Method for creating high-yield corn germplasm by using gene editing technology

Abstract

The invention discloses a method for creating high-yield corn germplasm by using a gene editing technology, and belongs to the technical field of biology. The invention discloses a method for creating a high-yield corn germplasm by using a gene editing technology. A CRISPR / MAD7 gene editing vector is transferred into a receptor plant. The amino acid sequence of the protein protein argonaute 1B is SEQ ID NO.2, the inhibition effect of miRNA168 can be relieved by regulating and controlling the coding sequence of the protein protein argonaute 1B, new corn germplasm with the row number of ears and the yield increased is obtained, and material accumulation is provided for corn breeding.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and more specifically to a method for creating high-yield corn germplasm using gene editing technology. Background Art

[0002] Genome editing is a technology for targeted and precise modification of the genome, mainly including zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced short palindromic repeats (CRISPR / Cas). The CRISPR / Cas system is roughly divided into three types: type I, type II and type III. Among them, the type II CRISPR / Cas9 system is relatively simple in composition, requiring only three components: Cas9 protein, tracrRNA and crRNA to function, and is highly efficient and easy to operate, making it the most widely used genome editing system. The characteristic protein of the type II CRISPR / Cas system is Cas9, which has two nuclease domains, RuvC and HNH, which are responsible for cutting the two strands of the target DNA, thereby causing double-strand breaks in the target DNA. The HNH domain is responsible for cutting the DNA strand complementary to the crRNA, and the cutting site is located 3bp upstream of the protospacer adjacent motif (PAM), while the RuvC domain is responsible for cutting the non-complementary strand, and the cutting site is located 3-8bp upstream of the PAM. Cas9 protein has the function of processing and producing crRNA and cutting exogenous nucleic acids. crRNA binds to tracrRNA through base pairing to form a tracrRNA / crRNA complex. Researchers can use tracrRNA and crRNA as two guide RNAs (gRNAs) or fuse the two together to form a single guide RNA (sgRNA). sgRNA can bind to Cas9 nuclease and guide Cas9 to the target site on the genome for cutting.

[0003] The CRISPR / Cas9 system causes double-strand breaks (DSBs) in the target gene DNA, activating the DNA damage repair mechanism in the cell, and then causing deletions, knock-ins, or gene insertions and specific base changes when there is a donor template. However, it is difficult to achieve efficient and stable single-base mutations in DNA repair caused by DSBs, so it is particularly important to develop a technology that can accurately and efficiently achieve single-base replacements. In addition, concerns about the genotoxicity of DNA double-strand breaks and the low efficiency of homology-directed repair (HDR) have further promoted the development of "second-generation" CRISPR technologies, which mediate genome editing without relying on the formation of DNA double-strand breaks and HDR. The most representative of these technologies are base editors (BE) and prime editors (PE). Scientists have developed several different base editors, the most commonly used of which are cytosine base editors (CBE) and adenine base editors (ABE). These base editors do not rely on the generation of DSBs when working, and do not require the participation of donor DNA.

[0004] Cas12a is a Cas nuclease that originated from the class II type V CRISPR-Cas system. It was discovered a few years after Cas9. As many as 11 subtypes (Cas12a-k) of the tag gene of the CRISPR / Cas12 system have been identified. The recently discovered CasX is classified as Cas12e, CasY is classified as Cas12d, Cas14 is classified as Cas12f, Classified as Cas12j. Among them, the most widely studied are Cas12a, Cas12b and Cas12f. Cas12a (also known as Cpf1) is a class of nucleases mediated by a single crRNA, which can specifically recognize and cut double-stranded DNA (dsDNA) targets with PAM (5-TTTN-3' or 5'-TTN-3), and use the RuvC subunit to cut double-stranded DNA to produce sticky ends, and then complete DNA insertion and deletion through the DNA repair pathway in the body, etc., to perform gene editing functions. Cas12a's recognition and cutting of single-stranded DNA (ssDNA) targets do not depend on the PAM sequence. The most commonly used Cas12a currently comes from the BV3L6 strain of the genus Acidococcus (AsCas12a) and the bacteria of the family Lachnospiraceae (LbCas12a). MAD7 is an engineered nuclease of the type 2 VA CRISPR-Cas (Cas12a / Cpf1) family, which has a low level of homology with typical Cas12a nucleases. It has been publicly released as a free nuclease for academic and commercial use.

[0005] Corn (Zea mays L.) is a major food crop and industrial raw material. my country is one of the world's major corn producers. The general goals of corn genetic improvement are high yield, high quality, stable yield, suitable growth period and adaptability to mechanization. Among them, high yield has always been the most important breeding goal. At the same time, with the improvement of living standards, people's demand for food nutrition quality has intensified, and the strategic slogan of the Food and Agriculture Organization of the United Nations has also changed from "food security" to "food and nutrition security". Therefore, how to ensure the improvement of corn yield and quality has become a key issue in current corn breeding.

