High-depth targeted sequencing to detect MAP2K1 gene mutations in Langerhans histiocytosis

Abstract

The present application belongs to the field of gene detection technology, and specifically relates to a method and application for detecting MAP2K1 gene mutation in Langerhans histiocytosis based on high-depth targeted sequencing. Compared with previous methods, the present application has at least the advantages of deep sequencing depth, good specificity, high sensitivity and accuracy, and can be better used to assess disease progression and recurrence risk, thereby assisting treatment decisions.

Description

Technical Field

[0001] The present application belongs to the field of gene detection technology, and specifically relates to a method, product and application for detecting MAP2K1 gene mutation in Langerhans' histiocytosis based on high-depth targeted sequencing. Background Art

[0002] Langerhans histiocytosis (LCH) is one of the first batch of rare diseases jointly released by the National Health Commission and other five departments. It is a representative disease of difficult and rare diseases in the pediatric blood system. It is characterized by abnormal proliferation and aggregation of CD1a and / or CD207 positive Langerhans cells, infiltration of a large number of inflammatory cells, and tissue damage. Compared with adults, it occurs more in young children. The clinical manifestations of LCH are varied. In mild cases, it manifests as a self-limited single lesion, such as simple bone or skin damage. In severe cases, multiple organs or systems of the body are involved, such as lymph nodes, lungs, pituitary glands, ears, eyes, thymus, etc. Children with liver, spleen or bone marrow involvement have a higher risk of death. The disease is very easy to misdiagnose and misdiagnose, and it is easy to relapse during treatment. Although the overall survival rate has greatly improved in the past few decades, chemotherapy has not been able to cure more than 50% of high-risk patients, and they are prone to lifelong sequelae such as diabetes insipidus, cirrhosis, neurodegenerative lesions, and bone deformities.

[0003] At present, LCH is considered to be a tumor of myeloid origin and has the characteristics of inflammation, and its pathogenesis is still unclear. Studies have found that most children with LCH have activation of the mitogen-activated protein kinase (MAPK) signaling pathway and mutations in related genes, mainly including BRAF and MAP2K1 gene mutations (Badalian-Very et al., Blood 2010, 116 (11): 1919-1923. Chakraborty et al., Blood 2014, 124 (19): 3007-3015.). The MAP2K1 (Mitogen-Activated Protein Kinase Kinase 1) gene is located in the human chromosome 15q22.31 region and belongs to the dual-specific protein kinase family. As an important component of the MAPK signal transduction pathway, it can activate the extracellular signal-regulated kinase (ERK) and regulate various cellular processes such as cell proliferation, differentiation, and transcription. In LCH lesions, MAP2K1 mutations and BRAF mutations are usually mutually exclusive. MAP2K1 gene mutations are found in the lesion tissues of approximately 8.6% to 40% of LCH patients, which can activate ERK phosphorylation and is an important driver mutation for LCH pathogenicity (Jouenne et al., Curr Opin Oncol 2021, 33(2):101-109.).

[0004] Dynamic monitoring of tumor-specific gene mutations in patients during diagnosis and treatment can accurately assess the patient's response to treatment and the risk of progression / recurrence, which has important guiding value for judging the patient's prognosis, implementing individualized precision treatment, and improving the efficacy. After treatment, the number of tumor cells in the body decreases, and the frequency of tumor-specific gene mutations is significantly reduced. Therefore, high-sensitivity and high-precision quantitative detection methods are required to detect gene mutations during the diagnosis and treatment process and follow-up. In recent years, studies have used digital PCR methods to detect MAP2K1 gene mutations such as MAP2K1Q58_E62del, F53_Q58del, and E102_I103del in the genomic gDNA of peripheral blood mononuclear cells of LCH patients (Milne et al., Blood Adv 2022, 6(16):4901-4904.). The biggest limitation of the digital PCR method is that it is only applicable to the quantitative analysis of known single mutation sites, while the mutation sites and types of the MAP2K1 gene in LCH are very diverse, which requires the customization of specific primers and probes for each mutation, greatly increasing the detection cost; and the technical requirements for primer and probe design are also high. Some mutation sites may not be suitable for digital PCR analysis and cannot meet the detection sensitivity requirements.

