S-LAM-PCR library building method and application thereof

Abstract

The invention discloses an S-LAM-PCR library building method and application of the S-LAM-PCR library building method. According to the S-LAM-PCR library building method provided by the invention, the preference of enzyme digestion interruption is overcome by using ultrasonic interruption, the test period is shortened by using the PCR amplification kit and reducing the linear amplification cycle number, and the sensitivity of the method is improved by linear amplification and two rounds of nested PCR.

Description

Technical Field

[0001] The present invention relates to the field of gene and cell therapy products, and in particular, to an S-LAM-PCR library construction method and application thereof. Background Art

[0002] Lentivirus vector (LV) is one of the most widely used gene therapy viral vectors in clinical trials. Lentivirus is a genus of retrovirus, a diploid RNA virus, and is called lentivirus because of its long incubation period. Studies have shown that LV prefers to integrate into the introns and downstream regions of transcriptionally active genes; it has a certain preference for the transcription units of transcriptionally active genes, but does not include the transcription start site (TSS); the preference of LV integration sites will also change with the activity state of the transduced cells. For example, LV can be integrated into the active transcription units of CD4+T cells in both resting and activated states, but the integration sites of CD4+T cells in activated states are more common in gene-dense, CpG island-dense, and G / C base-rich genomic regions; there are also differences in integration between dividing and non-dividing rodent cells. Compared with non-dividing cells, the integration of self-inactivating (SIN) vectors in dividing cells occurs preferentially in gene coding regions. LV has shown high efficiency and safety in gene therapy, but the characteristics of semi-random integration can still cause unpredictable insertion mutations. Due to the complex biological composition and special mechanism of action, the mediated genetic toxicity of gene therapy products using lentiviral vectors as delivery vectors is different from traditional genetic toxicity. It is mainly the risk of gene mutation, gene inactivation / activation, or carcinogenesis caused by integration and insertion. Therefore, its safety evaluation cannot fully adopt the traditional toxicology methods of chemical drugs.

[0003] Integration site analysis (ISA) can accurately locate insertions in the genome, providing a tool for evaluating longitudinally modified genes and the clonality of transplanted cell populations. This technology has become the main benchmark for integration vector systems to determine safety and track integration sites. Initially, viral vector integration site analysis was performed by separating and amplifying by TaqMan real-time fluorescence quantitative PCR, and the obtained amplified products were used for molecular hybridization experiments to analyze the characteristics of the integration site. Due to the rapid development of PCR and sequencing technology, molecular hybridization technology with complex operations and low sensitivity has gradually been replaced, and next-generation sequencing (Next-generation Sequencing, NGS) has gradually become the mainstream integration site analysis technology. According to different PCR technology routes, there are mainly inverse PCR, ligation-mediated (LM) PCR, and linear amplification mediated (LAM) PCR. LM-PCR has the disadvantages of low sensitivity and easy loss of target fragments when facing complex sample templates. Summary of the invention

[0004] The present invention aims to establish a high-sensitivity lentiviral vector integration site analysis method. Compared with other analysis methods, the experimental cycle is shortened, the sensitivity is greatly improved, and complex and trace samples can be analyzed.

[0005] The present invention adopts the following technical solution:

[0006] In one aspect, the present invention provides a method for analyzing the integration site of a lentiviral vector, the method comprising the following steps:

[0007] a) fragmenting a host DNA to obtain linear nucleic acid fragments, wherein the host DNA includes at least one insertion site to be detected;

[0008] b) linearly amplifying the linear nucleic acid fragment described in a) using a biotin-labeled primer to obtain a linear amplified fragment;

[0009] c) capturing the linear amplified fragment in b) and then performing second strand synthesis to obtain a double-stranded synthesis product;

[0010] d) repairing the ends of the double-stranded synthetic product obtained in c) and adding A, and connecting a linker to obtain a connection product;

[0011] e) performing a first round of PCR on the ligated product in d) using a set of primers and an adapter primer to obtain a first round of PCR product;

[0012] f) Performing a second round of PCR on the first round PCR product using another set of primers and linker primers to obtain the second round PCR product and establish a library.

[0013] In some embodiments, the method further comprises:

[0014] g) adding specific indexes to the second-round PCR products in f), wherein the specific indexes are P5 and P7, and performing a third-round PCR amplification using primers complementary to the adapter to obtain third-round PCR products, and establishing a sequencing library; the third-round PCR products are preferably purified using magnetic beads.

[0015] In some embodiments, the nucleotide sequence of P5 is AGGCGAAG.

