Use of cryzl1 gene / protein as a target in screening drugs for preventing or treating senecavirus infection

Abstract

The application discloses a kind of CRYZL1 The application discloses a kind of CRYZL1 The application discloses a kind of CRYZL1 CRYZL1 CRYZL1 CRYZL1 CRYZ The application discloses a kind of

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a... CRYZL1 The use of genes / proteins as targets in screening drugs for the prevention or treatment of Seneca virus infection. Background Technology

[0002] Seneca virus (formerly known as Seneca Valley virus) was discovered in 2002 by American researchers culturing adenovirus using embryonic retinal cells. When it was first isolated, purified, and analyzed, it was very similar to members of the cardivirus genus and was considered a recombinant virus of cardivirus. However, after in-depth research, it was found that its complete nucleotide sequence and microstructure differed, ultimately classifying it as belonging to the Picornaviridae family, Senecavirus genus. In 2015, the International Committee on Taxonomy of Viruses named it Senecavirus A (SVA). Initially, most research focused on its oncolytic properties; it wasn't until 2007 that Seneca virus was linked to porcine primary vesicular disease, attracting widespread attention in the veterinary field.

[0003] Seneca virus (SVA) infection can cause vesicular disease characterized by diarrhea, lameness, anorexia, and vesicles and erosions around the mouth and nose, and its clinical features are difficult to distinguish from those caused by foot-and-mouth disease virus (FMDV) infection. Since 2014, SVA-induced swine vesicular disease has been reported in the United States, Brazil, China, Thailand, and other countries. SVA infection was first reported in my country in 2015. Studies have shown that pigs are the main host of SVA, and SVA nucleic acid has also been detected in houseflies and mice. Overall, current research on SVA is insufficient; there are no effective treatments or commercially available vaccines for SVA infection, and molecular breeding also lacks original target genes.

[0004] Lens proteins were first discovered in 1894 as structural proteins of the lens. The ζ-lens (Crystallinzeta, CRYZ) is an important member of the lens protein family, first discovered in the lens of guinea pigs. Subsequent studies found that homologous genes encoding CRYZ are widely distributed in animals, plants, and microorganisms (Huang et al., 1987). In 1999, ζ-lens-like 1 (Crystallinzetalike1) was discovered on human chromosome 21q22.1. CRYZL1 It was named CRYZ because of its high resemblance to it. CRYZL1 . CRYZL1The gene is highly expressed in the lungs, brain, heart, and liver (Kimetal., 1999). Currently, regarding... CRYZL1 Research on this topic is scarce. Lim et al. used miRNA microarrays to detect genome-wide miRNA expression profiles and discovered targeted miRNAs. CRYZL1 miRNAs are associated with Down syndrome (Limetal., 2015), but no specific miRNAs have been observed. CRYZL1 Reports related to the prevention and treatment of SVA. Summary of the Invention

[0005] To address the aforementioned shortcomings of the prior art, the present invention provides a... CRYZL1 The use of genes / proteins as targets in screening drugs for the prevention or treatment of SVA infection, through silencing or knocking out. CRYZL1 The gene can effectively inhibit SVA infection.

[0006] To achieve the above objectives, the technical solution adopted by the present invention to solve its technical problem is as follows:

[0007] CRYZL1 The use of genes / proteins as targets in screening drugs for the prevention or treatment of SVA infection, among which, CRYZL1 The gene ID is ENSSCG00000028377.

[0008] CRYZL1 Use of gene / protein expression inhibitors or knockout agents in the preparation of drugs for the prevention or treatment of SVA infection.

[0009] Furthermore, drugs for the prevention or treatment of SVA infection have at least one of the following functions:

[0010] A1) Inhibit SVA endocytosis;

[0011] A2) Inhibits SVA growth or proliferation;

[0012] A3) Inhibit SVA invasion.

