Active ingredients comprising miRNAs and their use
By using miRNAs from the miR-302/miR-367 family, the cell cycle and proliferation capacity of senescent cells are restored, solving the problem of reversing cell senescence in existing technologies and achieving the effect of "rejuvenating" cells.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- YUANSHENG BIOTECH (TSING DAO) CO LTD
- Filing Date
- 2023-05-23
- Publication Date
- 2026-06-05
Smart Images

Figure BDA0004966811830000051 
Figure BDA0004966811830000071 
Figure BDA0004966811830000101
Abstract
Description
[0001] This application is a divisional application with application number 202310592232.X, application date May 23, 2023, and invention title "Active ingredient containing miRNA and its application". Technical Field
[0002] This application belongs to the field of biomedicine, specifically relating to active ingredients containing miRNA and their applications. Background Technology
[0003] Aging is a process that all living things must face. Finding the biological mechanisms of aging and discovering methods and drugs to slow down or reverse it has always been a hot topic in the scientific community, and it also has significant social implications and enormous commercial value. Aging is divided into several levels: individual aging, organ aging, and cellular aging. The aging of individuals and organs ultimately manifests in cellular aging. From a drug development perspective, obtaining drugs that slow down or reverse cellular aging and then applying them to animals is a reasonable approach.
[0004] MicroRNAs (miRNAs) are non-coding single-stranded RNA molecules of 18-25 nucleotides in length encoded by endogenous genes. miRNAs are involved in various biological processes. One mechanism is that miRNAs bind complementaryly to target genes, ultimately cleaving the target mRNA. Another mechanism is that miRNAs bind incompletely complementary to target genes, inhibiting the translation of the target gene.
[0005] The seed sequence of miRNA is the most evolutionarily conserved sequence, typically the 2nd to 8th nucleotides from the 5' end. The conservation of the seed and target sequences forms the basis of the target sequence prediction model, but the predicted target sequences still need experimental verification.
[0006] Currently, there are no effective miRNA drugs for reversing aging-related diseases. Summary of the Invention
[0007] Based on this, it is necessary to provide an active ingredient that has been found to be able to reverse the aging process, for example, to restore aging cells to re-enter the cell cycle or to restore the proliferative capacity of aging cells.
[0008] The specific technical solution is as follows:
[0009] This application provides an active ingredient, said active ingredient comprising at least one of the following:
[0010] (1) miRNAs of the miR-302 / miR367 family, or modified miRNA derivatives of the miR-302 / miR367 family, or miRNA mimics of the miR-302 / miR367 family.
[0011] (2) Pre-miRNA, wherein the precursor miRNA can be processed into the miRNA described in (1) within the host;
[0012] (3) A polynucleotide, which can be transcribed by the host to form the precursor miRNA described in (2) and processed to form the miRNA described in (1);
[0013] (4) An expression vector containing the miRNA described in (1), or the precursor miRNA described in (2), or the polynucleotide described in (3);
[0014] (5). (1) Agonists of the miRNA described in (5).
[0015] In one embodiment, the miRNA is derived from a human or other animal. Optionally, the other animals include one or more of primates and other mammals, amphibians, and birds. Optionally, the other animals include one or more of monkeys, cats, dogs, mice, and rats.
[0016] In one embodiment, the miR-302 / 367 family of miRNAs includes one or more of miR-302a, miR-302b, miR-302c, miR-302d, miR-302e, miR-302f, and miR-367. Optionally, miR-302a includes miR-302a-3p and / or miR-302a-5p; miR-302b includes miR-302b-3p and / or miR-302b-5p; miR-302c includes miR-302c-3p and / or miR-302c-5p; miR-302d includes miR-302d-3p and / or miR-302d-5p; and miR-367 includes miR-367-3p and / or miR-367-5p.
[0017] In one embodiment, the miR-302 / 367 family miRNAs are selected from one or more of the following: hsa-miR-302a-3p, hsa-miR-302b-3p, hsa-miR-302c-3p.1, hsa-miR-302d-3p, hsa-miR-302e, bta-miR-302b, bta-miR-302c, bta-miR-302d, gga-miR-302b-3p, gga-miR-302c-3p, gga-miR-302d, mdo- miR-302a, mdo-miR-302b, mdo-miR-302c, mdo-miR-302d, mml-miR-302a-3p, mml-miR-302b, mml-miR-302c, mml-miR-302d, mm u-miR-302a-3p, mmu-miR-302b-3p, mmu-miR-302d-3p, ptr-miR-302a, ptr-miR-302b, ptr-miR-302c, ptr-miR-302d, ptr-miR- 302e, hsa-miR-302a-5p, cfa-miR-302a, mmu-miR-302a-5p, hsa-miR-302b-5p, hsa-miR-302d-5p, cfa-miR-302b, cfa-miR-30 2d, gga-miR-302b-5p, mmu-miR-302b-5p, mmu-miR-302c-5p, mmu-miR-302d-5p, bta-miR-302a, gga-miR-302a, mmu-miR-302c -3p, hsa-miR-302c-5p, cfa-miR-302c, gga-miR-302c-5p, hsa-miR-302f, ptr-miR-302f, hsa-miR-367-5p, cfa-miR-367, mmu -miR-367-5p, hsa-miR-367-3p, mml-miR-367, mmu-miR-367-3p, ptr-miR-367, gga-miR-367, mml-miR-302a-5p and xtr-miR-367.
[0018] In one embodiment, the nucleotide sequence of the miR-302 / 367 family miRNA comprises at least one nucleotide sequence as shown in SEQ ID No: 1 to 14.
[0019] This application also provides the application of the above-mentioned active ingredients in the preparation of products that reverse the aging process.
[0020] This application also provides the use of the above-mentioned active ingredients in the preparation of products that restore the cell cycle or cell proliferation capacity of senescent cells.
[0021] In one embodiment, the senescent cells are senescent liver cells.
[0022] This application also provides the application of the above-mentioned active ingredients in the preparation of products for animals that reverse aging.
[0023] In one embodiment, the aging animal includes one or more of humans, cats, dogs, rats, and mice.
[0024] In one embodiment, the reversal includes restoring senescent cells in an aging animal to return to the cell cycle, causing the aging animal to reverse aging.
[0025] In one embodiment, the senescent cells include senescent liver cells.
[0026] This application also provides the use of the above-mentioned active ingredients in the preparation of products for treating diseases related to cellular aging.
[0027] Compared with the prior art, this application has the following beneficial effects:
[0028] This application, through in vitro cell experiments and in vivo animal experiments, discovered that miRNAs in the miR-302 / 367 family, or miRNAs with essentially the same function and the same core sequence, can reverse aging cells, enabling them to return to the cell cycle and proliferate, a phenomenon known as "rejuvenation," and thus serve as active ingredients for reversing aging. Attached Figure Description
[0029] Figure 1A The results are from flow cytometry fluorescence sorting. Figure 1B To detect the senescence of the p21-YFP-Neo cell line, the expression of p21-YFP was determined under a fluorescence microscope. Figure 1C Image of β-gal staining;
[0030] Figure 2 The proliferation of senescent cells after treatment with mir-302b;
[0031] Figure 3 To track the proliferation of senescent cells after miR-302b treatment with high content, each image was taken at a time interval of 6 hours.