[0016] In some embodiments, the nucleotide sequence of P7 is CAGGACGT.

[0017] In some embodiments, ultrasound is used to fragment the host DNA in a).

[0018] In some embodiments, the method fragments the host DNA into fragments of 200-500 bp.

[0019] In some embodiments, the method fragments the host DNA into 200-300 bp.

[0020] In some embodiments, the biotin-labeled primer in b) is 5-LTR1-R, and the 5-LTR1-R has a nucleotide sequence as shown in SEQ ID NO:2.

[0021] Biotin-labeled primers are a commonly used tool in molecular biology experiments that can be used to detect, locate, and separate specific nucleic acids or proteins. The principle of biotin-labeled primers is to use the highly specific binding between biotin and avidin. Biotin is a small molecule compound that belongs to the same B vitamin group as vitamin H. Biotin-labeled primers are usually prepared by adding biotin molecules to the end (e.g., 5' end) or inside the primer, so that a stable binding is formed between the primer and biotin.

[0022] In some embodiments, the linear amplification is for 40-60 cycles.

[0023] In some embodiments, the linear amplification is performed for 50 cycles.

[0024] In some embodiments, streptavidin magnetic beads are used to capture the linear amplified fragments in b) in c); and / or, random primers are used for the second strand synthesis.

[0025] In some embodiments, the linker in d) is a Y-shaped asymmetric linker. Commercially available Y-shaped linkers can be used.

[0026] In some embodiments, the primer in e) is 5-LTR1-R, and the 5-LTR1-R has a nucleotide sequence as shown in SEQ ID NO: 2; and / or,

[0027] e) The linker primer is YN-4, and the YN-4 has the nucleotide sequence shown in SEQ ID NO:3.

[0028] In some embodiments, the first round of PCR amplification is 20-50 cycles.

[0029] In some embodiments, the first round of PCR amplification is performed for 35 cycles.

[0030] In some embodiments, the primer in f) is 5-LTR2-R, and the 5-LTR2-R has a nucleotide sequence as shown in SEQ ID NO:4; and / or,

[0031] In the method f), the linker primer is YN-5, and the YN-5 has a nucleotide sequence as shown in SEQ ID NO: 5; and / or,

[0032] f) wherein the second round of PCR products further comprises purification using magnetic beads.

[0033] Magnetic bead purification: After adding the adapter, the library system contains various enzymes such as polymerase, ligase, and auxiliary substances. The addition of adapters is also excessive. Due to the instability of the ends, self-ligated fragments are easily formed. There may also be large fragments in the fragments interrupted by the shotgun method. Therefore, special magnetic beads (AMPure XP Beads) are needed for purification to remove large fragments and various impurities, so as to obtain library fragments with successful addition of adapters.

[0034] In some embodiments, the second round of PCR amplification is for 5-10 cycles.

[0035] In some embodiments, the second round of PCR amplification is performed for 8 cycles.

[0036] In some embodiments, the method comprises the steps of:

[0037] a) extracting host genomic DNA, and using an ultrasonic fragmentor to fragment the genomic DNA into fragments of 200 to 500 bp;

[0038] S200. Using the fragmented genome of step S100 as a template, linear amplification biotinylated primer 5-LTR1-R was used for 50 cycles to enrich the integrated target sequence for the first time;

[0039] S300. Using streptavidin magnetic beads to capture the linear amplification product of step S200, and using random primers to synthesize the second strand;

[0040] S400. Performing end repair and A addition on the second strand synthesis product of step S300, and connecting to a Y-shaped asymmetric linker;

[0041] S500. Using the product of step S400 as a template, using the first-round biotinylated primer 5-LTR1-R and the adapter primer YN-4, the target sequence is enriched and integrated for the second time;

[0042] S600. Using the PCR product of step S500 as a template, using the second round primer 5-LTR2-R and the adapter primer YN-5, the target sequence is enriched and integrated for the third time;

[0043] S700. Introducing a sequencing primer binding sequence into a sequencing platform;

[0044] S800. Sequencing the PCR product of step S700;

[0045] S900. Determine the integration event of the lentiviral vector based on the sequencing data.

[0046] Another aspect of the present invention provides a method for analyzing integration sites of lentiviral vectors, the method comprising:

[0047] Providing a sequencing library obtained by the above method;

[0048] Performing high-throughput sequencing on the sequencing library to obtain sequencing data;

[0049] The sequencing results are compared with the original sequence of the host DNA to determine the integration site of the modified nucleic acid in the host DNA.