[0005] There are also studies that use sequencing methods to detect MAP2K1 mutations in patients. For example, Tóth et al. used PCR and Sanger sequencing methods to detect MAP2K1 gene mutations in genomic gDNA of LCH lesion tissue (Tóth et al., Virchows Arch 2020, 477(5):749-753.). This first-generation sequencing method has low sensitivity and low throughput, and is not suitable for detecting low-frequency gene mutations in patients during diagnosis and treatment. Durham et al. used whole exome sequencing to detect MAP2K1 and other mutations in LCH (Durham et al., Nat Med 2019, 25(12):1839-1842.); Zhao et al. used gene combination targeted sequencing technology based on hybrid capture (including 183 blood tumor-related genes) to detect MAP2K1 E102_I103del gene mutations in gDNA and cfDNA of LCH patients at the time of diagnosis (Zhao et al., Leukemia 2022, 36(5):1412-1415.). However, the experimental operation process and analysis flow of the full-exome or gene combination targeted capture sequencing method are complicated, the detection cost is high, and the specificity is not high.

[0006] Amplicon-based targeted sequencing is a technology that designs specific PCR primers for the target region of interest to amplify and enrich the target sequence and perform high-throughput sequencing. Compared with the hybridization capture sequencing method, it has higher sequencing depth, better specificity, lower sample input, shorter operation time, simple operation, and lower sequencing cost. It is more suitable for detecting low-frequency mutations and can detect multiple gene variations in the target region at one time. However, this method intends to achieve high-depth sequencing and accurate detection, and has extremely high requirements for targeted primers. In practice, both the selection of the targeted segment and the design of the targeted primer will affect the accuracy and sensitivity of the detection results. At present, there are no reports on the use of amplicon targeted capture sequencing in LCH to detect MAP2K1 mutations in LCH, especially the detection of MAP2K1 mutations for LCH prognosis. Summary of the invention

[0007] To solve the above problems, this application uses high-depth targeted capture sequencing for the first time to monitor MAP2K1 gene mutations in the diagnosis and treatment of patients with Langerhans' histiocytosis, which can better judge the patient's treatment response, accurately assess the progression and recurrence risk, thereby assisting treatment decisions and improving patient prognosis.

[0008] Specifically, this application is implemented through the following technical solutions:

[0009] The present application first provides an amplicon targeting region that can be used for prognosis monitoring of Langerhans' histiocytosis, and the region is located in the MAP2K1 gene.

[0010] Furthermore, the primers target exon 2 and exon 3 of the MAP2K1 gene.

[0011] Furthermore, the primers target the second exon region chr15:66727423-66727492 and the third exon region chr15:66729066-66729124 of the MAP2K1 gene.

[0012] The present application also provides an amplicon-targeted sequencing primer set that can be used for prognosis monitoring of Langerhans' histiocytosis, wherein the primers are targeted to the MAP2K1 gene.

[0013] Furthermore, the primers target exon 2 and exon 3 of the MAP2K1 gene.

[0014] Furthermore, the primers target the second exon region chr15:66727423-66727492 and the third exon region chr15:66729066-66729124 of the MAP2K1 gene.

[0015] Furthermore, the mutations targeted by the primers include the following:

[0016]

[0017] In some embodiments, the primer sequence is as follows:

[0018] Primer pair 1:

[0019] F:CCCTACACGACGCTCTTCCGATCTCGAAAGCGCCTTGAGG (SEQ ID NO. 1);

[0020] R:GTTCAGACGTGTGCTCTTCCGATCTTCTCAAAGTCGTCATCCTTCAG (SEQ ID NO. 2);

[0021] Primer pair 2:

[0022] F:CCCTACACGACGCTCTTCCGATCTTCTTCCACCTTTCTCCAGCT (SEQ ID NO.3);

[0023] R: GTTCAGACGTGTGCTCTTCCGATCTATCTGGGTTCCGGATTGCGG (SEQ ID NO. 4).

[0024] The present application also provides an amplicon targeted sequencing kit for monitoring the prognosis of Langerhans' histiocytosis, characterized in that it comprises the primer set described above;

[0025] Preferably, the kit also includes conventional amplification components and sequencing components.

[0026] The present application also provides the use of the aforementioned amplicon targeted sequencing primer set in the prognosis monitoring of Langerhans' histiocytosis;

[0027] The present application also provides the use of the aforementioned amplicon targeted sequencing primer set in the preparation of a Langerhans' histiocytosis prognosis monitoring kit.

[0028] Furthermore, the detection is achieved by performing targeted amplification using the aforementioned primer set, followed by high-depth sequencing.