[0013] Furthermore, CRYZL1 Gene / protein expression inhibitors or knockout agents are at least one of nucleic acid molecules, small molecule compounds, peptides, proteins, gene editing vectors, lentiviruses, or adeno-associated viruses.

[0014] Furthermore, suppress CRYZL1 Gene expression, silencing, or knockout CRYZL1Genes can be manipulated using techniques known to those skilled in the art, such as gene mutation, gene silencing, gene knockout, gene editing, or gene knockdown. For example, RNA interference (RNAi) technology can be used to specifically eliminate or shut down the expression of a particular gene; gene editing tools can include, but are not limited to, CRISPR / Cas9 technology, zinc finger nucleases (ZFNs), or transcription activator-like effector nucleases (TALENs).

[0015] Furthermore, CRYZL1 Gene / protein expression inhibitors or knockout agents, including targeted knockouts CRYZL1 sgRNA of genes / proteins, or silencing and repression CRYZL1 siRNA for gene expression.

[0016] Furthermore, sgRNA is a double-stranded fragment formed by the annealing of sgRNA-F and sgRNA-R, and its target sequence is: GAGAAGGATTTCTTTCCTGT;

[0017] The sequences of sgRNA-F and sgRNA-R are as follows:

[0018] sgRNA-F: 5'-CACCGAGAAGGATTTCTTTCCTGT-3';

[0019] sgRNA-R: 5'-AAACACAGGAAAGAAATCCTTCTC-3'.

[0020] Furthermore, siRNA is CRYZL1 -si256-F / R、 CRYZL1 -si415-F / R or CRYZL1 -si526-F / R.

[0021] A combination of drugs for the prevention or treatment of SVA infection, comprising the above-mentioned... CRYZL1 Gene / protein expression inhibitors or knockout agents; or a combination of the above inhibitors and endocytosis inhibitors.

[0022] Furthermore, the endocytosis inhibitors are CPZ or EIPA.

[0023] CRYZL1 The use of genes in the preparation of formulations for breeding SVA-resistant pig breeds.

[0024] CRYZL1 Use of the gene in the preparation of formulations for the improvement of germplasm resources in SVA-related disease-resistant pig breeds.

[0025] The beneficial effects of this invention are:

[0026] This invention involves knocking out cells in cell lines. CRYZL1 Gene analysis revealed that the cell line showed significant resistance to SVA infection. Attached Figure Description

[0027] Figure 1 To knock down CRYZL1 Post-IBRS-2 cells CRYZL1 Changes in mRNA and SVA viral RNA copy number;

[0028] Figure 2 To knock down CRYZL1 Expression of SVA viral proteins after infection;

[0029] Figure 3 This is a structural diagram of a three-plasmid system;

[0030] Figure 4 for CRYZL1 Schematic diagram of gene-targeting cell line sequencing;

[0031] Figure 5 for CRYZL1 DNA sequencing of knockout cell lines and CRYZL1 mRNA detection results;

[0032] Figure 6 for CRYZL1 -Cell morphology diagram of KO1 cells after infection with SVA virus;

[0033] Figure 7 for CRYZL1 -Results of detection of viral RNA copy number and viral protein in KO1 cells after infection with SVA virus;

[0034] Figure 8 To knock out CRYZL1 Effects on viral adsorption and internalization;

[0035] Figure 9 The effect of inhibitor treatment on the endocytic pathway of SVA;

[0036] Figure 10 After treatment with inhibitors CRYZL1 -Infection status of SVA in KO1 cells;

[0037] Figure 11 To knock out CRYZL1 The influence of genes on the viral endocytosis pathway mediated by macropinocytosis;

[0038] Figure 12 To knock out CRYZL1 The influence of genes on the clathrin-mediated viral endocytosis pathway. Detailed Implementation

[0039] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0040] Example 1 Suppression CRYZL1 The effect of gene expression on SVA infection

[0041] 1. Synthesis of siRNA

[0042] According to the gene number ENSSCG00000028377 CRYZL1 Genetically designed and synthesized CRYZL1 -si256、 CRYZL1 -si415、 CRYZL1 -si526 interference sequence, the specific sequence is shown in Table 1.