[0032] Figure 4The proliferation of senescent cells after treatment with human miR-302a, miR-302b, miR-302c, miR-302d, miR-302e, miR-302f, and miR-367;
[0033] Figure 5 Figure A shows the flow cytometry cell cycle detection results; Figure A is the flow cytometry plot, and Figure B is the quantification plot of Figure A.
[0034] Figure 6 Results of Ki67 staining;
[0035] Figure 7 Build a process for pAAV-CMV-miR-302b;
[0036] Figure 8 A schematic diagram of the packaging of recombinant AAV virus overexpressing miR-302b;
[0037] Figure 9 A graph showing the effects of mir-302b administration on aging-reducing changes in older mice;
[0038] Figure 10 Results of organ β-gal staining;
[0039] Figure 11 Results of H&E staining of hair follicles;
[0040] Figure 12 Results of the rotating rod experiment and gripping force;
[0041] Figure 13 The results are from the urine stain test. Detailed Implementation
[0042] To make the above-mentioned objectives, features, and advantages of this application more apparent and understandable, the specific embodiments of this application are described in detail below with reference to the accompanying drawings. Many specific details are set forth in the following description to provide a thorough understanding of this application. However, this application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar modifications without departing from the spirit of this application. Therefore, this application is not limited to the specific embodiments disclosed below.
[0043] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein in the specification of this application is for the purpose of describing particular embodiments only and is not intended to be limiting of this application.
[0044] As used herein, the term "and / or" includes any and all combinations of one or more of the related listed items.
[0045] Currently, senescent cells are defined as cells whose cell cycle has permanently terminated. However, this application discovers that senescent cells do not have a permanent cell cycle termination, but rather a temporary cessation. Senescent cells can be reactivated and re-enter the cell cycle through exogenous miRNAs. This discovery, as a disruptive result, will bring new ideas and potential drugs to the critical problem of aging that urgently needs to be solved.
[0046] Based on this, one embodiment of this application provides an active ingredient, which includes at least one of the following:
[0047] (1) A miRNA or modified miRNA derivative or miRNA mimic containing at least one of the following core sequences, with a length of 16 to 28 nt, and functioning the same or substantially the same as miR-302 or miR-367:
[0048] 5'-AAGUGCU-3', 5'-CUUAAAC-3', 5'-CUUUAAC-3', 5'-AGUGCUU-3', 5'-UUAACAU-3', 5'-AAUUGCU-3', 5'-CUGUUGC-3' and 5'-AUUGCAC-3';
[0049] (2) Pre-miRNA, wherein the precursor miRNA can be processed into the miRNA described in (1) within the host;
[0050] (3) A polynucleotide, which can be transcribed by the host to form the precursor miRNA described in (2) and processed to form the miRNA described in (1);
[0051] (4) An expression vector containing the miRNA described in (1), or the precursor miRNA described in (2), or the polynucleotide described in (3);
[0052] Agonists of the miRNAs described in (5)(1).
[0053] In a specific example, the miRNA mentioned in (1) can be a mature miRNA.
[0054] The term "miRNA and its precursors" refers to microRNAs (miRNAs), which are endogenous, non-coding, single-stranded small RNAs of approximately 22 nucleotides in length, discovered in recent years in eukaryotes such as nematodes, fruit flies, plants, and mammals. They exhibit tissue- and time-specific expression, negatively regulating gene expression at the post-transcriptional level through complementary base pairing with target mRNAs, leading to mRNA degradation or translational repression. They are important regulatory molecules that regulate the expression of other functional genes. Increasing evidence suggests that although miRNAs are small, they play a crucial role in various life processes by forming complete or incomplete unpaired pairs with target mRNAs. As used herein, "miRNA" refers to a class of RNA molecules derived from transcripts that can form miRNA precursors. Mature miRNAs typically have 18-26 nucleotides (nt) (more specifically, about 19-22 nt), but miRNA molecules with other numbers of nucleotides are also possible. miRNAs can usually be detected by Northern blotting.
[0055] miRNAs can be processed from precursor miRNAs (pre-miRNAs), which fold into a stable stem-loop (hairpin) structure, typically 50-100 bp or longer. The precursor miRNA folds into a stable stem-loop structure, with the stem containing two substantially complementary sequences on either side. The precursor miRNA can be natural or synthetic. As used herein, "substantially complementary" means that the nucleotide sequences are sufficiently complementary to interact in a predictable manner, such as forming secondary structures (e.g., stem-loop structures). Typically, at least 70% of the nucleotides in two "substantially complementary" nucleotide sequences are complementary to each other; preferably, at least 80%; more preferably, at least 90%; and even more preferably, at least 95%; such as 98%, 99%, or 100%.
[0056] As used herein, a "stem-loop" structure, also known as a "hairpin" structure, refers to a nucleotide molecule that can form a secondary structure including a double-stranded region (stem) formed by two regions of the nucleotide molecule (located on the same molecule), positioned on either side of the double-stranded portion; it also includes at least one "loop" structure, comprising a non-complementary nucleotide molecule, i.e., a single-stranded region. Even if the two regions of the nucleotide molecule are not perfectly complementary, the double-stranded portion of the nucleotide can remain double-stranded. For example, insertions, deletions, substitutions, etc., can lead to a small region becoming non-complementary or forming a stem-loop structure or other forms of secondary structure; however, the two regions can still be substantially complementary and interact in a predictable manner to form a stem-loop double-stranded region. Stem-loop structures are well known to those skilled in the art, and typically, after obtaining a nucleic acid with a nucleotide sequence having a primary structure, those skilled in the art can determine whether the nucleic acid can form a stem-loop structure.
[0057] As used in this article, “functionally identical or substantially identical to miR-302” means that it retains ≥50%, ≥60%, ≥70%, ≥80%, or ≥90% of the miR-302b’s ability to reverse the aging process (e.g., to restore the cell cycle or cell proliferation of senescent cells).
[0058] This application also includes miRNA variants and derivatives. Those skilled in the art can modify miR-302 using common methods, including (but not limited to): methylation modification, locked nucleotide modification, nucleic acid modification, hydrocarbon group modification, glycosylation modification, peptide modification, lipid modification, halogen modification, etc.
[0059] In a specific example, miRNA agonists include substances that promote miRNA expression or enhance miRNA functional activity. For example, miRNA mimics contain polynucleotide sequences of primordial miRNAs (pri-miRNAs), pre-miRNAs (pre-miRNAs), or mature sequences of miR-302a, miR-302b, miR-302c, miR-302d, miR-302e, miR-302f, and / or miR-367.
[0060] In one specific example, the miRNA is derived from a human or other animal; preferably, the other animal is one or more of a monkey, cat, dog, rat, and mouse.