[0050] The application of the integration site analysis of the above-mentioned lentiviral vector is used to evaluate the safety of gene and cell therapy drugs that use lentiviral vectors as delivery vectors.

[0051] In some embodiments, the high-throughput sequencing is to input the sequencing library into an Illumina sequencer for high-throughput sequencing.

[0052] In some embodiments, the safety of gene and cell therapy drugs delivered by lentiviral vectors is determined based on the identified integration sites.

[0053] The judgment criteria are as follows: when integrated into a proto-oncogene, it is judged to have a high risk of mutation; when integrated into the gene, nearby, or in the exon region, it is judged to have an integration risk.

[0054] On the basis of being in accordance with the common sense in the art, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.

[0055] The reagents and raw materials used in the present invention are commercially available.

[0056] The positive and progressive effects of the present invention are:

[0057] Through the above technical scheme, the integration site analysis method provided by the present invention overcomes the preference of enzyme cleavage by using ultrasonic interruption, uses a PCR amplification kit and reduces the number of linear amplification cycles to shorten the test period, and linear amplification and two-round nested PCR improve the sensitivity of the method, and the WHO NIBSC standard is used to verify the method. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1 This is a picture of the effect of ultrasonic interruption of U-87MG cell gene.

[0059] Figure 2 The results of U-87MG cell genome library construction using the LAM-PCR method.

[0060] Figure 3 This is a statistical diagram of integration site function.

[0061] Figure 4 This is a diagram of integration site diversity.

[0062] Figure 5 This is a statistical diagram of the integration site distribution.

[0063] Figure 6 To integrate the preference analysis diagram. DETAILED DESCRIPTION

[0064] The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. The experimental methods in the following examples without specifying specific conditions are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0065] Example 1: Sample Accuracy Experiment

[0066] Analysis of integration sites in the genome of human astrocytic glioblastoma cells (U-87MG) transduced with lentiviral vectors

[0067] The gene site for lentiviral vector integration is PCDH1 gene;

[0068] The italics are LTR sequences, the bold underlines represent primer binding sites, and the rest are undifferentiated PCDH1 gene sequences.

[0069] 1. Ultrasonic disruption of U-87MG genome

[0070] The U-87MG cell genome was ultrasonically fragmented at 250 bp / 130 μL, and the ultrasonic fragmentation effect was analyzed by Qsep100 fragment analyzer. Figure 1 As shown, the fragment sizes were normally distributed, mainly concentrated in the range of 200 to 300 bp.

[0071] 2. Linear Amplification

[0072] use PCR SuperMix (-dye) kit was used for linear amplification, the sample template starting amount was 5 μL, the primer 5-LTR1-R nucleotide sequence was 5'-TTAGCCAGAGAGCTCCCAGG-3' (SEQ ID NO: 2), and the reaction system was shown in Table 1:

[0073] Table 1 Reaction system

[0074] name Volume (μL) Template DNA 5μL SuperMix(-dye) 25μL Primer 5-LTR1-R (0.5 pmol / μL) 0.5μL <![CDATA[ddH2O]]> 19.5μL Total 50μL

[0075] The reaction procedure is shown in Table 2:

[0076] Table 2 Reaction procedure

[0077] Number of cycles transsexual annealing polymerization Hold 1 95℃,5min 2-51 95℃,1min 60℃，45s 72℃，90s 52 72℃,10min hold 4℃

[0078] 3. Double-stranded synthesis

[0079] The linear amplification product of the previous step was captured using streptavidin magnetic beads, and double-stranded synthesis was performed using random primers to obtain a DNA microbead complex. The reaction system is shown in Table 3:

[0080] Table 3 Reaction system

[0081] name volume <![CDATA[ddH2O]]> 16.5μL 10× Hexanucleotide Mix 2μL dNTP (200 μmol) 0.5μL Klenow polymerase (2U / μL) 1μL DNA microbead complex

[0082] Incubate the reaction in a metal bath / PCR machine at 37°C for 1 h (close to 1 h but should not exceed 1 h).