[0029] Furthermore, the sequencing depth can reach more than 100,000×.

[0030] The present application also provides a method for monitoring the prognosis of Langerhans' histiocytosis, comprising obtaining a cfDNA sample, performing targeted enrichment of amplicons using the primer set described above, amplifying the sample through two rounds of PCR and then sequencing the sample on a machine, and performing bioinformatics analysis on the sequencing data after the sample is downloaded from the machine.

[0031] Compared with the prior art, this application has at least the following advantages:

[0032] This application establishes a high-depth targeted sequencing technology based on amplicon targeted sequencing for the MAP2K1 gene, covering the mutation hotspot target regions of the 2nd and 3rd exons of the MAP2K1 gene. The optimized and designed specific primers can efficiently and specifically amplify the targeted regions, and the mutation information of the hotspot sites can be obtained through high-throughput sequencing and bioinformatics analysis. The sequencing depth of this application can reach more than 100,000×, and the sample input is extremely low, the operation time is short and the operation is simple. It can detect multiple gene variations such as insertions, deletions, and single nucleotide variations at one time, and has the advantages of sensitivity, rapidity, efficiency and high throughput.

[0033] This application is the first to use a high-depth targeted capture sequencing method to monitor MAP2K1 gene mutations during the diagnosis and treatment of patients with Langerhans' histiocytosis, in order to better judge the patient's treatment response, accurately assess the risk of progression and recurrence, and assist in treatment decision-making, thereby improving patient prognosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] In order to more clearly illustrate the specific implementation methods of the present application or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0035] Figure 1 , the results of monitoring the frequency of MAP2K1 gene mutations in plasma cfDNA during treatment and follow-up of LCH-18 children with recurrent LCH;

[0036] Figure 2 , the results of monitoring the frequency of MAP2K1 gene mutations in plasma cfDNA during the treatment and follow-up of LCH-107 in children with recurrent LCH;

[0037] Figure 3 , the results of monitoring the frequency of MAP2K1 gene mutations in plasma cfDNA during LCH-101 treatment and follow-up in children with recurrent LCH;

[0038] Figure 4 , and the results of monitoring the frequency of MAP2K1 gene mutations in plasma cfDNA during the treatment and follow-up of pediatric patients with recurrent LCH in LCH-81. DETAILED DESCRIPTION

[0039] The technical solution of the present application will be described clearly and completely below in conjunction with the accompanying drawings. Obviously, the described embodiments are part of the embodiments of the present application, rather than all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present application.

[0040] Example 1: Screening and design of amplicon hotspot regions

[0041] 1. Hotspot area design and screening

[0042] 1. This application downloaded all MAP2K1 sequences in Genebank, including various mutant sequences, with a sequence download volume of no less than 500. Through comparison and statistics, it was found that the MAP2K1 gene mutations in LCH were mostly located in the negative regulatory functional domain encoded by exon 2 and the N-terminal catalytic core region of the kinase domain encoded by exon 3; the mutation sites and mutation types were very diverse, including in-frame del or insertion and deletion (indels) mutations, with Q58_E62del mutation being the most common, and mutations on MAP2K1 exon 2 also included F53_Q58delinsL, T55_V60delinsT, Q56_V60del, Q56_G61delinsR, K57_G61del, K57_E62del, etc., and mutations on exon 3 included E102_I103del, I99_K104del, etc.

[0043] At the same time, this application also discovered for the first time in the screening of gene mutations in the lesion tissues of children with LCH that there are mutation sites such as Q56P, L98_I103del, and H100_I103del in the MAP2K1 gene region. These mutations can also be used as molecular markers for disease prognosis detection. Due to the strong heterogeneity of LCH patients and the rarity of the disease, there may be other unreported mutation sites in these hotspots. In the selection of hotspots, this application tries to cover these known and potential mutations as comprehensively as possible.

[0044] In addition, to improve the efficiency of clinical applications, the amplicon primer pairs need to cover as long a genomic DNA region as possible. To this end, the amplicon length should be expanded as much as possible and the corresponding primer pairs should be reduced while meeting the amplification efficiency and detection sensitivity.

[0045] Based on the above considerations, the applicant finally determined chr15:66727423-66727492 in the exon 2 region and chr15:66729066-66729124 in the exon 3 region of the MAP2K1 gene on the chromosome as the amplicon targeting region. According to statistics, this region contains at least the following mutation sites.