[0061] In a specific example, the miR-302 / miR367 family containing the 5'-AAGUGCU-3' core sequence is selected from one or more of the following groups: hsa-miR-302a-3p, hsa-miR-302b-3p, hsa-miR-302c-3p.1, hsa-miR-302d-3p, hsa-miR-302e, bta-miR-302b, bta-miR-302c, bta-miR-302d, gga-miR-302b-3p, gga-miR-302c-3p, gga-miR-302d, mdo-miR-302a, mdo-miR-302 b, mdo-miR-302c, mdo-miR-302d, mml-miR-302a-3p, mml-miR-302b, mml-miR-302c, mml-miR-302d, mmu-miR-302a-3p, mmu-miR-302b-3p, mmu-miR-302d-3p, ptr-miR-302a, ptr-miR-302b, ptr-miR-302c, ptr-miR-302d, ptr-miR-302e; and / or, the miR-302 / miR367 family containing the 5'-CUUAAAC-3' core sequence is selected from one of the following groups. One or more: hsa-miR-302a-5p, cfa-miR-302a, and mmu-miR-302a-5p; and / or, the miR-302 / miR367 family containing the 5'-CUUUAAC-3' core sequence is selected from one or more of the following groups: hsa-miR-302b-5p, hsa-miR-302d-5p, cfa-miR-302b, cfa-miR-302d, gga-miR-302b-5p, mmu-miR-302b-5p, mmu-miR-302c-5p, and mmu-miR-302d ...67 family containing the 5'-AGUGCUU-3' core sequence is selected from one or more of the following groups: hsa-miR-302b-5p, cfa-miR-302d-5p, cfa-miR-302b-5p, gfa-miR-302d-5p, mmu-miR-302c-5p, and mmu-miR-302d-5p; and / or, the miR-367 family containing the 5'-AGUGCUU-3' core sequence is selected from one or more of the following groups: hsa-mi The miR-302 / miR367 family containing the core sequence is selected from one or more of the following groups: bta-miR-302a, gga-miR-302a, mmu-miR-302c-3p; and / or, the miR-302 / miR367 family containing the 5'-UUAACAU-3' core sequence is selected from one or more of the following groups: hsa-miR-302c-5p, cfa-miR-302c, and gga-miR-302c-5p; and / or, the miR-302 / miR367 family containing the 5'-AAUUGCU-3' core sequence is selected from hsa-miR-302f and / or ptr-miR-302f;And / or, the miR-302 / miR367 family containing the 5'-CUGUUGC-3' core sequence is selected from hsa-miR-367-5p, cfa-miR-367, mmu-miR-367-5p; and / or, the miR-302 / miR367 family containing the 5'-AUUGCAC-3' core sequence is selected from hsa-miR-367-3p, mml-miR-367, mmu-miR-367-3p, ptr-miR-367, xtr-miR-367.
[0062] In a specific example, the miRNA is a miRNA from the miR-302 / 367 family, which includes miR-302 and / or miR-367, or modified miR-302 or miR-367 derivatives, whose function is the same as or substantially the same as miR-302b or miR-367. The miRNA can be a mature miRNA. While there may be base differences in the sequences and coding sequences of these mature miRNAs across different species, this does not affect their function.
[0063] In a specific example, miR-302 includes one or more of miR-302a, miR-302b, miR-302c, miR-302d, miR-302e, and miR-302f; optionally, miR-302a includes miR-302a-3p and / or miR-302a-5p; miR-302b includes miR-302b-3p and / or miR-302b-5p; miR-302c includes miR-302c-3p and / or miR-302c-5p; miR-302d includes miR-302d-3p and / or miR-302d-5p; miR-367 includes miR-367-3p and / or miR-367-5p;
[0064] In a specific example, the miRNA is selected from the following miRNAs in the miR-302 / 367 family:
[0065] hsa-miR-302a-3p(MIMAT0000684)、hsa-miR-302b-3p(MIMAT0000715)、hsa-miR-302c-3p.1(MIMAT0000717)、hsa-miR-302d-3p(MIMAT0000718)、hs a-miR-302e(MIMAT0005931)、bta-miR-302b(MIMAT0009280)、bta-miR-302c(MIMAT0009281)、bta-miR-302d(MIMAT0009279)、gga-miR-302b-3p(MI MAT0003357)、gga-miR-302c-3p(MIMAT0003359)、gga-miR-302d(MIMAT0003360)、mdo-miR-302a(MIMAT0004182)、mdo-miR-302b(MIMAT0004180)、mdo-miR-302c(MIMAT0004181)、mdo-miR-302d(MIMAT0004183)、mml-miR-302a-3p(MIMAT0006259)、mml-miR-302b(MIMAT0006260)、mml-miR-302c(M IMAT0006261)、mml-miR-302d(MIMAT0006262)、mmu-miR-302a-3p(MIMAT0000380)、mmu-miR-302b-3p(MIMAT0003374)、mmu-miR-302d-3p(MIMAT0003377)、ptr-miR-302a(MIMAT0008086)、ptr-miR-302b(MIMAT0008087)、ptr-miR-302c(MIMAT0008088)、ptr-miR-302d(MIMAT0008089)、ptr-miR-30 2e(MIMAT0008090)、hsa-miR-302a-5p(MIMAT0000683)、cfa-miR-302a(MIMAT0009855)、mmu-miR-302a-5p(MIMAT0004579)、hsa-miR-302b-5p(MIMA T0000714)、hsa-miR-302d-5p(MIMAT0004685)、cfa-miR-302b(MIMAT0009856)、cfa-miR-302d(MIMAT0009858)、gga-miR-302b-5p(MIMAT0003356)、mmu-miR-302b-5p(MIMAT0003373), mmu-miR-302c-5p(MIMAT0003375), mmu-miR-302d- 5p(MIMAT0017225), bta-miR-302a(MIMAT0009278), gga-miR-302a(MIMAT0001143), mmu -miR-302c-3p(MIMAT0003376), hsa-miR-302c-5p(MIMAT0000716), cfa-miR-302c(MIMA T0009857), gga-miR-302c-5p (MIMAT0003358), hsa-miR-302f (MIMAT0005932), ptr-miR -302f(MIMAT0008091), hsa-miR-367-5p(MIMAT0004686), cfa-miR-367(MIMAT0009859) , mmu-miR-367-5p(MIMAT0017214), hsa-miR-367-3p(MIMAT0000719), mml-miR-367(MIM AT0006292), mmu-miR-367-3p (MIMAT0003181), ptr-miR-367 (MIMAT0008118), gga-miR- 367 (MIMAT0003369), mml-miR-302a-5p (MIMAT0026851) and xtr-miR-367 (MIMAT0003638). ,
[0066] The part in parentheses is the accession sequence number, which can be queried in the mirbase database.