[0043] Table 1 siRNA sequences

[0044]

[0045] 2. Inhibition CRYZL1 The effect of gene expression on SVA infection

[0046] Wild-type IBRS-2 cells were seeded in 12-well plates and transfected when the cell density reached 60%-70%. CRYZL1 -siRNA and CRYZL1 -siNC, and after 36 hours, cells in each group were infected with SVA (MOI=1). Total RNA was extracted 12 hours after viral infection and detected by qRT-PCR. CRYZL1 The relative mRNA content and viral RNA copy number were used. GAPDH was used as an internal reference gene. The horizontal axis represents different interfering sequences, and the vertical axis represents... CRYZL1 Or the relative content of SVA mRNA. Statistical analysis was performed using one-way ANOVA, and the results are shown below. Figure 1 Where A represents knockdown. CRYZL1 after CRYZL1 The relative content of mRNA; Figure B shows the knockdown. CRYZL1 The subsequent viral RNA copy number detection results, * represents p <0.05, ** represents p <0.01, *** represents p <0.001.

[0047] like Figure 1 As shown, knockdown in IBRS-2 cells CRYZL1 It will decrease CRYZL1 The relative content of mRNA CRYZL1 -si256、 CRYZL1 -si415、 CRYZL1 -si526 can all achieve this CRYZL1 Knock down, knock down CRYZL1 Subsequently, the viral RNA copy number also decreased significantly.

[0048] 3. SVA VP2 protein content detection

[0049] The expression of SVA VP2 protein in the cell samples treated in step 2 was detected, and the results are as follows: Figure 2 As shown, in knocking down CRYZL1 Following gene expression reduction, SVA VP2 protein expression also decreased significantly, indicating that... CRYZL1 It plays an important role in the process of SVA infection of IBRS-2 cells.

[0050] Example 2 CRYZL1 Construction of gene knockout cell lines

[0051] 1. This invention uses the CRISPR-PB vector system (see...). Figure 3 This system contains three plasmids: the piggyBac transposon backbone vector pSg4 (containing the puro resistance gene) with sgRNA, the plasmid pPBase that transiently expresses the PB transposase, and the plasmid pS10 (containing the neo resistance gene) that expresses the Cas9-flag protein induced by doxorubicin.

[0052] 2. Based on the gene number ENSSCG00000028377 CRYZL1 Genes were designed with sgRNA-F / R sequences: sgRNA-F: 5'-CACCGAGAAGGATTTCTTTCCTGT-3'; and sgRNA-R: 5'-AAACACAGGAAAGAAATCCTTCTC-3'.

[0053] During synthesis, we added the corresponding sticky ends of the endonuclease Bbs I. After obtaining the sequence, we annealed the two single strands of sgRNA to form a double strand. The annealing reaction system is shown in Table 2, and the reaction procedure is shown in Table 3.

[0054] Then, it is ligated with the BbsI-digested vector backbone pSg4. The ligation reaction system is shown in Table 4. The digestion reaction conditions are: overnight in a metal bath at 16°C. When the ligated PCR fragment is small, the ligation time can be shortened. During the ligation reaction, the molar ratio of vector backbone DNA to insert fragment DNA is generally 1:2-10.

[0055] Finally, the ligated vector was sequenced for verification, yielding the CRISPR targeting vector containing the host gene. Simultaneously, a pair of verification primers were designed and synthesized approximately 250 bp flanking the sgRNA sequence. CRYZL1 -F: 5'-TTGGATCTGGTGTCACTGTGG-3'; CRYZL1 -R:5'-GAGCAAA GTGATTCAGGCTTACA-3' is used to verify the targeting of the host gene.

