and DNA reporter nucleic acids (e.g., fluorescence color) on different channels and determining the level of a detectable signal by measuring the signal levels of the RNA and DNA reporter molecules and by measuring the amount of target nucleic acid in the RNA and DNA reporter molecules, sampling based on the combined (e.g., using minimum or product) level of the detectable signal.

[0173] In one embodiment, the target gene is present within the cell.

[0174] In one embodiment, the cell is a prokaryotic cell.

[0175] In one embodiment, the cell is a eukaryotic cell.

[0176] In one embodiment, the cell is an animal cell.

[0177] In one embodiment, the cell is a human cell.

[0178] In one embodiment, the cell is a plant cell, such as the cell of a cultivated plant (e.g., cassava, corn, sorghum, wheat, or rice), algae, tree, or vegetable.

[0179] In one embodiment, the target gene is present in an in vitro nucleic acid molecule (e.g., a plasmid).

[0180] In one embodiment, the target gene is present in a plasmid.

[0181] Terminology Definition

[0182] In this invention, unless otherwise stated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, the operational steps used herein, such as molecular genetics, nucleic acid chemistry, chemistry, molecular biology, biochemistry, cell culture, microbiology, cell biology, genomics, and recombinant DNA, are all conventional steps widely used in their respective fields. To better understand this invention, definitions and explanations of relevant terms are provided below.

[0183] Nucleic acid cleavage or cleavage of nucleic acids as used herein includes: DNA or RNA breaks in target nucleic acids produced by the Cas enzyme described herein (Cis cleavage), and DNA or RNA breaks in side-branched nucleic acid substrates (single-stranded nucleic acid substrates) (i.e., nonspecific or non-targeted, trans cleavage). In some embodiments, the cleavage is a double-stranded DNA break. In some embodiments, the cleavage is a single-stranded DNA break or a single-stranded RNA break.

[0184] CRISPR system

[0185] As used herein, the terms “regularly clustered short palindromic repeats (CRISPR)-CRISPR-related (Cas) (CRISPR-Cas) system” or “CRISPR system” are used interchangeably and have the meaning commonly understood by those skilled in the art, which typically includes transcripts or other elements relating to the expression of CRISPR-related (“Cas”) genes, or transcripts or other elements capable of directing the activity of said Cas genes.

[0186] CRISPR / Cas complex

[0187] As used herein, the term “CRISPR / Cas complex” refers to a complex formed by the binding of guide RNA or mature crRNA to the Cas protein, which contains a guide sequence that hybridizes to the target sequence and a homologous repeat sequence that binds to the Cas protein. This complex is capable of recognizing and cleaving polynucleotides that hybridize with the guide RNA or mature crRNA.

[0188] Guide RNA (gRNA)

[0189] As used herein, the terms “guide RNA (gRNA),” “mature crRNA,” and “guide sequence” are used interchangeably and have the meanings commonly understood by those skilled in the art. Generally, guide RNA may comprise a direct repeat sequence and a guide sequence, or consist substantially of or composed of a direct repeat sequence and a guide sequence.

[0190] In some cases, the guide sequence is any polynucleotide sequence that is sufficiently complementary to the target sequence to hybridize with the target sequence and guide the specific binding of the CRISPR / Cas complex to the target sequence. In one embodiment, the complementarity between the guide sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% when optimal alignment is achieved. Determining the optimal alignment is within the capabilities of a person skilled in the art. For example, publicly available and commercially available alignment algorithms and programs exist, such as, but not limited to, ClustalW, the Smith-Waterman algorithm in MATLAB, Bowtie, Geneious, Biopython, and SeqMan.

[0191] target sequence

[0192] A "target sequence" refers to a polynucleotide targeted by a guide sequence in the gRNA, such as a sequence complementary to that guide sequence, where hybridization between the target and guide sequences will promote the formation of a CRISPR / Cas complex (including the Cas protein and gRNA). Perfect complementarity is not required, as long as sufficient complementarity exists to induce hybridization and promote the formation of a CRISPR / Cas complex.

[0193] The target sequence can contain any polynucleotide, such as DNA or RNA. In some cases, the target sequence is located inside or outside the cell. In some cases, the target sequence is located in the cell nucleus or cytoplasm. In some cases, the target sequence may be located in an organelle of a eukaryotic cell, such as a mitochondrion or chloroplast. The sequence or template that can be used for recombination into a target locus containing the target sequence is referred to as an "edit template," "edit polynucleotide," or "edit sequence." In one embodiment, the edit template is a foreign nucleic acid. In one embodiment, the recombination is homologous recombination.