[0046] Table 1. Mutation sites included in the identified hotspot targeting regions (including known sites and newly discovered sites)

[0047]

[0048]

[0049] 2. Amplicon Primer Design, Screening and Sequence Optimization

[0050] For the aforementioned amplicon targeting regions chr15:66727423-66727492 and chr15:66729066-66729124, the present application extended the upstream and downstream by 100 bp respectively when downloading the sequences, downloaded the sequences from the NCBI or UCSC database, and designed the primers respectively after downloading the sequences:

[0051] The preliminary primer design should at least meet the following aspects:

[0052] 1) Primer length is 18-30bp; GC content is 40-60%; primer annealing temperature is between 55-65°C, and the difference between the two primers cannot be too large; primers do not have more than 4 consecutive repeated bases; there are no more than 5 reverse complements between primers; primers are evaluated for specificity using the NCBI Blast database to ensure that the primers will not amplify other regions; primers do not form dimers; primers do not form hairpin structures.

[0053] 2) As mentioned above, in order to improve the efficiency of clinical application, the amplicon primers of the present application should cover all mutation hotspot regions of an exon as much as possible.

[0054] 3) This application selected plasma cfDNA samples from LCH patients for dynamic monitoring of LCH-specific gene mutations. The cfDNA in plasma comes from the DNA released after cell damage and rupture, which is cleaved into fragments of approximately 160 nt by nucleases. Therefore, the size of the DNA fragment amplified by the designed primers needs to be controlled within 160 bp.

[0055] Based on the above principles, this application preliminarily designed the following 5 batches of primers, see Table 2.

[0056] Table 2. Preliminary designed primer sequences

[0057]

[0058]

[0059] 3. Primer pair evaluation and adjustment:

[0060] Since the level of tumor cells in the blood circulation of LCH is low and the level is even lower after treatment, it is necessary to be able to detect mutations in plasma cfDNA with high sensitivity and deeper sequencing depth. Therefore, in the experimental design, the primers were diluted to a concentration of 10μM, and then the plasma cfDNA was PCR amplified (annealing temperature set at 60℃) and sequenced. The effective reads ratio of each set of primers to the target region was evaluated when the data volume was 200M, so as to select the best available primers.

[0061] The results of the post-amplification sequencing evaluation are shown in Table 3 below. It can be seen that primer combination 1 and combination 5 have the highest target region reads ratio, and have a significantly higher advantage than others, with primer combination 1 being 97.95% and primer combination 5 being 96.90%.

[0062] Table 3. Statistics of the percentage of reads in the primer target region

[0063]

[0064] Based on this, the applicant determined that the optimal primer sequence pair for high-depth targeted sequencing detection in this application is as follows:

[0065] Targeting the chr15:66727423-6672749 region of exon 2:

[0066] Primer pair 1 (combination 1):

[0067] F:CCCTACACGACGCTCTTCCGATCTCGAAAGCGCCTTGAGG (SEQ ID NO. 1);

[0068] R:GTTCAGACGTGTGCTCTTCCGATCTTCTCAAAGTCGTCATCCTTCAG (SEQ ID NO. 2);

[0069] Targeting the chr15:66729066-66729124 region of exon 3:

[0070] Primer pair 2 (combination 5):

[0071] F:CCCTACACGACGCTCTTCCGATCTTCTTCCACCTTTCTCCAGCT (SEQ ID NO.3);

[0072] R: GTTCAGACGTGTGCTCTTCCGATCTATCTGGGTTCCGGATTGCGG (SEQ ID NO. 4).

[0073] Example 2: Establishment of detection system

[0074] In order to meet the high sensitivity detection of low-frequency gene mutations in patients during the diagnosis and treatment process and follow-up, this application has carried out a series of optimizations on the PCR amplification conditions, specifically using a two-step PCR, and increasing the number of cycles of the second step PCR from the initial 10 cycles to 20 cycles, so that the sensitivity of sequencing reaches 0.1% and below. The specific method system is established as follows:

[0075] 1. Nucleic acid preparation

[0076] 10 mL of peripheral blood was collected and centrifuged at 3000 rpm for 10 min. The supernatant was transferred to a 1.5 mL low-adsorption centrifuge tube; the supernatant was centrifuged at 12000 rpm for 5 min to obtain plasma.

[0077] Preparation of cfDNA: 3 mL of plasma was taken and free cfDNA was extracted using a large volume free nucleic acid extraction kit (Tian Gen, DP710). cfDNA was quality checked using Qubit, and concentrations greater than 0.1 ng / μL were considered qualified.