[0056] Table 2 sgRNA annealing reaction system

[0057]

[0058] Table 3 sgRNA annealing reaction procedure

[0059]

[0060] Table 4 Connection Reaction System

[0061]

[0062] 3. 1.5 μg of Psg4 plasmid, 1.5 μg of pS10 plasmid, and 1 μg of pPBase plasmid were transfected into two wild-type IBRS-2 cells using liposome transfection. Simultaneously, plasmids expressing green fluorescence were also transfected. To remove untransfected cells, 24 h after transfection, cells were treated with a medium containing 2 μg / mL puromycin and 4 μg / mL doxorubicin. Puromycin was used to select for positively transfected cells, and doxorubicin induced Cas9 protein expression, thus targeting the target gene.

[0063] Cells screened with puromycin were recultured, and the genome was extracted approximately one week later for PCR amplification and DNA sequencing to determine the knockout status of candidate genes. The results are shown below. Figure 4 This indicates that the system was successfully constructed. CRYZL1 Gene knockout system.

[0064] 4. Pick CRYZL1 The knockout IBRS-2 monoclonal cell line was revived in 10 cm dishes and then cultured in medium containing 4 μg / mL puromycin. CRYZL1 The mixed target cell lines were cultured for 36 hours, then replaced with puromycin-free growth medium. After approximately one week of culture, distinct monoclonal cell spots appeared in 10 cm dishes. Monoclonal cells were picked using a cloning loop and sequenced for verification, yielding [the desired cell line]. CRYZL1 Gene knockout IBRS-2 monoclonal cell line CRYZL1 -KO1, results see Figure 5Where A is CRYZL1 -KO1 genome sequencing results: green sequence represents sgRNA target sequence; blue sequence represents PAM sequence; red region represents gene mutation status. Figure B shows... CRYZL1 -KO1 cells CRYZL1 mRNA expression status.

[0065] like Figure 5 As shown, the present invention successfully obtained CRYZL1 Gene knockout IBRS-2 monoclonal cell line CRYZL1 -KO1, CRYZL1 Both strands of -KO1 underwent mutations; one strand lost 3 bases and gained 1 base, while the other strand lost 24 bases. Furthermore, according to the detection results in Figure B, CRYZL1 Gene knockout significantly reduced its mRNA expression level. CRYZL1 -KO2 has an additional base on both chains.

[0066] Example 3 CRYZL1 Disease resistance detection of gene knockout cell lines

[0067] 1. CRYZL1 -KO1 disease resistance test

[0068] (1) Wild-type cells and CRYZL1 -KO1 cells were seeded in 12-well plates and infected with SVA at 80% confluence (MOI=1) when the cell density reached 90%. Wild-type cells and... CRYZL1 - KO1 cell morphology, results are shown in […]. Figure 6 .

[0069] like Figure 6 As shown, wild-type cells developed significant CPE 24 h after viral infection, while CRYZL1 -KO1 cells showed no significant CPE.

[0070] (2) Infecting wild-type IBRS-2 cells with SVA and CRYZL1 -KO1 cells were collected, and cell samples were collected 6 h and 12 h after viral infection. Total RNA and total protein were extracted, and viral RNA copy number and VP2 protein expression were detected. Results are shown in […]. Figure 7 In the figure, A and B show the results of viral RNA copy number detection 6 h and 12 h after viral infection, respectively. C shows the expression of VP2 protein 12 h after viral infection.

[0071] like Figure 7 As shown, compared with wild-type cells, CRYZL1-KO1 cells showed significantly reduced intracellular viral RNA copy numbers and significantly reduced expression of viral VP2 protein at 6 h and 12 h after viral infection, indicating that... CRYZL1 Knockout cell lines can resist SVA infection.