[0194] In this invention, the "target sequence," "target polynucleotide," or "target nucleic acid" can be any endogenous or exogenous polynucleotide for a cell (e.g., a eukaryotic cell). For example, the target polynucleotide can be a polynucleotide present in the nucleus of a eukaryotic cell. The target polynucleotide can be a sequence encoding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory polynucleotide or useless DNA). In some cases, the target sequence should be associated with a protospacer adjacent motif (PAM).

[0195] Single-stranded nucleic acid detector

[0196] The single-stranded nucleic acid detector described in this invention refers to a sequence containing 2-200 nucleotides, preferably 2-150 nucleotides, more preferably 3-100 nucleotides, more preferably 3-30 nucleotides, more preferably 4-20 nucleotides, and even more preferably 5-15 nucleotides. It is preferably a single-stranded DNA molecule, a single-stranded RNA molecule, or a single-stranded DNA-RNA hybrid.

[0197] The single-stranded nucleic acid detector has different reporter groups or label molecules at both ends. When it is in its initial state (i.e., uncut state), it does not present a reporter signal. When the single-stranded nucleic acid detector is cut, it presents a detectable signal, that is, it shows a detectable difference after cutting compared to before cutting.

[0198] In one embodiment, the reporter group or labeled molecule includes a fluorescent group and a quencher group, wherein the fluorescent group is selected from one or any of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, or LC RED460; and the quencher group is selected from one or any of BHQ1, BHQ2, BHQ3, Dabcy1, or Tamra.

[0199] In one embodiment, the single-stranded nucleic acid detector has a first molecule (such as FAM or FITC) connected to the 5' end and a second molecule (such as biotin) connected to the 3' end. The reaction system containing the single-stranded nucleic acid detector is used in conjunction with a flow strip to detect target nucleic acids (preferably, colloidal gold detection). The flow strip is designed with two capture lines, with an antibody binding the first molecule (i.e., the first molecule antibody) at the sample contact end (colloidal gold), an antibody binding the first molecule antibody at the first line (control line), and an antibody binding the second molecule antibody (i.e., the second molecule antibody, such as avidin) at the second line (test line). As the reaction flows along the strip, the first molecule antibody binds to the first molecule, carrying cleaved or uncleaved oligonucleotides to the capture lines. Cleaved reporters bind to the first molecule antibody at the first capture line, while uncleaved reporters bind to the second molecule antibody at the second capture line. The binding of the reporter group at each line results in a strong readout / signal (e.g., color). As more reporters are cleaved, more signal accumulates at the first capture line, and less signal appears at the second line. In some aspects, the present invention relates to the use of flow strips as described herein for the detection of nucleic acids. In some aspects, the present invention relates to methods for detecting nucleic acids using flow strips as defined herein, such as (lateral)flow assays or (lateral)flow immunochromatographic assays. In some aspects, the molecules in the single-stranded nucleic acid detector may be interchanged or their positions altered, provided that their reporting principle is the same as or similar to that of the present invention, and any modifications thereof are also included in the present invention.

[0200] The detection method described in this invention can be used for the quantitative detection of target nucleic acids. The quantitative detection index can be determined based on the signal strength of the reporter group, such as the luminescence intensity of the fluorescent group or the width of the colored band.

[0201] wild type

[0202] As used herein, the term “wildtype” has the meaning commonly understood by those skilled in the art as referring to the typical form of an organism, strain, or gene, or the characteristic that distinguishes it from mutant or variant forms when it exists in nature, is separable from its natural source and has not been intentionally modified by humans.

[0203] Derivatization

[0204] As used herein, the term "derivation" refers to the chemical modification of an amino acid, polypeptide, or protein in which one or more substituents are covalently linked to the amino acid, polypeptide, or protein. Substituents may also be referred to as side chains.

[0205] A derivatized protein is a derivative of the original protein. Generally, the derivatization of a protein does not adversely affect its desired activity (e.g., activity to bind to guide RNA, endonuclease activity, activity to bind to and cleave a target sequence at a specific site under the guidance of guide RNA). In other words, the derivative of a protein has the same activity as the original protein.

[0206] Derivatized proteins

[0207] Also known as "protein derivatives," these are modified forms of proteins, where one or more amino acids of the protein may be deleted, inserted, modified, and / or substituted.

[0208] Not naturally occurring

[0209] As used herein, the terms “non-naturally occurring” or “engineered” are used interchangeably and indicate artificial involvement. When these terms are used to describe nucleic acid molecules or peptides, they indicate that the nucleic acid molecule or peptide is at least substantially free from at least one other component bound to it, either naturally occurring or found in nature.