[0078] 2. First step: PCR amplification

[0079] After synthesizing the primers determined in Example 1, dilute them to 10 μM with enzyme-free water. Add 25 μL of PCR amplification enzyme mixture, 0.5 μL of F primer, 0.5 μL of R primer, 24 μL of cfDNA or 500 ng of gDNA (total system 50 μL) to the PCR tube, pipette and mix well, and then perform PCR amplification.

[0080] PCR amplification program: 98°C for 3 min; 98°C for 30 s, 60°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min; 4°C Hold.

[0081] Purification of PCR products: Add an equal volume of DNA purification magnetic beads to the PCR product after PCR amplification, mix by pipetting, and let stand at room temperature for 5 minutes; place on a magnetic rack for 5 minutes, discard the supernatant; add 200μL 80% ethanol, let stand for 30 seconds, discard the supernatant, and repeat once; after the ethanol is sucked out, let stand at room temperature for 5-10 minutes, and dry; add 25μL enzyme-free water, mix by pipetting, and let stand for 5 minutes; place on a magnetic rack for 5 minutes, and transfer the supernatant to a new PCR tube.

[0082] 3. Second step PCR amplification

[0083] Add 25 μL of PCR amplification enzyme mixture and 5 μL of double-ended barcode primer (sequence as shown below) to the above-mentioned purified product, pipette and mix well, and then perform PCR amplification.

[0084] Barcode primer sequence:

[0085] P7:

[0086] CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC;

[0087] P5:

[0088] AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNACACTCTTTCCCTACACGAGCTCTTCCGATCT;

[0089] Among them, NNNNNNNN are 8 fixed bases.

[0090] PCR amplification program: 98°C for 3 min; 98°C for 30 s, 60°C for 30 s, 72°C for 30 s, 20 cycles; 72°C for 10 min; 4°C Hold.

[0091] Purification of PCR products: Add an equal volume of DNA purification magnetic beads to the PCR product after PCR amplification, mix by pipetting, and let stand at room temperature for 5 minutes; place on a magnetic stand for 5 minutes, discard the supernatant; add 200μL 80% ethanol, let stand for 30s, discard the supernatant, and repeat once; after the ethanol is sucked out, let stand at room temperature for 5-10 minutes, and dry; add 33μL enzyme-free water, mix by pipetting, and let stand for 5 minutes; place on a magnetic stand for 5 minutes, transfer the supernatant to a new EP tube to obtain the NGS library.

[0092] Quality inspection: The obtained library is quality inspected using qubit, and the library is qualified if the concentration is greater than 10 ng / μL.

[0093] 4. NGS high-throughput sequencing

[0094] The library obtained in step (3) was sequenced on an Illumina sequencer.

[0095] After diluting the library to 4nM, mix different libraries in equal volumes for pooling; take 2μL of library (not less than 4nM) to the bottom of the low adsorption tube, add 2μL 0.2N NaOH, mix by pipetting, close the tube lid and incubate at room temperature for 5min. Add 2ul 200mM Tris-HCl PH 8.0 to the denatured 4μL library, mix by pipetting. Then put it on ice immediately. Add 394ul pre-cooled HT1 to the denatured 6ul library, mix well and centrifuge quickly. Then take 117μL of library from 400μL diluent and mix with 1183μL pre-cooled HT1. Mix by pipetting, and then put it on ice immediately for use.

[0096] Use a clean 1mL pipette tip to pierce the foil seal of the Load Samples well and inject 1.3mL of the prepared library into the Load Samples well. Avoid touching the foil seal. After loading the sample, check if there are bubbles in the well. If there are bubbles, gently tap the reagent kit on the bench to release the bubbles. After loading, start sequencing.

[0097] 5. Bioinformatics analysis

[0098] The library was sequenced using a second-generation sequencing platform to obtain raw sequencing data.

[0099] The raw data were analyzed using cutadapt software (URL: https: / / cutadapt.readthedocs.io / en / stable / ) to remove adapter sequences and low-quality bases (quality value less than 10), and to filter sequences less than 40 bp in length.

[0100] The filtered data were aligned to the corresponding position of the reference genome hg19 using the MEM algorithm of the bwa software (website: http: / / bio-bwa.sourceforge.net / ) to obtain a bam file.