[0072] (3) Wild-type IBRS-2 cells and CRYZL1 -KO1 cells were seeded in 12-well plates. When the cell density reached 80%-90%, each group of cells was infected with SVA (MOI = 10). After incubation at 4℃ for 1 h, the virus adsorption was measured. After incubation at 37℃ for 30 min, the virus internalization was measured. The virus adsorption results are as follows: Figure 8 As shown in Figure A, compared to wild-type cells... CRYZL1 The relative amount of viral RNA adsorbed on the cell surface was not significantly affected after knockout. Viral internalization results are as follows: Figure 8 As shown in B, CRYZL1 The relative content of viral RNA in the cell was significantly reduced after knockout.

[0073] (4) IBRS-2 cells were seeded into 12-well plates. When the cell density reached 60%-70%, the cells were... CRYZL1 -si526 and CRYZL1 -siNC was transfected into cells, and after 36 h of transfection, cells in each group were infected with SVA (MOI = 10). After incubation at 37°C for 30 min, viral internalization was assessed. Results are as follows: Figure 8 As shown in C, knock down CRYZL1 It also affected the internalization of the virus.

[0074] Example 4 CRYZL1 Impact of knockout on SVA internalization

[0075] 1. Determine the endocytosis pathway

[0076] IBRS-2 cells were seeded in 12-well plates. When the cell density reached 80%-90%, the cells were treated with DMSO or 50 nM MBCD (cryptin-mediated endocytosis inhibitor), CPZ (clathrin-mediated endocytosis inhibitor), or EIPA (macropinocytosis-mediated endocytosis inhibitor) for 6 h. Cells were then infected with SVA (MOI = 10) and incubated at 37°C for 30 min. Cell samples were collected, total RNA was extracted, and the relative viral RNA content was detected by qRT-PCR. GAPDH was used as an internal control gene. The x-axis represents different inhibitors, and the y-axis represents the relative SVA mRNA content. Results are shown in [Figure number missing]. Figure 9 .

[0077] like Figure 9As shown, compared with wild-type cells, MBCD treatment did not affect viral internalization, while CPZ and EIPA treatments significantly reduced the relative content of intracellular viral RNA, inhibiting viral internalization. This study is the first to discover that SVA infects host cells via two pathways: clathrin-mediated endocytosis and macropinocytosis-mediated endocytosis.

[0078] The effects of different inhibitors, MBCD, CPZ, and EIPA, on SVA infection were also examined. Results are as follows: Figure 10 As shown, consistent with the results of viral internalization, MBCD treatment did not affect viral infection, while CPZ and EIPA treatments significantly reduced the intracellular viral RNA copy number and inhibited viral infection.

[0079] 2. CRYZL1 Effects on macropinocytosis-mediated viral endocytosis pathway

[0080] Wild-type IBRS-2 cells and CRYZL1 -KO1 cells were seeded in 24-well plates. When the cell density reached 80%-90%, each group of cells was infected with a mixture of 250 μg / mL FITC-Dextran and SVA (MOI = 10). After incubation at 37℃ for 30 min, the culture medium was discarded, and the endocytosis of Dextran was observed by immunofluorescence. The results are shown in the table below. Figure 10 In the image, DAPI staining of cell nuclei shows a blue signal, while Dextran shows a green signal. The Merge group is an overlay of DAPI and GFP images, with a scale bar of 400 pum.

[0081] like Figure 10 As shown, compared with wild-type cells, CRYZL1 The green fluorescence signal was significantly reduced after knockout, which indicates that... CRYZL1 This affected Dextran's endocytosis, indicating CRYZL1 It can affect the viral endocytosis pathway mediated by macropinocytosis.

[0082] 3. CRYZL1 Impact on clathrin-mediated viral endocytosis pathway

[0083] wild-type IBRS-2 cells and CRYZL1 -KO1 cells were seeded in 24-well plates. When the cell density reached 80%-90%, each group of cells was infected with a mixture of 50 μg / mL Bio-Transferrin and SVA (MOI=10). After incubation at 37%C for 30 min, the culture medium was discarded. Immunofluorescence was performed using streptavidin, a fluorescently conjugated compound, to observe the endocytosis of Transferrin. The results are shown in [Figure number missing]. Figure 11In the image, DAPI staining of cell nuclei shows a blue signal, while Dextran shows a green signal. The Merge group is an overlay of DAPI and GFP images, with a scale bar of 400 pum.