[0210] Orthologue (ortholog)

[0211] As used herein, the term "orthologue" has the meaning commonly understood by those skilled in the art. As further guidance, an "orthologue" of a protein, as described herein, refers to a protein belonging to a different species that performs the same or similar function as the protein that is its orthologue.

[0212] identity

[0213] As used herein, the term "identity" refers to the sequence matching between two polypeptides or two nucleic acids. Two compared sequences are identical at a position when the same base or amino acid monomeric subunit occupies the same location (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine). The "percentage identity" between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared × 100. For example, if six out of ten positions in two sequences match, then the two sequences have 60% identity. For example, the DNA sequences CTGACT and CAGGTT share 50% identity (three out of six positions match). Typically, two sequences are compared to produce the maximum identity. Such comparisons can be made using methods readily available, for example, computer programs such as the Align program (DNAstar, Inc.) Needleman et al. (1970) J. Mol. Biol. 48: 443-453. The percentage identity between two amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (Comput. Appl Biosci., 4:11-17 (1988)) integrated into the ALIGN program (version 2.0), which uses a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. Alternatively, the percentage identity between two amino acid sequences can be determined using the Needleman and Wunsch algorithm (J MoIBiol. 48:444-453 (1970)) in the GAP program integrated into the GCG software package (available at www.gcg.com), which uses a Blossum 62 matrix or a PAM250 matrix, along with gap weights of 16, 14, 12, 10, 8, 6, or 4, and length weights of 1, 2, 3, 4, 5, or 6.

[0214] carrier

[0215] The term "vector" refers to a nucleic acid molecule capable of delivering another nucleic acid molecule linked to it. Vectors include, but are not limited to, single-stranded, double-stranded, or partially double-stranded nucleic acid molecules; nucleic acid molecules including one or more free ends, or without free ends (e.g., circular); nucleic acid molecules including DNA, RNA, or both; and a wide variety of other polynucleotides known in the art. A vector can be introduced into a host cell through transformation, transduction, or transfection, thereby enabling the expression of its carried genetic material elements in the host cell. A vector can be introduced into a host cell to produce transcripts, proteins, or peptides, including proteins, fusion proteins, isolated nucleic acid molecules, etc., as described herein (e.g., CRISPR transcripts, such as nucleic acid transcripts, proteins, or enzymes). A vector may contain a variety of elements controlling expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, the vector may contain a replication initiation site.

[0216] One type of vector is a "plasmid," which is a circular double-stranded DNA loop into which another DNA fragment can be inserted, for example, using standard molecular cloning techniques.

[0217] Another type of vector is the viral vector, in which a virus-derived DNA or RNA sequence is present in a vector used to package the virus (e.g., retroviruses, replication-defective retroviruses, adenoviruses, replication-defective adenoviruses, and adeno-associated viruses). Viral vectors also contain polynucleotides carried by the virus used for transfection into a host cell. Some vectors (e.g., bacterial vectors with bacterial origins of replication and episodic mammalian vectors) are capable of autonomous replication in the host cells into which they are introduced.

[0218] Other vectors (e.g., non-attachment mammalian vectors) integrate into the host cell's genome upon introduction and thereby replicate along with the host genome. Furthermore, some vectors are capable of directing the expression of genes they are operatively linked to. Such vectors are referred to herein as "expression vectors."

[0219] host cells

[0220] As used herein, the term “host cell” refers to a cell that can be used to introduce a vector, including but not limited to prokaryotic cells such as Escherichia coli or Bacillus subtilis, and eukaryotic cells such as microbial cells, fungal cells, animal cells, and plant cells.

[0221] Those skilled in the art will understand that the design of expression vectors can depend on factors such as the selection of host cells to be transformed and the desired expression level.

[0222] Control element

[0223] As used herein, the term "regulatory element" is intended to include promoters, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals such as polyadenylation signals and poly-U sequences), for which detailed description can be found in Goeddel, *Gene Expression Technology: Methods in Enzymology*, 185, Academic Press, San Diego, California (1990). In some cases, regulatory elements include those sequences that direct constitutive expression of a nucleotide sequence in many types of host cells and those sequences that direct expression of that nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). Tissue-specific promoters can primarily direct expression in the desired tissue of interest, such as muscle, neurons, bone, skin, blood, specific organs (e.g., liver, pancreas), or specific cell types (e.g., lymphocytes). In some cases, regulatory elements can also be directed to express in a time-dependent manner (such as in a cell cycle-dependent or developmental stage-dependent manner), which may or may not be tissue or cell type specific. In some cases, the term "regulatory element" covers enhancer elements such as WPRE; CMV enhancer; R-U5' fragment in the LTR of HTLV-I (Mol. Cell. Biol., Vol. 8(1), pp. 466-472, 1988); SV40 enhancer; and intron sequence between exons 2 and 3 of rabbit β-globin (Proc. Natl. Acad. Sci. USA., Vol. 78(3), pp. 1527-31, 1981).