[0067] In a preferred example, the miRNA is selected from one or more of the following miRNAs in the miR-302 / 367 family: hsa-miR-302a-3p, hsa-miR-302a-5p, hsa-miR-302b-3p, hsa-miR-302b-5p, hsa-miR-302c-3p, hsa-miR-302c-5p, hsa-miR-302d-3p, hsa-miR-302d-5p, hsa-miR-302e, hsa-miR-302f, hsa-miR-367-5p, and hsa-miR-367-3p, or selected from nucleotides with ≥75% homology to the above miRNA sequences, preferably ≥85%, more preferably ≥95%, and most preferably ≥99%. Furthermore, the miRNA includes nucleotide sequences as shown in SEQ ID NO:1–14.
[0068] Based on the miRNA sequence provided in this application, those skilled in the art can design polynucleotides (constructs) that, after being introduced, can be processed into miRNAs that can affect the expression of the corresponding mRNAs, i.e., the polynucleotides (constructs) can upregulate the function of the corresponding miRNAs in vivo. Therefore, one embodiment of this application also provides an isolated polynucleotide (construct), which can be transcribed into a precursor miRNA by human cells, and the precursor miRNA can be cleaved and expressed into the miRNA by human cells.
[0069] Typically, the polynucleotide construct is located on an expression vector. Therefore, this application also includes a vector containing the described miRNA or the described polynucleotide (construct). The expression vector typically also contains a promoter, origin of replication, and / or marker genes. Methods well known to those skilled in the art can be used to construct the expression vectors required by this invention. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. The expression vector preferably contains one or more selective marker genes to provide phenotypic traits for selecting transformed host cells.
[0070] In a specific example, the derivative or the polynucleotide, or the expression vector thereof, comprises the structure shown in Formula I:
[0071] Seq 正向 -X-Seq 反向 Formula I;
[0072] In Equation I, Seq 正向 To ensure that the nucleotide sequence can be processed in the host into any miRNA in the miRNA-302 / miRNA-367 family, Seq 反向To be with Seq 正向 Essentially complementary nucleotide sequences; or, Seq 反向 To ensure that the nucleotide sequence can be processed in the host into any miRNA in the miRNA-302 / miRNA-367 family, Seq 正向 To be with Seq 反向 Essentially complementary or completely complementary nucleotide sequences; X is a spacer sequence located between the forward and reverse directions of Seq, and said spacer sequence is consistent with Seq. 正向 and Seq 反向 Not complementary;
[0073] Furthermore, the structure shown in Equation I, after being transferred into the host, forms the secondary structure shown in Equation II:
[0074]
[0075] In Equation II, Seq 正向 Seq 反向 The definitions of X and X are as described above.
[0076] || indicates that in Seq 正向 and Seq 反向 The complementary base pairing relationship formed between them.
[0077] In a preferred example, the precursor miRNA, the polynucleotide, or the expression vector comprises a nucleotide sequence as shown in any one of SEQ ID No: 1 to 14, for example, the nucleotide sequence of the precursor miR-302b is shown in SEQ ID No: 15.
[0078] In one specific example, the expression vector may be selected from viral vectors or non-viral vectors, wherein non-viral vectors include one or more of plasmids, bacteriophages, lipid nanoparticles (LNPs), transfection reagents, and exosomes.
[0079] Optionally, the plasmid includes one or more combinations of pCMV-myc, pcDNA3.0, pcDNA3.1, and Minicircle.
[0080] Preferably, the plasmid is Minicircle, which can carry the target gene with the smallest number of bp and can be continuously expressed in animals.
[0081] Optionally, the viral vector is selected from one or more of retroviral vectors, lentiviruses, adenovirus vectors, adeno-associated virus vectors, herpesvirus vectors, alphavirus vectors, baculoviruses, and vaccinia viruses. Preferably, it is an adeno-associated virus vector, such as AAV virus.
[0082] This application also provides, in one embodiment, the use of the above-described active ingredients in the preparation of products that reverse the aging process.
[0083] One embodiment of this application also provides the use of the above-mentioned active ingredients in the preparation of products that restore senescent cells to re-enter the cell cycle or restore the cell proliferation capacity of senescent cells.
[0084] An embodiment of this application also provides the use of the above-described active ingredient in the preparation of products for treating diseases related to cell aging.
[0085] In one specific example, the related diseases caused by cellular aging include one or more of the following: skin aging, hair loss, gray hair, hypertension, cardiovascular and cerebrovascular diseases, degenerative joint diseases, osteoporosis, diabetes, lipid metabolism disorders, fatty liver, cirrhosis, gonadal atrophy, overactive bladder, renal dysfunction, depression, Parkinson's disease, Alzheimer's disease, multiple organ dysfunction, cataracts, tooth loss, and hearing impairment.
[0086] In one specific example, lipid metabolism abnormalities are characterized by one or more of the following: excessive fatty acid synthesis, abnormal signaling pathways for de novo fatty acid synthesis (such as mTORC2 signaling), and abnormal expression of downstream rate-limiting enzymes related to de novo fatty acid synthesis.
[0087] In a specific example, overactive bladder is characterized by one or more of the following: urinary frequency, urgency, and with or without urge incontinence.
[0088] In one specific example, the product includes formulations and / or drug groups.
[0089] In one specific example, the drug comprises any of the active ingredients described above and pharmaceutically acceptable excipients or carriers.
[0090] In one specific example, the excipients include one or more of the following: solvents, propellants, solubilizers, cosolvents, emulsifiers, colorants, binders, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, flow aids, flavoring agents, preservatives, suspending agents, coating materials, fragrances, anti-adhesion agents, binding agents, penetration enhancers, pH adjusters, buffers, plasticizers, surfactants, foaming agents, defoamers, thickeners, encapsulating agents, humectants, absorbents, diluents, flocculants, anti-flocculation agents, filter aids, and release inhibitors.
[0091] In one specific example, the pharmaceutically acceptable carrier is selected from the group consisting of water, saline, liposomes, lipids, proteins, protein-antibody conjugates, peptides, cellulose, nanogels, or combinations thereof. The choice of carrier should be matched to the route of administration, as is well known to those skilled in the art.
[0092] Generally, the dosage form of a drug should be matched with the route of administration. In a specific example, the dosage form of the drug in this application includes one or more of the following: injection, oral liquid, suspension, emulsion, extract, powder, granule, suppository, aerosol, transfection agent, tablet, and capsule.
[0093] The drug described in this application can be used alone or in combination with other drugs that can treat the same disease.
[0094] One embodiment of this application also provides a pharmaceutical composition comprising the active ingredient described in any of the above claims.
[0095] One embodiment of this application also provides a method for reversing aging, using the above-described active ingredient or pharmaceutical composition to reverse the aging of a subject. The reversal of aging includes reversing the aging of an individual or reversing the aging of senescent cells.
[0096] In one specific example, using the DNA sequence encoding the above-mentioned miRNA as the target gene, such as miR-302b (SEQ ID No: 15), an overexpression vector of the miRNA is constructed, and a drug containing the overexpression vector of the miRNA is prepared and administered via in vitro or in vivo administration.