[0006] Argonaute (AGO) protein is a class of RNA binding proteins that play a key role in sRNA-mediated gene silencing. AGO protein is involved in the regulation of gene expression at the transcriptional and post-transcriptional levels and maintains genome integrity. AGO protein was first discovered in the Arabidopsis mutant ago1. Because the mutant is shaped like an "octopus", it was named Argonaute. This protein is commonly found in biological organisms and has a large relative molecular mass (about 10 5 ) and a large family of members, and is the core element of the sRNA-mediated silencing complex (RISC). AGO protein is a multi-domain protein, consisting of a variable N-terminus, PAZ (PIWI Argonaut and Zwille) MID and PIWI (P-element induced wimpy testis) domains. Among them, the PAZ domain is the binding site of sRNA, recognizing and binding to the 3' end of the 2nt protruding from the sRNA. MID forms a "pocket-like" structure, binds to the 5' phosphate end of sRNA, and anchors sRNA to the AGO protein. The PIWI domain has endonuclease activity and can cut and degrade target mRNA. There is a conserved active site Asp-ASp-His (DDH motif) in PIWI, which may be related to its catalytic activity. In addition, other more conservative motifs such as ArgoL1 (argonaute linker 1), ArgoL2 (argonaute linker 2) and Gly-rich_Ago1 (glycine-rich region of Ago1) were found in the AGO protein structure. The location, presence and function of these motifs in different AGO proteins vary.

[0007] AGO1 is the most involved in pathways and the most functionally rich class of AGO protein family studies. Studies have shown that AGO1 protein plays an important regulatory role in biological processes such as plant growth and development and stress response, mainly through the regulatory network formed by sRNAs-AGO1-miRNAs. Loss of AGO1 function usually leads to abnormal developmental phenotypes such as dwarf stems, narrow leaves, sterile inflorescence, premature leaf senescence, and low fruiting rate. AGO1 plays a key role in regulating miRNA-mediated drought tolerance mechanisms. Under ABA and drought treatment, AGO1 transcriptional activity increased in Arabidopsis, and during the stress response, the increase in miR168a transcriptional level was necessary to maintain a stable AGO1 transcriptional level. This indicates that the transcriptional regulation of miR168a and the post-transcriptional regulation of AGO1 homeostasis play an important and conservative role in plant response to abiotic stress and signal transduction. Further studies have found that the loss of AGO1 function in Arabidopsis not only promotes leaf stomatal closure, thereby improving drought tolerance, but also changes the response of Arabidopsis to ABA and other abiotic stresses, indicating that AGO1 may be a negative regulator of the Arabidopsis ABA signaling pathway and stress response. In recent years, studies have found that AGO1 not only acts as an RNA-binding protein, but also as a DNA-binding protein, binding to chromatin and promoting gene expression in signaling pathways such as jasmonic acid during plant response to hormones and adverse stresses, indicating that AGO1 has a regulatory function that is different from classical RNA interference in activating gene expression during plant response to different endogenous and exogenous signals.

[0008] RNA interference and all gene expression silencing mechanisms mediated by small RNA molecules have a common feature, that is, there will be an sRNA molecule responsible for silencing that interacts with the Argonaute family protein. This RNA-Argonaute protein complex constitutes the most basic and core effector element in the RISC complex. In the RISC complex, sRNA molecules play the following role: through the principle of base complementary pairing, they guide Argonaute proteins to bind to target molecules in a sequence-specific manner. After these target molecules of mRNA are recognized by Argonaute proteins, they will be cut or translation will be inhibited, and eventually degraded by cells.

[0009] Therefore, providing a method for creating high-yield corn germplasm using gene editing technology is an urgent problem that technicians in this field need to solve. Summary of the invention

[0010] In view of this, the present invention provides a method for creating high-yield corn germplasm using gene editing technology.

[0011] The present invention demonstrates that the CRISPR-MAD7 system can be used for genome editing and recognize T-rich PAM sequences (YTTN) in plants.

[0012] In order to achieve the above object, the present invention adopts the following technical solution:

[0013] A sgRNA, the sequence of which is as follows: gtgcagctcgggaactggtctag; SEQ ID NO.3.

[0014] Furthermore, a CRISPR / MAD7 gene editing vector, the nucleotide sequence of which is shown in SEQ ID NO.13 and SEQ ID NO.14.

[0015] Furthermore, a recombinant bacterium EHA105 / CRISPR / MAD7 contains the CRISPR / MAD7 gene editing vector.