[0101] The bam file was analyzed using sentieon software (https: / / https: / / support.sentieon.com / ) to obtain information about single nucleotide variations (SNVs) and insertions and deletions (INDELs). The mutation sites were filtered with the following filtering conditions: 1) the number of mutation reads was greater than 1; 2) the site coverage was greater than 20×. The mutation frequency was calculated based on the mutation reads and reference reads.

[0102] Example 3: Detection sensitivity evaluation

[0103] Another difficulty in the technical solution of this application is that there is a lack of cfDNA standards with known MAP2K1 mutation frequencies on the market. To this end, the applicant selected gDNA samples of LCH patient lesion tissues (MAP2K1 mutation frequencies have been determined based on high-throughput sequencing results), used gDNA samples of healthy people with known negative mutations as negative controls, and used healthy people's gDNA to grade dilute LCH patient gDNA samples to obtain standards with different mutation frequencies, which were tested after library construction to determine the sensitivity of the sequencing method of this application.

[0104] 1. Mutation detection sensitivity for region chr15:66727423-66727492

[0105] The gDNA samples of lesion tissue from a LCH patient (WXR) with known MAP2K1 Q58_E62del gene mutation were selected as the standard, and the mutation frequency was determined to be 7.82% by high-throughput sequencing. The gDNA samples of normal subjects with known negative mutations were used as negative controls. The patient's gDNA was gradiently diluted according to the mutation frequencies of 1%, 0.5%, 0.1%, 0.08%, and 0.06%, and the library was sequenced. 0.5%, 0.1%, 0.08%, and 0.06% were repeated 10 times each.

[0106] The sequencing result data show (Table 4) that the effective sequencing depth of the present application can reach up to 100,000× or more; the lowest limit of quantification (LLoQ) of the present application is 0.1% (and repeated 10 times, the detection rate is 100%), and the lowest limit of detection (LoD) is 0.08% (and repeated 10 times, the detection rate is 90%), which reflects the extremely high sensitivity.

[0107] Table 4. Sequencing depth and mutation frequency detection of samples at different dilution concentrations

[0108]

[0109]

[0110] 2. Mutation detection sensitivity for chr15:66729066-66729124:

[0111] The gDNA samples of lesion tissues from an LCH patient (YAQ) with known MAP2K1 L101_I103del gene mutation were selected as standards, and the mutation frequency was determined to be 3.21% by high-throughput sequencing. The gDNA samples of normal subjects with known negative mutations were used as negative controls. The patient gDNA was diluted in sequence according to the mutation frequencies of 1%, 0.5%, 0.1%, 0.08%, and 0.06%, and the libraries were sequenced. The dilutions of 0.5%, 0.1%, 0.08%, and 0.06% were repeated ten times each.

[0112] According to the sequencing result data (Table 5), the effective sequencing depth can reach more than 100,000×, and some even reach 1,000,000×; in addition, the lowest limit of quantification (LLoQ) is 0.08% (and repeated 10 times, the detection rate is 100%), and the lowest limit of detection (LoD) is 0.06% (and repeated 10 times, the detection rate is 80%), which also reflects the extremely high sensitivity.

[0113] Table 5. Sequencing depth and mutation frequency detection of samples at different dilution concentrations

[0114]

[0115]

[0116]

[0117] Example 4: Clinical practice detection and prognostic evaluation significance

[0118] This example uses the aforementioned method to detect plasma MAP2K1 gene mutations in real clinical LCH patients, and simultaneously evaluates the correlation between the monitoring results and clinical treatment response and prognosis.

[0119] From January 1, 2023 to March 31, 2024, our hospital used the method of this application to test 24 children with LCH, and continuously tested the MAP2K1 gene mutation levels in the plasma cfDNA of these 24 children.

[0120] Among the 24 children with LCH, there were 19 boys and 5 girls, with a median age of 5.75 years (range: 0.58-11.42 years). In terms of clinical classification, 12 cases (48.0%) were in the single system involvement group (SS) and 5 cases (48.0%) were in the multi-system group without risk organ involvement (MSRO). — ) 9 cases (37.5%), multi-system group with risk organ involvement (MS RO + ) 3 cases (12.5%); the most common organ affected was bone (incidence 100%), followed by lymph nodes (33.3%), lungs (12.5%), skin (8.3%), liver (4.2%), pituitary gland (4.2%), etc.