[0097] Specifically, those skilled in the art can administer the drug via an in vitro route: the drug of the above-mentioned miRNA overexpression vector is introduced or transfected into the individual's own or allogeneic cells in vitro, and then returned to the individual after in vitro cell expansion.
[0098] Specifically, those skilled in the art can also administer the drug via in vivo: directly introducing the drug of the above-mentioned miRNA overexpression vector into an individual.
[0099] The effective amount of the active ingredient described in this application may vary depending on the administration method and the severity of the disease to be treated. A preferred effective amount can be determined by those skilled in the art based on various factors (e.g., through clinical trials). These factors include, but are not limited to: the pharmacokinetic parameters of the active ingredient, such as bioavailability, metabolism, and half-life; the severity of the disease to be treated, the patient's weight, the patient's immune status, and the route of administration.
[0100] One embodiment of this application also provides a method for non-therapeutic reversal of aging in vitro, or a method for restoring the cell cycle or cell proliferation capacity of senescent cells. The method includes adding the pharmaceutical composition of this application or the active ingredient of this application into cultured senescent cells, thereby reversing the aging process of the senescent cells and causing the senescent cells to return to the cell cycle and proliferate.
[0101] The embodiments of this application will be described in detail below with reference to examples. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of this application. For experimental methods in the following embodiments where specific conditions are not specified, please refer to the guidelines given in this application, or follow experimental manuals or conventional conditions in the art, or follow the conditions recommended by the manufacturer, or refer to experimental methods known in the art.
[0102] In the specific embodiments described below, the measurement parameters involving raw material components may have slight deviations within the weighing accuracy range unless otherwise specified. Temperature and time parameters are subject to acceptable deviations due to instrument testing accuracy or operational precision.
[0103] Example 1: Doxorubicin induces senescence in the p21-YFP-Neo cell line
[0104] In the early stages of their research, the inventors utilized CRISPR / Cas9 technology, employing Cas9, gRNA, and p21-YFP donors for gene editing. Specifically, they inserted the YFP gene fragment at a specific location into the p21 terminator codon of the LO2 cell line and screened for LO2-P21-YFP positive cell lines.
[0105] Specifically, the CRISPR / Cas9 vector was constructed using a gRNA sequence, the sequence of which is GGCTTCCTGTGGGCGGATTA, SEQ ID No:25.
[0106] Synthesis of the p21-YFP donor plasmid: First, the sequence of the YFP encoding gene (bases at positions 3536 to 4252 as shown in SEQ.ID No:26) was inserted into the Venus-P2A-Neo plasmid to prepare the YFP-P2A-Neo plasmid. Using LO2 cell genomic DNA and the YFP-P2A-Neo plasmid as templates, the Vector fragment, p21Upstream fragment, YFP-NeoR fragment, and p21Downstream fragment were amplified using the primers in Table 1. The four fragments were then assembled into the p21-YFP donor plasmid using the Gibson reaction system (donor plasmid sequence as shown in SEQ ID No:26). All the above experiments were performed by Sangon Biotech.
[0107] Table 1
[0108]
[0109] Furthermore, LO2 cells were co-transfected with a CRISPR / Cas9 vector containing gRNA and a p21-YFP donor plasmid, and LO2-P21-YFP positive cell lines were screened.
[0110] Furthermore, senescence of the LO2-P21-YFP cell line was induced using Doxorubicin, and a senescent cell model was obtained by flow cytometry sorting using YFP.
[0111] P21 (cyclin-dependent kinase inhibitor p21, CDKN1A) is an important biomarker of aging. P21 is a downstream CDKN1 that phosphorylates p53 and blocks cell cycle entry into the G1 / S involution cell cycle by binding to CDK2. High expression of P21 is associated with aging.
[0112] Doxorubicin is a DNA topoisomerase inhibitor commonly used in cancer treatment. At a low concentration of 50 nM, it can induce cellular senescence. Due to the quinone-hydroquinone structure of the anthracene ring ligand in the doxorubicin molecule, it has the ability to accept electrons and donate neutrons. It inserts between adjacent base pairs in DNA, generating reactive free radicals that cause the DNA double helix to unwind, leading to DNA strand breaks, inhibiting nucleic acid template activity, interfering with transcription, and suppressing mRNA synthesis. It may also cause cell membrane rupture, exhibiting cytotoxic effects. As a cell cycle non-specific drug, it acts on cells in all phases, but is most sensitive to the early S phase, followed by the M phase, and least sensitive to the G1 phase. It has a delaying effect on the G1, S, and G2 phases.
[0113] Specifically, the steps involved in doxorubicin-induced senescence in the p21-YFP-Neo cell line include the following:
[0114] (1) 0.3x10 6 One p21-YFP-Neo cell was seeded into a 35mm laser confocal cell culture dish and cultured for 12 hours.
[0115] (2) After the cells adhere, change the medium and add Doxorubicin medium containing 50 nM / L.
[0116] (3) After 24 hours, replace with normal culture medium.
[0117] (4) After culturing for 4 days, YFP was used for flow cytometry sorting to observe the expression of p21-YFP in the sorted cells.
[0118] (5) Perform aging-related β-galactosidase staining.
[0119] The β-galactosidase staining method includes the following steps:
[0120] Dilute 10X Fixative Solution to 1X, and completely dissolve and dilute Staining Solution to 1X in a 37°C water bath. Dissolve 20 mg of X-gal in DMF and store at -20°C protected from light. Prepare staining solution by adding 1 mL of staining solution to each well of a 6-well plate. Prepare 1 mL of staining solution by mixing 930 μL of 1X Staining Solution, 10 μL of 100X Staining Solution A, 10 μL of 100X Staining Solution B, and 50 μL of 20 mg / mL X-gal, and adjust the pH to 6.0. Remove the cell culture supernatant, wash twice with PBS, and fix each well of the 6-well plate with 1 mL of 1X Fixative Solution at room temperature for 15 min. Remove the fixative, wash once with PBS, add staining solution, and incubate at 37°C in a carbon dioxide-free incubator for 12 hours. Observe the staining under a microscope.
[0121] YFP-positive cells were selected and sorted using FITC fluorescence gating, and the results are as follows: Figure 1A As shown.
[0122] After sorting, the cells were seeded into plates, and 0.3 × 10⁶ cells were seeded into each well. 6 Cells were seeded in a 35 mm cell culture dish and imaged using a fluorescence microscope as shown below. Figure 1B As shown, Doxorubicin can induce the expression of p21-YFP.
[0123] β-galactosidase staining results are as follows Figure 1C As shown, the addition of Doxorubicin can induce senescence in the LO2-p21-YFP cell line, indicating that a cell senescence model has been successfully constructed.
[0124] Example 2: miR-302b induces senescent cells to regain their proliferative capacity.