[0224] promoter

[0225] As used herein, the term "promoter" has the meaning known to those skilled in the art, referring to a non-coding nucleotide sequence located upstream of a gene that initiates the expression of a downstream gene. A constitutive promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell under most or all physiological conditions of the cell. An inducible promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell substantially only when an inducer corresponding to the promoter is present in the cell. A tissue-specific promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell substantially only when the cell is a cell of the tissue type corresponding to that promoter.

[0226] NLS

[0227] A “nuclear localization signal” or “nuclear localization sequence” (NLS) is an amino acid sequence that “tags” a protein to allow it to be transported to the nucleus via nuclear transport; that is, a protein with an NLS is transported to the nucleus. Typically, an NLS contains positively charged Lys or Arg residues exposed on the protein surface. Exemplary nuclear localization sequences include, but are not limited to, NLS from the following: SV40 large T antigen, EGL-13, c-Myc, and TUS protein. In some embodiments, the NLS contains the PKKKRKV sequence. In some embodiments, the NLS contains the AVKRPAATKKAGQAKKKKLD sequence. In some embodiments, the NLS contains the PAAKRVKLD sequence. In some embodiments, the NLS contains the MSRRRKANPTKLSENAKKLAKEVEN sequence. In some embodiments, the NLS contains the KLKIKRPVK sequence. Other nuclear localization sequences include, but are not limited to, the acidic M9 domain of hnRNP A1, the KIPIK sequence in the yeast transcriptional repressor Matα2, and PY-NLS.

[0228] Operable connection

[0229] As used herein, the term “operably linked” is intended to mean that the nucleotide sequence of interest is linked to one or more regulatory elements in a manner that allows the expression of that nucleotide sequence (e.g., in an in vitro transcription / translation system or in the host cell when the vector is introduced into the host cell).

[0230] Complementarity

[0231] As used herein, the term "complementarity" refers to the ability of a nucleic acid to form one or more hydrogen bonds with another nucleic acid sequence via conventional Watson-Crick or other non-conventional types. The percentage of complementarity indicates the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 are 50%, 60%, 70%, 80%, 90%, and 100% complementary). "Complete complementarity" means that all consecutive residues in a nucleic acid sequence form hydrogen bonds with the same number of consecutive residues in a second nucleic acid sequence. As used herein, “substantially complementary” refers to a complementarity of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% in a region having 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more nucleotides, or to two nucleic acids hybridizing under stringent conditions.

[0232] Strict conditions

[0233] As used herein, “strict conditions” for hybridization refer to conditions under which a nucleic acid complementary to the target sequence hybridizes primarily with the target sequence and substantially does not hybridize to non-target sequences. Strict conditions are typically sequence-dependent and vary depending on many factors. Generally, the longer the sequence, the higher the temperature at which it specifically hybridizes to its target sequence.

[0234] Hybridization

[0235] The terms “hybridization” or “complementary” or “substantially complementary” refer to nucleic acids (such as RNA, DNA) containing nucleotide sequences that enable them to bind non-covalently, that is, to form base pairs and / or G / U base pairs with another nucleic acid in a sequence-specific, antiparallel manner (i.e., nucleic acid-specific binding of complementary nucleic acids), also known as “annealing” or “hybridization”.

[0236] Hybridization requires two nucleic acids to contain complementary sequences, although mismatches between bases may exist. Suitable conditions for hybridization between two nucleic acids depend on their length and degree of complementarity, which are well-known variables in the art. Typically, hybridizable nucleic acids are 8 nucleotides or longer (e.g., 10 nucleotides or longer, 12 nucleotides or longer, 15 nucleotides or longer, 20 nucleotides or longer, 22 nucleotides or longer, 25 nucleotides or longer, or 30 nucleotides or longer).

[0237] It should be understood that the sequence of a polynucleotide does not need to be 100% complementary to the sequence of its target nucleic acid for specific hybridization. The polynucleotide may contain 60% or higher, 65% or higher, 70% or higher, 75% or higher, 80% or higher, 85% or higher, 90% or higher, 95% or higher, 98% or higher, 99% or higher, 99.5% or higher, or have 100% sequence complementarity with the target region of the target nucleic acid sequence it hybridizes with.

[0238] Hybridization of the target sequence with gRNA means that at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleic acid sequences of the target sequence and gRNA can hybridize to form a complex; or it means that at least 12, 15, 16, 17, 18, 19, 20, 21, 22, or more bases of the nucleic acid sequences of the target sequence and gRNA can be complementary and hybridize to form a complex.