[0016] Furthermore, the aforementioned sgRNA, or the aforementioned CRISPR / MAD7 gene editing vector, or the aforementioned recombinant bacterium EHA105 / CRISPR / MAD7 is used to increase the number of rows of corn ears.

[0017] Furthermore, the aforementioned sgRNA, or the aforementioned CRISPR / MAD7 gene editing vector, or the aforementioned recombinant bacterium EHA105 / CRISPR / MAD7 is used to increase the thickness of corn ears.

[0018] Furthermore, the aforementioned sgRNA, or the aforementioned CRISPR / MAD7 gene editing vector, or the aforementioned recombinant bacterium EHA105 / CRISPR / MAD7 is used in improving corn yield.

[0019] Furthermore, the use of the sgRNA, the CRISPR / MAD7 gene editing vector, or the recombinant bacteria EHA105 / CRISPR / MAD7 in preparing high-yield corn varieties.

[0020] Furthermore, the application of the sgRNA, the CRISPR / MAD7 gene editing vector, or the recombinant bacteria EHA105 / CRISPR / MAD7 in corn breeding.

[0021] Furthermore, a method for creating high-yield corn germplasm using gene editing technology is provided, wherein the CRISPR / MAD7 gene editing vector is transferred into a recipient plant.

[0022] Furthermore, the recipient plant is the corn inbred line KN5585.

[0023] It can be seen from the above technical solutions that, compared with the prior art, the present invention discloses a method for creating high-yield corn germplasm using gene editing technology. Since the AGO1 protein plays a regulatory role in the growth and development of plants, and the gene sequence encoding the AGO1 protein itself is negatively regulated by miRNA168, the present invention induces non-frameshift mutations in the binding site of miRNA168 by gene editing technology, thereby relieving the inhibitory effect of miRNA168 on the AGO1 gene and increasing corn yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0025] Figure 1 The attached drawings show the gene editing vectors and mutant types constructed by the present invention;

[0026] Among them, A is the constructed recombinant MAD7 vector map; B is the gene map and the designed target; C is the screened homozygous mutant;

[0027] Figure 2 The accompanying drawings are the results of the investigation of the ear row number trait of the homozygous mutant material ZmAGO1a-1 screened by the present invention;

[0028] Figure 3 The accompanying drawings are the results of the investigation of ear thickness traits of the homozygous mutant material ZmAGO1a-1 screened by the present invention;

[0029] Figure 4 The attached figure shows the ear row number phenotype result of the homozygous mutant material ZmAGO1a-1 screened by the present invention;

[0030] Figure 5 The attached figure shows the survey results of single ear yield traits of the homozygous mutant material ZmAGO1a-1 screened by the present invention. DETAILED DESCRIPTION

[0031] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0033] The genetic transformation recipient was the maize inbred line KN5585, which has been recorded in: Yang Linfeng. Construction of reference sequence of high-embryogenic transformation maize KN5585 and analysis of its genomic characteristics [D]. Huazhong Agricultural University, 2021. DOI: 10.27158 / d.cnki.ghznu.2021.001021.

[0034] Escherichia coli strain Trans1-T1 (CD501-03) was purchased from Beijing Quanshijin Biotechnology Co., Ltd.

[0035] Hind III (R0104V), homologous recombination enzyme (NEBuilder) and KOD Plus (KOC-401) high-fidelity PCR amplification enzyme were purchased from Beijing Bailingke Biotechnology Co., Ltd.

[0036] Example 1 Construction of CRISPR / MAD7 gene editing vector

[0037] The coding sequence (CDS) of the ZmAGO1a gene in the corn variety KN5585 is SEQ ID NO.1, and the encoded amino acid sequence is the protein argonaute 1B protein of SEQ ID NO.2. In the genomic DNA of corn B73, the genomic sequence encoding the protein argonaute 1B protein in genebank is Zm00001d035747. According to the ZmAGO1a (Zm00001d035747) gene in the reference genome sequence B73_RefGen_v5, the sgRNA (GTGCAGCTCGGGAACTGGTCTAG; SEQID NO.3) was designed, and the sgRNA was located at positions 467-489 of SEQ ID NO.1 (corresponding to positions 2196-2218 of Zm00001d035747). The forward and reverse primer sequences of the target site are:

[0038] 5'-CAGCATCCGGCTGCCAT-3'; SEQ ID NO.4;

[0039] 5'-TGACAGCACGATTGACACCA-3'; SEQ ID NO. 5.

[0040] The sgRNA sequence was verified by Sanger sequencing in the maize inbred line KN5585.