[0125] We previously discovered that the miR302 / 367 family is highly expressed in ES and iPS exosomes (Youkun Bi et al. Systemic proteomics and miRNA profile analysis of exosomes derived from human pluripotent stem cells. Stem Cell Res Ther. 2022 Sep 5; 13(1):449.). Subsequent extensive research revealed that stem cell exosomes can induce senescent LO2 cells to return to the cell cycle. To further investigate whether small RNAs in exosomes exhibit this phenomenon, the following experiments were conducted:
[0126] miR-302b mimic was synthesized by Sangon Biotech, prepared into a 20 μM solution, and stored at -20℃ for 6 months.
[0127] The sequence is as follows:
[0128] The sequences of miR-302b-3p and miR-302b-5p are as follows:
[0129] 5'-UAAGUGCUUCCAUGUUUUAGUAG-3', SEQ ID No: 3 and 5'-ACUUUAACAUGGAAGUGCUUUC-3', SEQ ID No: 4;
[0130] LO2 cells were induced to senescence with 50 nM Dox using the method described in Example 1. Figure 2 As observed, after 24 hours of induction, the Dox group cells were significantly larger and fewer in number compared to the control group, and senescent cells were sorted. Adding 7.5 μL of miR-302b mimic (Dox-miR-302b group, final concentration 50 nM) to the Dox-induced senescent cells and culturing for 2 days resulted in a significant increase in cell count compared to the Dox-Vehicle group (control group).
[0131] To verify whether the addition of miR-302b to senescent cells induced proliferation, we induced cell senescence in 35 mm confocol dishes according to the method described in Example 1. Senescent cells were sorted and grouped into two groups: a Dox+PBS group (7.5 μL PBS added to 3 mL of culture medium) and a Dox+320B group (7.5 μL 20 mM miR-302b mimic added to 3 mL of culture medium, bringing the final concentration of miR-302b mimic in the culture medium to 50 nM). We further analyzed the cells using a high-content laser confocal cell imaging system (Opera Phenix, PerkinElmer Enterprise Management, Inc.) live-cell workstation. Figure 3As shown, we tracked the proliferation of single cells after the addition of 50 nM miR-302b mimic. Cellular senescence is defined as a permanent state of cell cycle termination. This implies that the definition of senescent cells will be rewritten; that is, senescent cells do not have a permanent cell cycle termination, but rather a temporary cessation, and the cell cycle can be restored through exogenous factors.
[0132] The miR302 / miR367 family is evolutionarily conserved and expressed in various species, including primates, other mammals, amphibians, and birds. Within the genus *Homo*, the miR302 / miR367 family is divided into miR-302a, miR-302b, miR-302c, miR-302d, miR-302e, miR-302f, and miR-367. Senescent cells were cultured and sorted according to the method described in Example 1. Human miR-302a, miR-302b, miR-302c, miR-302d, miR-302e, miR-302f, and miR-367 were transfected into senescent cells at a dose of 50 nM using a Lipo3000 transfection machine (Thermo Fisher Scientific). Changes in cell viability over time were statistically analyzed. Figure 4 As shown, the cell viability of the control group (normal LO2 cells, Con) was close to 100%, while the initial viability of the Dox-treated group was about 50%, which gradually decreased to about 30% after 48 hours. The transfected miRNA groups showed a gradual increase in viability (miR-302a, miR-302b, miR-302c, miR-302d, miR-302e), or little change in viability without a decrease (miR-302f, miR-367). This suggests that the miR302 / miR367 family has a certain ability to reverse aging.
[0133] The sequence is as follows, and the corresponding double-stranded miRNA mimic is synthesized by Sangon Biotech:
[0134] hsa-miR-302a-5p MIMAT0000683:
[0135] 5'-ACUUAAACGUGGAUGUACUUGCU-3', SEQ ID No: 1;
[0136] hsa-miR-302a-3p MIMAT0000684:
[0137] 5'-UAAGUGCUUCCAUGUUUUGGUGA-3'; SEQ ID No: 2;
[0138] miR-302b-3p_MIMAT0000715:
[0139] 5'-UAAGUGCUUCCAUGUUUUAGUAG-3', SEQ ID No: 3;
[0140] miR-302b-5p_MIMAT0000714:
[0141] 5'-ACUUUAACAUGGAAGUGCUUUC-3', SEQ ID No: 4;
[0142] hsa-miR-302c-5p MIMAT0000716:
[0143] 5'-UUUAACAUGGGGGGUACCUGCUG-3', SEQ ID No: 5;
[0144] hsa-miR-302c-3p MIMAT0000717:
[0145] 5'-UAAGUGCUUCCAUGUUUCAGUGG-3', SEQ ID No: 6;
[0146] hsa-miR-302d-5p MIMAT0004685:
[0147] 5'-ACUUUAACAUGGAGGCACUUGC-3', SEQ ID No: 7;
[0148] hsa-miR-302d-3p MIMAT0000718:
[0149] 5'-UAAGUGCUUCCAUGUUUGAGUGU-3', SEQ ID No: 8;
[0150] hsa-miR-302e MIMAT0005931:
[0151] Forward sequence: 5'-UAAGUGCUUCCAUGCUU-3', SEQ ID No: 9;
[0152] Reverse sequence: 5'-AUUCACGAAGGUACGAA-3', SEQ ID No: 10;
[0153] hsa-miR-302f MIMAT0005932:
[0154] Forward sequence: 5'-UAAUUGCUUCCAUGUUU-3', SEQ ID No: 11;
[0155] Reverse sequence: 5'-AUUAACGAAGGUACAAA-3', SEQ ID No: 12;
[0156] hsa-miR-367-3p MIMAT0000719:
[0157] 5'-AAUUGCACUUUAGCAAUGGUGA-3', SEQ ID No: 13;
[0158] hsa-miR-367-5p MIMAT0004686:
[0159] 5'-ACUGUUGCUAAUAUGCAACUCU-3', SEQ ID No: 14.
[0160] Example 4: miR-302b induces senescent cells to re-enter the cell cycle.
[0161] Cell senescence was induced according to the method in Example 1, and Dox-induced senescent cells were screened by flow cytometry.
[0162] Senescent cells were seeded into plates, with 0.3 × 10⁶ cells per well. 6 For each cell group, 50 nM miR-302b mimic was added to each well in the Dox-miR-302b group and treated for 3 days; for each Dox-PBS group, 5 μl PBS solution was added to each well and treated for 3 days. A normal LO2 cell group (Con) was set up as a control. Cells were collected for cell cycle analysis.
[0163] Specifically, cells were digested with trypsin substitute and centrifuged at 1000×g for 5 min. Cells were washed with 1 mL of pre-chilled physiological saline, centrifuged at 1000×g for 5 min, and the supernatant was carefully aspirated, leaving 50 μl of supernatant to avoid aspirating cells. The bottom of the centrifuge tube was gently tapped to disperse the cells and prevent clumping. 1 mL of pre-chilled 70% ethanol was added, and the mixture was gently pipetted to mix. The cells were fixed at 4°C for 24 hours. After centrifugation at 1000×g for 5 min, the supernatant was discarded, leaving 50 μl of supernatant to avoid aspirating cells. Cells were washed once with 1 mL of pre-chilled physiological saline. 0.5 mL of PI staining solution was added to each sample tube, and the cells were slowly and thoroughly resuspended. The cells were stained at 37°C in the dark for 30 min. After staining, flow cytometry was used for analysis, with an excitation wavelength of 488 nm.