[0239] Express

[0240] As used herein, the term "expression" refers to the process by which a DNA template is transcribed into polynucleotides (such as mRNA or other RNA transcripts) and / or the transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides can be collectively referred to as "gene products." If the polynucleotides are derived from genomic DNA, expression can include the splicing of mRNA in eukaryotic cells.

[0241] connector

[0242] As used herein, the term "linker" refers to a linear polypeptide formed by the linkage of multiple amino acid residues via peptide bonds. The linkers of this invention can be synthetically produced amino acid sequences or naturally occurring polypeptide sequences, such as polypeptides with hinge region functions. Such linker polypeptides are well known in the art (see, for example, Holliger, P. et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak, RJ et al. (1994) Structure 2:1121-1123).

[0243] treat

[0244] As used in this article, the term "treatment" means to treat or cure a disease, to delay the onset of symptoms of a disease, and / or to slow the progression of a disease.

[0245] Subjects

[0246] As used herein, the term “subject” includes, but is not limited to, various animals, plants and microorganisms.

[0247] animal

[0248] For example, mammals, such as bovids, equines, sheep, suidae, canids, felines, lagos, rodents (e.g., mice or rats), non-human primates (e.g., macaques or cynomolgus monkeys), or humans. In some embodiments, the subject (e.g., a human) suffers from a condition (e.g., a condition caused by a disease-related gene defect).

[0249] plant

[0250] The term "plant" should be understood as any differentiated multicellular organism capable of photosynthesis, including crop plants at any stage of maturity or development, particularly monocotyledonous or dicotyledonous plants, vegetable crops including artichokes, kohlrabi, arugula, leeks, asparagus, lettuce (e.g., head lettuce, leaf lettuce, longleaf lettuce), bok choy, taro, cucurbits (e.g., melons, watermelons, crenshaw, cantaloupes, Roman melons), rapeseed crops (e.g., Brussels sprouts, cabbage, cauliflower, broccoli, kale, headless cabbage, Chinese cabbage, baby bok choy), artichokes, carrots, napa cabbage, okra, onions, celery, parsley, chickpeas, parsnip, chicory, peppers, potatoes, gourds (e.g., zucchini, cucumbers, baby zucchini, squash, pumpkin), radishes, and dried heads. Onions, rutabagas, purple eggplant (also known as eggplant), ginseng, lettuce, scallions, chicory, garlic, spinach, green onions, squash, leafy greens, beets (sugar beets and fodder beets), sweet potatoes, romaine lettuce, wasabi, tomatoes, turnips, and spices; fruits and / or vine crops such as apples, apricots, cherries, nectarines, peaches, pears, plums, prunes, cherries, quince, almonds, chestnuts, hazelnuts, pecans, pistachios, walnuts, citrus fruits, blueberries, boysenberries. Raspberries, cranberries, currants, raspberries, strawberries, blackberries, grapes, avocados, bananas, kiwis, persimmons, pomegranates, pineapples, tropical fruits, pears, melons, mangoes, papayas, and lychees; field crops such as clover, alfalfa, evening primrose, silvergrass, corn / maize (feed corn, sweet corn, popcorn), hops, jojoba, peanuts, rice, safflower, small grain cereals (barley, oats, rye, wheat, etc.), sorghum, tobacco, kapok, legumes (beans, lentils, peas) Beans, soybeans), oil plants (rapeseed, mustard, olive, sunflower, coconut, castor oil plants, cocoa beans, peanuts), Arabidopsis, fiber plants (cotton, flax, jute), Lauraceae (cinnamon, camphor), or a plant such as coffee, sugarcane, tea, and natural rubber plants; and / or bedding plants, such as flowering plants, cacti, succulents and / or ornamental plants, and trees such as forests (broadleaf trees and evergreen trees, such as conifers), fruit trees, ornamental trees, and nut-bearing trees, as well as shrubs and other seedlings.

[0251] Beneficial effects of the invention

[0252] This invention enhances the activity of the Cas12i3 protein through mutation, and has broad application prospects.

[0253] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings and examples. However, those skilled in the art will understand that the following drawings and examples are for illustrative purposes only and are not intended to limit the scope of the invention. Various objects and advantages of the present invention will become apparent to those skilled in the art from the following detailed description of the drawings and preferred embodiments. Attached Figure Description

[0254] Figure 1 Validation of the editing efficiency of Cas protein with different unit site amino acid mutations.

[0255] Figure 2 Validation of the editing efficiency of Cas protein by combining different amino acid sites.