[0121] All of these children were diagnosed with LCH by biopsy pathological examination at the initial diagnosis, and MAP2K1 gene mutations were detected in the lesion tissues by the second-generation sequencing method. The specific mutation sites are shown in Table 6. Among them, 19 cases (79.2%) had MAP2K1 mutations located in exon 2, and 5 cases (20.8) had mutations located in exon 3.

[0122] Table 6. MAP2K1 mutation sites in lesion tissues of 24 children with LCH

[0123]

[0124] Among the 24 children, 21 had MAP2K1 mutation levels in plasma cfDNA tested at diagnosis, of which 13 (61.9%) were positive for mutations, with a median mutation level of 0.135% and a range of 0.009%-4.100%. Plasma MAP2K1 gene mutation levels were monitored during treatment and follow-up in 14 patients, of whom 4 had significantly increased MAP2K1 gene mutation levels at the time of disease relapse or progression, and 1 had significantly increased gene mutations 6 months before relapse. Some of the results are as follows (see Figure 1-4 ).

[0125] Case LCH-18: boy, first diagnosed at the age of 1 year and 3 months, the affected organs are liver, lungs, multiple bones (bilateral frontal bones, temporal bones, occipital bones, skull base bones, right clavicle, sternum, right humerus, cervical vertebra T1 vertebra and left lamina, T2, T9 vertebra, T11 right lamina, right second anterior rib, fifth lateral rib and left sixth anterior rib), skin, multiple lymph nodes (cervical, abdominal cavity), clinical classification is MS RO + The lesion biopsy tissue of the child at the initial diagnosis was positive for MAP2K1K57_G61del mutation, with a mutation rate of 3.23%. The patient was given targeted therapy with trametinib. The disease was stable at 1 month, and the plasma MAP2K1 gene mutation was negative when detected by the method of the present invention. The disease progressed and the right frontal and parietal bones worsened at 2 months, and the plasma MAP2K1 gene mutation level turned positive (0.31%). The disease improved at 6 months, and the plasma MAP2K1 gene level turned negative. The disease improved or stabilized from 12 months to 6 months of dose reduction, and the plasma MAP2K1 gene was low-level positive, which were 0.034%, 0.021% and 0.008%, respectively. Relapses occurred in the parietal bones and the ninth posterior ribs 3 months after drug withdrawal, and the plasma MAP2K1 mutation level was significantly increased (4.081%) at this time. Trametinib targeted therapy was given again after relapse, and the disease was stable at 3 months, and the plasma gene mutation level dropped significantly to 0.024%. The disease improved in 6 and 9 months, and the plasma MAP2K1 mutation was low-level positive, which were 0.009% and 0.055%, respectively. The child is still receiving targeted therapy.

[0126] Case LCH-107: girl, first diagnosed at the age of 1 year and 10 months, affected organs are lungs, multiple bones (C6, T5, T11 vertebrae, right humerus, left scapula, right 3rd and 4th ribs, left temporal bone mastoid, occipital bone, right temporal bone mastoid, left mandibular ramus of mandible, left femoral neck, right humerus, pelvis), lymph nodes (multiple bilateral submandibular, submental and carotid sheath, axilla). MAP2K1 Q58_E62del mutation was detected in the biopsy tissue of the child at the first diagnosis, with a mutation ratio of 13.28%. At the same time, the detection of MAP2K1 gene mutation in plasma cfDNA by the method of the present invention was negative. After 5 weeks of first-line chemotherapy, the patient's condition progressed, with new destruction of the parietal bone and left temporal bone, progression of the right humerus, aggravation of the left iliac bone and left femur, and the plasma MAP2K1 gene mutation level increased to 0.040%. The patient was upgraded to second-line treatment, and the condition was evaluated as improved after 5 courses of treatment, with the plasma gene mutation level dropping to 0.0087%. After 10 courses of second-line treatment, the condition continued to improve, and the gene mutation turned negative. The patient is still undergoing second-line chemotherapy.