[0164] The preparation of PI staining solution is as follows: 500 μl staining buffer, 25 μl PI staining solution (20×), 10 μl RNase A, and a total volume of 535 μl.
[0165] The results are as follows Figure 5The results showed that approximately 22% of normal LO2 cells (LO2-PBS group) were in S phase, approximately 2% of LO2 cells after Dox-induced senescence were in S phase (LO2-Dox-PBS group), and approximately 8% of senescent LO2 cells after Dox-induced senescence, after addition of miR-302b, were in S phase (LO2-Dox-miR-302 group), significantly higher than the LO2-Dox-PBS group. This is consistent with the aforementioned results, namely that miR-302b can reverse senescence.
[0166] Further, Ki67 staining was performed. Ki67 is a nuclear protein and a marker of cell proliferation. The results are as follows: Figure 6 The results show that the cells in the LO2-Dox-miR-302 group were mostly in a proliferative state, while almost no cells in the LO2-Dox-PBS group were in a proliferative state.
[0167] Example 5: Preparation of systemic expression of mir-302b adeno-associated virus
[0168] (1) The sequences of miR-302b-3p and miR-302b-5p are: 5'-UAAGUGCUUCCAUGUUUUAGUAG-3', SEQ ID No:3 and 5'-ACUUUAACAUGGAAGUGCUUUC-3', SEQ ID No:4, respectively; the designed precursor sequence (WT) is as follows: 5'-GCTCCCTTCAACTTTAACATGGAAGTGCTTTCTGTGACTTTAAAAGTAAGTGCTTCCATGTTTTAGTAGGAGT-3', SEQ ID No:15. The upstream flanking sequence (200bp), the downstream flanking sequence (200bp), and the final synthesized sequence are as follows:
[0169] 5'-
[0170] aaaggaattcaagagttaagaatagtataaatagaagtggctgaagtccctgccttttacccttctggaggagaacacgaatctttgggaactagttcaggaaggtaaaa
[0171] aaatttttttcttctaaagttatgccattttgttttctttctcctcagctctaaatactctgaagtccaaagaagttgtatgttgggtggGCTCCCTTCAACTTTAA
[0172] CATGGAAGTGCTTTCTGTGACTTTAAAAGTAAGTGCTTCCATGTTTTAGTAGGAGTgaatccaatttacttctc
[0173] caaaatagaacacgctaacctcatttgaagggatcccctttgctttaacatgggggtacctgctgtgtgaaacaaaagtaagtgcttccatgtt tcagtggaggtgtctccaagccagcacaccttttgttacaaaatttttttgttattgtgttttaaggttaactaagcttgttacaggtt-3', SEQ ID No:16.
[0174] (2) The AAV vector rAAV-CMV-sfGFP-3×FLAG-WPRE provided by Heyuan Biotechnology Co., Ltd. was used to construct a recombinant vector overexpressing miR-302b. The final synthesized sequence was inserted downstream of the CMV promoter in the expression vector using homologous recombination to construct the recombinant plasmid (see the specific construction method for details). Figure 7 The clones were selected and sent to the company for sequencing. The plasmids that were correctly sequenced were named AAV-miR-302b.
[0175] (3) Transfect HEK293T cells with the recombinant vector constructed in step (2). After 24 hours, cell samples were collected, miRNA was extracted, and the miR-302b content in the cells was determined by real-time quantitative PCR using the tailing method.
[0176] (4) 7×10 6 HEK293T cells / well were seeded in 15cm culture dishes in DMEM containing 10% FBS and incubated at 37°C with 5% CO2 for approximately 24 hours to allow cell confluence to reach 70%–80%. Before transfection, the complete culture medium was replaced with Opti-DMEM. Transfection was performed using the Tubofect transfection reagent. TM Transfection Reagent (Invitrogen, Cat #Transfection was performed according to the instructions for R0532, with the following specific steps: Take a 5 mL DNase / RNase-free centrifuge tube, add 500 μL of Opti-DMEM medium, and add the recombinant expression plasmid rAAV-TBG-miR-302b (20 μg), the serotype plasmid rAAV2 / 8-Rep / Cap (10 μg), and the viral packaging helper plasmid rAAV-Helper (30 μg) to the centrifuge tube. Vortex to mix. Separately, take another 5 mL DNase / RNase-free centrifuge tube, add 500 μL of Opti-DMEM medium, and add 120 μL of Tubofect according to a plasmid-to-transfection reagent ratio of 1:2. Vortex to mix. Mix the two solutions and incubate at room temperature for 15 min. Slowly add the incubated liquid to the prepared HEK293T cells in a concentric circle, gently shaking as you add. Then incubate at 37°C for 5%... CO2 incubator, after 12 hours, replace Opti-DMEM with complete culture medium. See [link to recombinant AAV packaging procedure]. Figure 8 .
[0177] (5) Observe the cell state. During this period, an appropriate amount of complete culture medium can be added to the culture dish. Collect the packaged virus 72 hours after transfection. The specific steps are as follows: Collect the cell supernatant along with the cells into the same centrifuge tube, centrifuge at 2100×g for 10 min at room temperature, then transfer the supernatant to a new centrifuge tube, precipitate with PEG 8000 overnight (add 2.33g NaCl and 8.5g PEG 8000 per 100mL of supernatant). The next day, centrifuge at 3500×g and 4℃ for 30 min, immediately discard the supernatant to prevent virus rehydration, and resuspend in 2mL PBS + 0.001% PF68; resuspend the above centrifuged cell pellet in 2mL PBS + 0.001% PF68, freeze and thaw repeatedly at -80℃ and 37℃ 3 times, and add 2mL 5M NaCl (autoclave); mix the above PEG-precipitated cell supernatant and resuspended cell pellet, and sonicate by shaking (sonicate for 30s, stop for 8-10s), AMPL. Sonicate 3-4 times at 30% concentration. If the sample viscosity decreases, switch to AMPL 20% and sonicate once (the sonication intensity is changed to prevent excessive sonication from affecting viral activity). After sonication, centrifuge the liquid at 3500×g and 4℃ for 30 min, and transfer the supernatant to a new centrifuge tube.
[0178] (6) The AAV prepared by iodixanol gradient centrifugation is as follows: Prepare different concentrations of iodixanol (iodixanol and sterile water are prepared according to the mass / volume ratio (Table 2), and then filtered through a 0.22μm filter membrane); take the autoclaved centrifuge tube, add different concentrations of iodixanol layer by layer, from bottom to top: 4.2mL 60% layer, 5mL 40% layer, 6mL 25% layer, 9mL 15% layer (when adding different concentrations of iodixanol, the centrifuge tube should be tilted to avoid cross-layering, and special attention should be paid to the small density difference between the 15% layer and the 25% layer), and the whole process is carried out in a biosafety cabinet; slowly add the virus prepared in step (5) to the upper layer, balance the centrifuge tube (control the error within 0.01g), prepare a VTi50 rotor, and centrifuge at 48000rpm and 4℃ for 150min.