[0083] 4. End repair / addition of A

[0084] Using Hieff The DNA Library Prep Kit performs end repair and A addition on the double-stranded synthetic product, and connects to a Y-shaped asymmetric adapter. When preparing, thaw each reagent, mix well, and place on ice for later use. The reaction system is shown in Table 4:

[0085] Table 4 Reaction system

[0086] Element 60μL DNA microbead complex 3μL Endprep Buffer 7μL Endprep Enzyme 3μL <![CDATA[ddH2O]]> to 60μL

[0087] The end repair / addition A reaction program is shown in Table 5:

[0088] Table 5 Reaction procedure

[0089] temperature time Heating cover 105℃ On 30℃ 30min 72℃ 30min 4℃ Hold

[0090] 5. Connector connection

[0091] The preparation of the linker connection reaction system is shown in Table 6:

[0092] Table 6 Reaction system

[0093] name Volume (μL) dA-tailed DNA 60 Connectivity enhancers 30 DNA adapter 5 Fast T4 DNA Ligase 10 <![CDATA[ddH2O]]> 5 total 110

[0094] The linker ligation reaction procedure is shown in Table 7:

[0095] Table 7 Reaction procedure

[0096] temperature time Heating cover 105℃ On 20℃ 15min 4℃ Hold

[0097] 6. First round of nested PCR

[0098] After the adapter connection was completed, the first round of nested PCR amplification (nested PCR 1) was performed, the nucleotide sequence of the adapter primer YN-4 was ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 3), and the reaction system was shown in Table 8:

[0099] Table 8 Reaction system

[0100] name Volume (μL) Template DNA 2μL SuperMix(-dye) 25μL Primer 5-LTR1-R (50 pmol / μL) 0.5μL Adapter primer YN-4 (50pmol / μL) 0.5μL <![CDATA[ddH2O]]> 22μL Total 50μL

[0101] The reaction procedure is shown in Table 9 below:

[0102] Table 9 Reaction procedure

[0103]

[0104]

[0105] 7. Second round of nested PCR

[0106] After nested PCR 1 was completed, the amplified product was used to perform the second round of nested PCR amplification (nested PCR 2). The nucleotide sequence of primer 5-LTR2-R was GATCTGGTCTAACCAGAGAG (SEQ ID NO: 4), the nucleotide sequence of linker primer YN-5 was GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCGATCTGGTCTA ACCAGAGAG (SEQ ID NO: 5), and the reaction system and reaction procedure were the same as nested PCR 1.

[0107] The products after the second round of nested PCR amplification were purified using magnetic beads according to the instructions for common magnetic bead purification.

[0108] The targets were detected using Qsep100 biological fragment analyzer.

[0109] The third round of PCR plus Index

[0110] The second round of nested PCR amplification products purified by magnetic beads were added with specific indexes (P5 and P7), the nucleotide sequence of P5 was AGGCGAAG, and the nucleotide sequence of P7 was CAGGACGT, and the third round of PCR amplification was performed.

[0111] The reaction system is shown in Table 10.

[0112] Table 10 Reaction system

[0113]

[0114] The reaction procedure is shown in Table 11 below:

[0115] Table 11 Reaction procedure

[0116] Number of cycles transsexual annealing polymerization Hold 1 98℃，45s 8 98℃，15s 60℃，30s 72℃，30s 1 72℃,1min Hold 4℃

[0117] The product after the third round of PCR amplification was purified using magnetic beads, and the purified DNA fragments were extracted to form a sequencing library.

[0118] Experimental results:

[0119] The results of LAM-PCR method for U-87MG cell genome library construction are shown in Figure 2 After two rounds of nested PCR amplification of the U-87MG cell genome, the size of the U1 fragment of the U-87MG cell genome in the experimental group was within the expected target range, concentrated at 339-695 bp, and the main peak was obvious; the negative control group N1 used enzyme-free water as a template, and no amplification product was found. After the LAM-PCR method was successfully used to build the library, NGS sequencing and bioinformatics analysis were performed.

[0120] 9. NGS sequencing

[0121] The sequencing library was put into Illumina sequencer for NGS sequencing.

[0122] 10. Bioinformatics Analysis

[0123] The sequencing result is compared with the original sequence of the host DNA to determine the integration site of the modified nucleic acid in the host DNA.

[0124] Specifically, the image data from the sequencing instrument is processed and converted into base sequence information. The base sequence of the DNA fragments in each cluster is determined using the information of the fluorescent signal. The measured sequence is compared with the original sequence of the host DNA.

[0125] Integration site function statistics Figure 3 As shown, a total of 6501 integration sites were detected, of which 150 were in exon regions, 4639 were in intron regions, 1151 were in intergenic regions, and 2874 were in repetitive sequence regions.

[0126] Integration site diversity Figure 4 As shown in the figure, the larger the Shannon index is, the more diverse the integration sites are; and the Gini coefficient approaches 1, reflecting that the integration sites are unevenly distributed on the genome, such as having the most integration sites in the intron region.