[0256] Figure 3 Sequencing results of the target gene after editing the mutant protein.

[0257] Figure 4 Verification of the editing efficiency of the E328R-N369R-S433R-K942R-N945R mutant protein at different target sites.

[0258] Figure 5 Validation of editing efficiency of mutant Cas12i (N369R and S433R) in rice. Detailed Implementation

[0259] The following examples are for illustrative purposes only and are not intended to limit the invention. Unless otherwise specified, the experiments and methods described in the examples are generally performed according to conventional methods well known in the art and described in various references. For example, conventional techniques such as immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant DNA used in this invention can be found in Sambrook, Fritsch, and Maniatis, *Molecular Cloning: A Laboratory Manual*, 2nd edition (1989); *Current Protocols in Molecular Biology* (edited by FM. Ausubel et al., (1987)); and the *Methods in Enzymology* series (academic publishing company): *PCR 2: A PRACTICAL*. APPROACH (edited by MJ MacPherson, BD Hames and GR Taylor (1995)), Harlow and Lane (1988) Antibodies, A Laboratory Manual, and Animal Cell Culture (edited by R.R. Freshney (1987)).

[0260] Furthermore, unless specific conditions are specified in the examples, conventional conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products. Those skilled in the art will understand that the examples are described by way of illustration and are not intended to limit the scope of protection claimed by the invention. All disclosures and other references mentioned herein are incorporated herein by reference in their entirety.

[0261] Example 1. Obtaining the Cas mutant protein

[0262] For the known Cas protein (Cas12f.4 in CN111757889B, referred to as Cas12i3 in this embodiment), the applicant used bioinformatics to predict key amino acid sites that may affect its biological function, and mutated these amino acid sites to obtain a Cas mutant protein with enhanced editing activity. Specifically, the Cas12i3 coding sequence was codon-optimized and synthesized. The amino acid sequence of wild-type Cas12i3 is shown in SEQ ID No. 1, and its nucleic acid sequence is shown in SEQ ID No. 2. Site-directed mutations were performed on the amino acids that could potentially bind to the target sequence in Cas12i3 using bioinformatics methods.

[0263] Variants of the Cas protein were generated through site-directed mutagenesis based on PCR. Specifically, the Cas12i3 protein DNA sequence was divided into two parts centered on the mutation site. Two pairs of primers were designed to amplify these two DNA sequences respectively, with the desired mutation sequence introduced onto the primers. Finally, the two fragments were loaded into the pcDNA3.3-eGFP vector using Gibson cloning. The combination of mutants was achieved by splitting the Cas12i3 protein DNA into multiple segments and constructing them using PCR and Gibson cloning. Fragment amplification kit: TransStart FastPfu DNA Polymerase (containing 2.5 mM dNTPs), detailed experimental procedures are available in the instruction manual. Gel extraction kit: FastPureGel DNA Extraction MiniKit, detailed experimental procedures are available in the instruction manual. Vector construction kit: pEASY-Basic Seamless Cloning and Assembly Kit (CU201-03), detailed experimental procedures are available in the instruction manual. The involved mutated amino acid sites and the primer sequences used are shown in the table below:

[0264]

[0265]

[0266] Based on the above amino acid mutation sites, wild-type protein (WT) of Cas12i3 and proteins with mutations at a single amino acid site (named by mutation type) were obtained: K181R, K322R, E328R, L333R, G366R, N369R, F398R, Q432R, S433R, G455R, F583R, N941R, K942R, N945R or D964R.

[0267] Example 2. Validation of the editing activity of the Cas mutant protein

[0268] The gene-editing activity of different Cas proteins obtained in Example 1 was verified in animal cells. A target was designed for the FUT8 gene in Chinese hamster ovary cells (CHO), FUT8-Cas-XX-g3:TTC. CAGCCAAGGTTGTGGACGGATCA The italicized portion represents the PAM sequence, and the underlined area represents the target region. The vector pcDNA3.3 was modified to carry EGFP fluorescent protein and the PuroR resistance gene. The SV40 NLS-Cas-XX fusion protein was inserted via the XbaI and PstI restriction sites; the U6 promoter and gRNA sequence were inserted via the Mfe1 restriction site. The CMV promoter initiates the expression of the SV40NLS-Cas-XX-NLS-GFP fusion protein. The Cas-XX-NLS and GFP proteins are linked using the T2A linker peptide. The EF-1α promoter initiates the expression of the puromycin resistance gene. Plating: CHO cells were plated when confluence reached 70-80%, with a seeding density of 8*10^4 cells / well in 12-well plates. Transfection: Transfection was performed 24 hours after plating, adding 6.25 μl of HieffTrans to 100 μl opti-MEM. TM Mix the liposome nucleic acid transfection reagent thoroughly; add 2.5 μg of plasmid to 100 μl of opti-MEM and mix well. The diluted Hieff Transfection reagent... TM The liposome nucleic acid transfection reagent was mixed thoroughly with the diluted plasmid and incubated at room temperature for 20 min. The incubated mixture was then added to cell-coated culture medium for transfection. Puromycin was added for selection: 24 h after transfection, puromycin was added at a final concentration of 10 μg / ml. After 24 h of puromycin treatment, the medium was replaced with normal medium and cultured for another 24 h.