[0179] Table 2. Preparation of Iodixanol density gradient centrifugation solutions.
[0180]
[0181] (7) After ultrafiltration, puncture the bottom of the ultrafiltration tube with a needle, discard the 2 mL of liquid that drips down, collect the 3rd to 7th mL of liquid, add the collected virus to the double antibody, treat at 37℃ for 1 h, then dilute with PBS + 0.001% PF68 to an appropriate volume, and filter through a 0.22 μm filter membrane for sterilization; transfer the filtrate to a 100 KD ultrafiltration tube, centrifuge at 3500 rpm and 4℃ for 30 min; mix the remaining liquid in the ultrafiltration tube by pipetting, aspirate and transfer to the virus collection tube, wash the concentration tube twice with PBS + 0.001% PF68 150 μL, transfer the remaining liquid to the virus collection tube, label it with the name and date, and store at -80℃ for a long time.
[0182] (8) Take 10 μL of virus for titer determination. Real-time quantitative PCR is a commonly used method for determining the number of purified virus particles. There is a linear relationship between the Ct value of the template and the logarithm of the initial copy number of the template. A standard curve is plotted using a known copy number standard, and then the number of virus particles is calculated. The specific operating steps are as follows: Dilute the virus sample 10 times and prepare a mixture (DNase / RNase-free ddH2O 4μL, DNAasel 1μL, 10×DNAasel Buffer 1μL, virus dilution 4μL), incubate at 37℃ for 30 min, and at 95℃ for 5 min to inactivate DNase; add 1μL proteinase K (5μg / μL), incubate at 37℃ for 30 min, then add 30μL ultrapure water, heat at 95℃ for 5 min to inactivate proteinase K, centrifuge at 12000 rpm for 2 min, and take the supernatant for qPCR detection; take 5μL of the centrifuged supernatant, dilute 10 times, and take 2μL of the dilution as a template for qPCR; calculate the number of virus particles: number of virus particles (VP / mL) = relative value with respect to standard × 1000.
[0183] Example 6: mir-302b reverses aging in mice
[0184] Twenty 24-month-old C57BL / 6 mice were randomly divided into two groups. The mice were administered AAV-miR-302b via tail vein, 50 μl once weekly for two weeks. Results were as follows: Figure 9 As shown, at 30 months of age, compared with the older mouse group, the miR-302b group showed a significant reduction in arched backs and hair loss in older mice, further suggesting that miR-302b has the ability to reverse aging in animals.
[0185] β-gal staining results of multi-organ pathological sections from mice, as shown below. Figure 10 As shown, the aged mouse group showed positive β-gal staining in the lungs, liver, and spleen, and miR-302b treatment significantly alleviated the symptoms.
[0186] Hair follicle H&E staining results as follows Figure 11 As shown, the results indicate that miR-302b treatment alleviated hair follicle atrophy in older mice.
[0187] Animal behavioral experiments: A rotarod test was conducted on animals aged 29-30 months, such as... Figure 12 As shown, mice were placed on a swivel, which was kept at a speed of 25 rpm. The time the mice spent on the swivel was recorded. After four days of training, the experiment was conducted on the fifth day, and the results are as follows. Figure 12 As shown in the left figure, the miR-302b treatment group lasted approximately 65 seconds, significantly longer than the control group's approximately 28 seconds. Further, a grip strength test was conducted; the average of three grip strength tests was divided by body weight, and the tests were performed every two days. The results are as follows... Figure 12 The right figure shows that the miR-302b treatment group was superior to the control group. These results indicate that the miR-302b treatment group experienced significant relief from aging.
[0188] Urine stain test:
[0189] With aging, both mice and humans often experience bladder overactivity, manifesting as urinary frequency, urgency, and with or without urge incontinence. Mice may exhibit small urinary spots (≤5mm in diameter). Each mouse in each group underwent the following procedure: the bedding was removed from the bottom of the cage and dried, and a 12cm × 25cm filter paper was placed and attached to the bottom of the cage. After the mice had acclimatized for two hours, the filter paper was removed and replaced with the same filter paper for recording. During this process, the mice were allowed free access to food but were not given water. Three hours later, the filter paper was removed and photographed using a gel imaging system. The photographic parameters were: ultraviolet reflected light, aperture 85, focal length 50, focus 100, gain 35.03dB, contrast 0, gamma 1.1, and exposure time 1.1s.
[0190] Urine stain image of one mouse from the Aging-PBS group and the Aging+miR-302b group, as shown below. Figure 13 As shown in the figure. Statistical analysis revealed that the number of urine spots in the Aging-PBS group was 46.25 ± 13.75 (N = 4), while the number of urine spots in the Aging+miR-302b group was 10.25 ± 2.66 (N = 4). The statistical graph is shown below. Figure 13 As shown in the right figure, the results show that miR-302b treatment significantly alleviated the symptoms of overactive bladder in aging animals.
[0191] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0192] The embodiments described above are merely illustrative of several implementation methods of this application, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the protection scope of this application. Therefore, the protection scope of this patent application should be determined by the appended claims, and the specification and drawings can be used to interpret the content of the claims.
Claims
1. The application of an active ingredient in the preparation of products that reverse the aging process, wherein the active ingredient is miR-302b. The miR-302b includes miR-302b-3p and miR-302b-5p, the nucleotide sequence of miR-302b-3p is shown in SEQ ID NO:3, and the nucleotide sequence of miR-302b-5p is shown in SEQ ID NO:4; the reversal includes restoring senescent cells to return to the cell cycle and proliferate.
2. The application according to claim 1, characterized in that, The senescent cells are senescent liver cells.
3. Application of the active ingredient in the preparation of products for reversing aging in animals, wherein the active ingredient is miR-302b. The miR-302b includes miR-302b-3p and miR-302b-5p, the nucleotide sequence of miR-302b-3p is shown in SEQ ID NO:3, and the nucleotide sequence of miR-302b-5p is shown in SEQ ID NO:4; the reversal includes restoring senescent cells in an aging animal to return to the cell cycle and proliferate, resulting in the reversal of aging in the aging animal.
4. The application according to claim 3, characterized in that, The aging animals include one or more of the following: humans, cats, dogs, rats, and mice.
5. The application according to claim 3, characterized in that, The senescent cells include senescent liver cells.
6. The application according to any one of claims 1 to 5, characterized in that, The product includes the active ingredients and excipients mentioned above.
7. The application according to claim 6, characterized in that, The dosage forms of the product include one or more of the following: suspension, emulsion, extract, powder, granule, suppository, aerosol, tablet, and capsule.
8. The application according to claim 6, characterized in that, The dosage form of the product includes one or more of injections and oral liquids.