[0127] Integration site distribution statistics: Count the number of integration sites with a distance from TSS less than 5K and a distance from CpG less than 1K. The results are as follows Figure 5 As shown, there are 572 integration sites that are less than 5K away from TSS, and 101 integration sites that are less than 1K away from CpG.

[0128] The genome repeat class includes: short interspersed nuclear elements (SI NE), long interspersed nuclear elements (LINE), LTR, DNA repeat elements, simple repeats (i.e. micro-satellites), low complexity repeats, satellite repeats, RNA repeats (including RNA, tRNA, rRNA, s nRNA, scRNA, srpRNA). The distribution of integration sites in the genome repeat region obtained by sample detection is shown in the figure, with the largest distribution ratio in the long interspersed nuclear elements.

[0129] Integration preference analysis: Based on the host integration site annotation results, the integration sites distributed by chromosome and gene functional region are plotted to reflect the integration preference of the exogenous sequence in the sample. The results are as follows: Figure 6 shown.

Claims

1. A method for constructing a S-LAM-PCR library. It is characterized in that The method comprises: a) fragmenting a host DNA to obtain linear nucleic acid fragments, wherein the host DNA includes at least one insertion site to be detected; b) linearly amplifying the linear nucleic acid fragment described in a) using a biotin-labeled primer to obtain a linear amplified fragment; c) capturing the linear amplified fragment in b) and then performing second strand synthesis to obtain a double-stranded synthesis product; d) repairing the ends of the double-stranded synthetic product obtained in c) and adding A, and connecting a linker to obtain a connection product; e) performing a first round of PCR on the ligated product in d) using a set of primers and an adapter primer to obtain a first round of PCR product; f) Performing a second round of PCR on the first round PCR product using another set of primers and linker primers to obtain the second round PCR product and establish a library.

2. The method according to claim 1, It is characterized in that The method further comprises: g) adding a specific index and two oligonucleotide sequences P5 and P7 to the second-round PCR product in f), performing a third-round PCR amplification using primers complementary to the adapter to obtain a third-round PCR product, and establishing a sequencing library; the third-round PCR product is preferably purified using magnetic beads; Preferably, the nucleotide sequence of P5 is AGGCGAAG; and / or, The nucleotide sequence of P7 is CAGGACGT.

3. The method according to claim 1 or 2, It is characterized in that a) using ultrasound to disrupt host DNA; Preferably, the method breaks the host DNA into fragments of 200-500 bp, preferably 200-300 bp.

4. The method according to any one of claims 1 to 3, It is characterized in that b) the biotin-labeled primer is 5-LTR1-R, and the 5-LTR1-R has a nucleotide sequence as shown in SEQ ID NO: 2; Preferably, the linear amplification is performed for 40-60 cycles, preferably 50 cycles.

5. The method according to any one of claims 1 to 4, It is characterized in that c) using streptavidin magnetic beads to capture the linear amplified fragment in b); and / or, random primers are used for second strand synthesis.

6. The method according to any one of claims 1 to 5, It is characterized in that The joint described in d) is a Y-shaped asymmetric joint.

7. The method according to any one of claims 1 to 6, It is characterized in that e) the primer is 5-LTR1-R, and the 5-LTR1-R has a nucleotide sequence as shown in SEQ ID NO: 2; and / or, e) the linker primer is YN-4, and the YN-4 has the nucleotide sequence shown in SEQ ID NO: 3; Preferably, the first round of PCR amplification is 20-50 cycles, preferably 35 cycles.

8. The method according to any one of claims 1 to 7, It is characterized in that f) the primer is 5-LTR2-R, and the 5-LTR2-R has a nucleotide sequence as shown in SEQ ID NO: 4; and / or, In the method f), the linker primer is YN-5, and the YN-5 has a nucleotide sequence as shown in SEQ ID NO: 5; and / or, f) wherein the second round of PCR products further comprises purification using magnetic beads; Preferably, the second round of PCR amplification is 5-10 cycles, preferably 8 cycles.

9. A method for analyzing integration sites of lentiviral vectors, It is characterized in that The method comprises: Providing a sequencing library obtained by the method according to any one of claims 2 to 8; Performing high-throughput sequencing on the sequencing library to obtain sequencing data; preferably, placing the sequencing library into an Illumina sequencer for high-throughput sequencing; The sequencing results are compared with the original sequence of the host DNA to determine the integration site of the modified nucleic acid in the host DNA.

10. The method according to claim 9, It is characterized in that The safety of gene and cell therapy drugs delivered by lentiviral vectors is determined based on the identified integration sites.

Images