[0084] like Figure 11 As shown, compared with wild-type cells, CRYZL1 The significant decrease in green fluorescence signal after knockout indicates that Transferrin's endocytosis was affected, suggesting... CRYZL1 It affected the clathrin-mediated viral endocytosis pathway.

[0085] Finally, it should be noted that the above specific embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to examples, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications and substitutions should be covered within the scope of the claims of the present invention.

Claims

1. CRYZL1 Use of gene / protein expression inhibitors or knockout agents in the preparation of medicaments for the prevention or treatment of SVA infection, wherein the CRYZL1 gene / protein expression inhibitors or knockout agents include targeted knockout. CRYZL1 sgRNA of genes / proteins, or silencing and repression CRYZL1 siRNAs for gene expression; The sgRNA is a double-stranded fragment formed by annealing sgRNA-F and sgRNA-R, and its target sequence is: GAGAAGGATTTCTTTCCTGT; in, The sequences of sgRNA-F and sgRNA-R are as follows: sgRNA-F: 5'-CACCGAGAAGGATTTCTTTCCTGT-3'; sgRNA-R: 5'-AAAC ACAGGAAAGA AATCCTTCTC-3'; The siRNA is CRYZL1 -si256-F / R、 CRYZL1 -si415-F / R or CRYZL1 -si526-F / R, its sequence is as follows: CRYZL1 -si256-F:5’-CATGGATGGCCCTCGGCAAG-3’; CRYZL1 -si256-R:5'-UAUUUAUCUGGCUCAGAGCTT-3'; CRYZL1 -si415-F:5’-GCCUACACAGCUCUGCAUUTT-3’; CRYZL1 -si415-R:5'-AAUGCAGAGCUGUGUAGGCTT-3'; CRYZL1 -si526-F:5’-GGAGCCAAAGUGCUUUCAATT-3’; CRYZL1 -si526-R:5’-UUGAAAGCACUUUGGCUCCTT-3’。 2. The use according to claim 1, characterized in that, The drug for preventing or treating SVA infection has at least one of the following functions: A1) Inhibit SVA endocytosis; A2) Inhibits SVA growth or proliferation; A3) Inhibit SVA invasion.

3. A pharmaceutical composition for the prevention or treatment of SVA infection, characterized in that, Including targeted knockout CRYZL1 sgRNA of genes / proteins, or silencing and repression CRYZL1 siRNAs for gene expression; The sgRNA is a double-stranded fragment formed by annealing sgRNA-F and sgRNA-R, and its target sequence is: GAGAAGGATTTCTTTCCTGT; The sequences of sgRNA-F and sgRNA-R are as follows: sgRNA-F: 5'-CACCGAGAAGGATTTCTTTCCTGT-3'; sgRNA-R: 5'-AAAC ACAGGAAAGA AATCCTTCTC-3'; The siRNA is CRYZL1 -si256-F / R、 CRYZL1 -si415-F / R or CRYZL1 -si526-F / R, its sequence is as follows: CRYZL1 -si256-F:5’-CATGGATGGCCCTCGGCAAG-3’; CRYZL1 -si256-R:5'-UAUUUAUCUGGCUCAGAGCTT-3'; CRYZL1 -si415-F:5’-GCCUACACAGCUCUGCAUUTT-3’; CRYZL1 -si415-R:5'-AAUGCAGAGCUGUGUAGGCTT-3'; CRYZL1 -si526-F:5’-GGAGCCAAAGUGCUUUCAATT-3’; CRYZL1 -si526-R:5’-UUGAAAGCACUUUGGCUCCTT-3’。

Images