[0269] DNA extraction, PCR amplification of the area near the editing region, and hiTOM sequencing: Cells were collected after trypsin digestion, and genomic DNA was extracted using a cell / tissue genomic DNA extraction kit (Biotech). Genomic DNA was amplified in the region near the target site. PCR products were then sequenced using hiTOM. Sequencing data analysis was performed, identifying the types and proportions of sequences within a 15nt upstream and 10nt downstream of the target site. Sequences with a SNV frequency greater than or equal to 1% or a non-SNV mutation frequency greater than or equal to 0.06% were identified to determine the editing efficiency of the Cas-XX protein at the target site. CHO cell FUT8 gene target sequence: FUT8-Cas-XX-g3: TTC CAGCCAAGGTTGTGGACGGATCA The italicized portion is the PAM sequence, and the underlined area is the target region. The gRNA sequence is: AGAGAAUGUGUGCAUAGUCAaCAC CAGCCAAGGUUGUGGACGGAUCA The underlined area is the target region, and the other areas are DR (directed repeat sequence) regions.

[0270] Figure 1The editing activity of the wild-type Cas12i3 protein (WT) and mutant proteins with a single amino acid site mutation is shown. Figure 1 As shown, compared with WT, mutations at the K322R / L333R / G366R / G455R / F583R sites lead to reduced editing efficiency or even the inability to exhibit editing activity; the editing efficiency of the protein after the K181R mutation is comparable to that of the wild type; mutations at other sites, such as E328R, N369R, F398R, Q432R, S433R, N941R, K942R, N945R, or D964R sites, can improve the editing efficiency of the protein to some extent; this indicates that amino acid sites at positions 328, 369, 398, 432, 433, 941, 942, 945, or 964 are key sites for Cas12i3 to exert its activity.

[0271] Example 3. Validation of the editing activity of multi-site combined mutant Cas protein

[0272] In this embodiment, combined mutations were performed on the sites verified in Example 2 that could improve the editing efficiency of the Cas protein, resulting in proteins with the following multiple amino acid site mutations: E328R-N369R, E328R-S433R, E328R-K942R, E328R-N945R, N369R-S433R, N369R-K942R, N369R-N945R, S433R-N945R, E328R-N369R-S433R, and E328R-N369R-S433R-K942R-N945R. Their editing efficiency was verified using the same method as in Example 2.

[0273] like Figure 2 As shown, the results indicate that the Cas proteins with different site combinations of mutations exhibit significantly improved editing efficiency compared to wild-type Cas proteins. The types of gene editing targeting include base deletion, base insertion, and base substitution. Taking the E328R-N369R-S433R-K942R-N945R protein as an example, some of its edited genotypes are shown below. Figure 3 .

[0274] The editing activity of the E328R-N369R-S433R-K942R-N945R mutant protein was validated at a wider range of gene targets, including the following four:

[0275] Target 1: FUT8-Cas-XX-g1: TTGACAAACTGGGATACCCACCACAC

[0276] Target 2: FUT8-Cas-XX-g6:TTGAAGCCAAGCTTCTTGGTGGTTTC

[0277] Target 3: FUT8-Cas-XX-g11: TTGCCTCTTTAACAAAGAAGGGTCA

[0278] Target 4: FUT8-Cas-XX-g13: TTGTTAAAGGAGGCAAAGACAAAGTA

[0279] The same method was used to verify the editing efficiency, and the results are as follows: Figure 4 As shown, among the several targets tested, the aforementioned E328R-N369R-S433R-K942R-N945R mutant protein ( Figure 4 i3 five-pronged approach) and wild type ( Figure 4 Compared to i3WT, both can significantly improve editing efficiency.