[0127] Case LCH-101: boy, first diagnosed at age 7 months, affected organs are skin, both lungs, multiple bones (frontal bone, occipital bone and right temporal bone, mandible, C2, 5 and T1 vertebrae, C5 and T1 attachments, right zygomatic arch, cervical thoracic vertebrae, skull base bones, bilateral scapulae, left clavicle, bilateral humerus, ribs, ilium, left femur, bilateral tibia, bilateral femur, left humerus, right radius). MAP2K1 Q58_E62del mutation was detected in the biopsy tissue of the child at the first diagnosis, with a mutation ratio of 1.1%. At the same time, the MAP2K1 gene mutation level detected in plasma cfDNA using the method of the present invention was 4.1%. The patient was given targeted therapy with trametinib, and the condition improved in January, and the plasma MAP2K1 gene mutation turned negative; the condition continued to improve or stabilize after 3-15 months of targeted therapy and 4 months of dose reduction, and the plasma MAP2K1 gene mutation was negative or low-level positive (0.05%-0.1146%); after 7 months of dose reduction, the condition was rated as improved, but the plasma MAP2K1 gene mutation level increased to 0.504%; after 10 months of dose reduction, the condition was still rated as improved, but the plasma MAP2K1 gene mutation level increased significantly to 13.764%; after 13 months of dose reduction, the condition progressed, with new left pedicle bone destruction, and the plasma MAP2K1 gene mutation level continued to be at a high level of 6.783%; the patient was transferred to second-line chemotherapy for 4 courses and the condition was rated as improved, and the plasma MAP2K1 gene mutation level dropped to 0.292%. The child is currently still receiving second-line chemotherapy.

[0128] Case LCH-81: Girl, first diagnosed at age 3 years and 4 months, multiple bones (occipital bone, C6, T9) were affected. MAP2K1 Q56_V60del mutation was detected in the biopsy tissue at the first visit, with a mutation ratio of 13.28%, and plasma MAP2K1 gene mutation test was negative. First-line chemotherapy was given, and the condition improved at 5 weeks. The plasma MAP2K1 gene mutation test continued to be negative at 25 weeks. The disease progressed 3 months after stopping the drug, and the localized bone destruction of the occipital bone was more obvious than before. At the same time, the plasma MAP2K1 gene mutation level turned positive, with a level of 0.0161%.

[0129] The above results suggest that the detection of MAP2K1 gene mutation levels in plasma cfDNA of LCH patients during targeted or chemotherapy by the method of the present application is closely related to the patient's treatment response and prognosis and is accurate, especially patients with significantly elevated MAP2K1 gene mutation levels should be alert to the progression or recurrence of the disease. Therefore, the application of the high-depth targeted capture sequencing technology of the present invention to detect MAP2K1 gene mutation levels in LCH patients during treatment and follow-up is helpful to accurately assess the risk of progression and recurrence, further assist the clinic in accurately judging the patient's treatment response and prognosis, and provide important reference and guidance for formulating reasonable treatment plans, implementing individualized precision treatment for patients, and molecular targeted treatment.

[0130] The sites that can be detected by the high-depth targeted capture sequencing of the present application include not only the 10 MAP2K1 gene mutation sites established by the prior art, but also other possible mutation sites in the target region of the MAP2K1 gene covered by the primers. In addition, the high-depth targeted capture sequencing technology of the present application can also be further applied to the detection of MAP2K1 mutations in gDNA of peripheral blood mononuclear cells and lesion tissue cells in LCH.

[0131] Finally, it is noted that the above embodiments are only used to illustrate the technical solution of the present application, rather than to limit it. Although the present application has been described in detail with reference to the aforementioned embodiments, it should be understood in the art that the technical solutions described in the aforementioned embodiments can still be modified, or some or all of the technical features therein can be replaced by equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solution to deviate from the scope of the technical solutions of the embodiments of the present application.

Claims

1. An amplicon targeted sequencing primer set for prognosis monitoring of Langerhans' histiocytosis, characterized in that: The primers are directed to the MAP2K1 gene; the primers are directed to the second exon region chr15:66727423-66727492 and the third exon region chr15:66729066-66729124 of the MAP2K1 gene; the mutations directed by the primers include the following: The primer sequences are as follows: Primer pair 1: F:CCCTACACGACGCTCTTCCGATCTCGAAAGCGCCTTGAGG; R:GTTCAGACGTGTGCTCTTCCGATCTTCTCAAAGTCGTCATCCTTCAG; Primer pair 2: F:CCCTACACGACGCTCTTCCGATCTTCTTCCACCTTTCTCCAGCT; R:GTTCAGACGTGTGCTCTTCCGATCTATCTGGGTTCCGGATTGCGG.

2. An amplicon targeted sequencing kit for prognosis monitoring of Langerhans' histiocytosis, characterized in that: Comprising the primer set of claim 1.

3. Use of the amplicon targeted sequencing primer set according to claim 1 in preparing a prognosis monitoring kit for Langerhans' histiocytosis.

Images