[0280] Example 4. Validation of the editing activity of the Cas mutant protein in plant cells

[0281] In this embodiment, conventional techniques and procedures in the art were used to verify the gene editing efficiency of the aforementioned Cas mutant protein in rice. The gene editing efficiency was verified in rice using a Cas protein with simultaneous mutations in N369R and S433R. The results are as follows... Figure 5 As shown, Figure 5 WT in the figure represents the editing efficiency of the wild-type Cas12i3. Figure 5In the table, "Mutant" represents the editing efficiency of the aforementioned mutant Cas proteins (both N369R and S433R are simultaneously mutated); for target 1, no editing events were generated in the wild-type Cas12i protein, and the editing efficiency of the mutant Cas12i (N369R and S433R) was 16.67%; for target 2, no editing events were generated in the wild-type Cas12i protein, and the editing efficiency of the mutant Cas12i (N369R and S433R) was 11.11%; for target 3, the editing efficiency of the wild-type Cas12i protein was 69.44%, and the editing efficiency of the mutant Cas12i (N369R and S433R) was 86.11%; for target 5, the editing efficiency of the wild-type Cas12i protein was 19.44%, and the editing efficiency of the mutant Cas12i (N369R and S433R) was 69.44%. The overall editing efficiency of wild-type Cas12i protein on the four targets was 69.44%, while that of mutant Cas12i (N369R and S433R) was 91.67%. Compared with wild-type Cas12i protein, the mutant Cas12i (N369R and S433R) significantly improved the editing efficiency in rice, especially at some targets where wild-type Cas12i protein had no editing activity; the mutant Cas12i (N369R and S433R) still exhibited editing activity and generated editing events.

[0282] The above results show that the Cas mutant protein with enhanced editing activity obtained in this application can also improve the editing efficiency of Cas12i3 in plant cells.

[0283] Although specific embodiments of the invention have been described in detail, those skilled in the art will understand that various modifications and variations can be made to the details based on all the published teachings, and all such changes are within the scope of protection of the invention. The entire scope of the invention is given by the appended claims and any equivalents thereof.

Claims

1. A fusion protein comprising a Cas mutant protein and other modified portions, wherein the modified portions are nuclear localization signal sequences; The mutant Cas protein, compared to the parental Cas protein, has a mutation at any of the following amino acid sites corresponding to the amino acid sequence shown in SEQ ID No. 1: positions 369, 433, 328, 398, 432, 941, 942, 945, or 964; all amino acid sites 369, 433, 328, 398, 432, 941, 942, 945, or 964 are mutated to R; the parental Cas protein originates from the Cas12i family of proteins, and the amino acid sequence of the parental Cas protein is shown in SEQ ID No.

1.

2. The fusion protein according to claim 1, characterized in that, The nuclear localization signal sequence is located at both ends of the Cas mutant protein.

3. An isolated polynucleotide, characterized in that, The polynucleotide encodes the fusion protein according to any one of claims 1-2.

4. A carrier, characterized in that, The vector comprises the polynucleotide of claim 3 and a regulatory element operatively linked thereto.

5. An engineered host cell, wherein the cell is a non-animal or non-plant cell, characterized in that, The host cell comprises the fusion protein of any one of claims 1-2, or the polynucleotide of claim 3, or the vector of claim 4.

6. The application of the fusion protein according to any one of claims 1-2, or the polynucleotide according to claim 3, or the vector according to claim 4, or the host cell according to claim 5 in gene editing, gene targeting, or gene cutting, wherein the application is for purposes other than disease diagnosis and treatment; Alternatively, its use in the preparation of reagents or kits for gene editing, gene targeting, or gene cutting.

7. The use of the fusion protein of any one of claims 1-2, or the polynucleotide of claim 3, or the vector of claim 4, or the host cell of claim 5, in any one or more of the following applications, wherein the application is for purposes other than disease diagnosis and treatment: Cutting double-stranded DNA, single-stranded DNA, or single-stranded RNA; non-specific cutting and / or degradation of side-branched nucleic acids; non-specific cutting of single-stranded nucleic acids; nucleic acid detection; specific editing of double-stranded nucleic acids; base editing of double-stranded nucleic acids; base editing of single-stranded nucleic acids.

8. A method for editing, targeting, or cleaving a target nucleic acid, the method being a method for non-disease diagnosis and treatment purposes, the method comprising contacting the target nucleic acid with a fusion protein according to any one of claims 1-2, or a polynucleotide according to claim 3, or a vector according to claim 4, or a host cell according to claim 5.

9. A kit for gene editing, gene targeting, or gene cutting, the kit comprising the fusion protein of any one of claims 1-2, or the polynucleotide of claim 3, or the vector of claim 4, or the host cell of claim 5.

10. Use of the fusion protein of any one of claims 1-2, or the polynucleotide of claim 3, or the vector of claim 4, or the host cell of claim 5 in the preparation of a formulation or kit for editing a target sequence in a target locus to modify the treatment of an organism or disease.

Images