[0041] First, construct a CRISPR / MAD7 gene editing vector to edit the gene Zm00001d035747 encoding protein argonaute 1B in maize. The specific steps are as follows:

[0042] 1) Promoter information: The promoter used is the U6 promoter of maize (Zea mays). According to sequence alignment, there are multiple U6 promoters in maize. After comparing with U6 promoters in other species, a promoter with higher conservation was used and named U6. Its sequence is shown in SEQ ID NO.6.

[0043] 2) Enzyme digestion system and purification and recovery of MAD7

[0044] The MAD7 vector was reported in the literature (Qiupeng Lin, Genome editing in plants with MAD7 nuclease. Journal of Genetics and Genomics 48 (2021) 444e451).

[0045] (1) Digest the MAD7 vector with BamHI. The system is as follows:

[0046] MAD7 vector DNA (200 ng / μl) 20 μl, 10× Buffer 5 μl, BamHI endonuclease (15 U / μl) 1 μl, ddH 2 O24μl, Total 50μl.

[0047] The reaction procedure was to place the mixture in a metal bath at 37°C for 3 h, and then perform 1.2% agarose gel electrophoresis after the reaction was completed.

[0048] (2) Recovery of enzyme-digested vector

[0049] The MAD7 linear vector was recovered using an agarose gel recovery kit (Tiangen; Beijing; China). The operation steps are described in the kit manual. Finally, 50 μl of ddHO was added to 2 O for elution and stored at -20°C for future use.

[0050] 3) Primer design

[0051] In the process of constructing the vector, the primer sequences needed are as follows:

[0052] U6-F: 5'-GGTGTCATCTATGTTACTAGATCGGATCC CTAATTGGCCCTTACAAA -3'; SEQ ID NO.7;

[0053] U6-R: 5'-ACTCGTTTCGTCCTCACGGACTCATCAGTAATTT GGAGCGGTGGTCGCAGCTGA -3'; SEQ ID NO.8;

[0054] M13-F: 5'-GTAAAACGACGGCCAGT-3'; SEQ ID NO.9;

[0055] sgRNA-R: 5'-CAGTGCCAAGCTTGCATGCCTGCAGGAAAAAAAGTCCCATTCGCCATGCCGAAG-3'; SEQ ID NO. 10.

[0056] 4) Obtaining and purifying the target fragment

[0057] (1) KOD-Plus DNA polymerase

[0058] Due to the high fidelity of KOD plus, KOD plus was used to amplify the target fragment to obtain the required DNA fragment. The reaction system is shown in Table 1.

[0059] Table 1

[0060] name Dosage (unit: μL) illustrate 10xBuffer 5 1x 2mM dNTP 5 0.2mMEach <![CDATA[25mMMgSO 4 ]]> 2 1.0mM U6-F(10μM) 1.5 0.3μM U6-R (10μM) 1.5 0.3μM KN5585 genomic DNA 2 100-200ng / 50μL KODplus(1U / μL) 1 1U / 50μL <![CDATA[ddH 2 The]]> 32 Add to 50 μL

[0061] The reaction procedure of KOD plus is shown in Table 2.

[0062] Table 2

[0063]

[0064] The PCR results were detected by agarose gel electrophoresis. The target fragment U6 was excised and recovered using the Tiangen agarose gel recovery kit. Finally, 50 μL of ddHO was used to recover the fragment. 2 After dissolution and elution, store at -20℃ for future use.

[0065] (2) HH+scaffold+sgRNA+HDV sequence synthesis: The scaffold, HH and HDV sequences with the designed sgRNA sequence were synthesized by BGI. The specific synthetic sequence is shown in SEQ ID NO.11.

[0066] In SEQ ID NO.11, bp 1-43 is the HH sequence; bp 44-78 is the scaffold sequence; bp 79-101 is the sgRNA sequence; and bp 102-176 is the HDV sequence.

[0067] (2) Overlapping PCR reaction

[0068] Overlap extension PCR technique (gene splicing by overlap extension PCR, referred to as SOE PCR) owing to adopting primers with complementary ends, makes PCR product form overlapping chains, thereby in the subsequent amplification reaction, by the extension of overlapping chains, the amplified fragments from different sources are overlapped and spliced ​​together. This technology can carry out effective gene recombination in vitro using PCR technology, and does not need endonuclease digestion and ligase treatment, and can utilize this technology to obtain products that are difficult to obtain by other methods that rely on restriction endonuclease digestion very quickly. The key to the success of overlap extension PCR technology is the design of overlapping complementary primers. Overlap extension PCR has its extensive and unique application in aspects such as site-directed mutagenesis of gene, construction of fusion gene, synthesis of long fragment gene, gene knockout and amplification of target gene.

[0069] According to the principle of overlapping PCR, a similar method was designed to connect the target fragments, and finally the target fragment containing U6 promoter, HH, sgRNA, scaffold and HDV was obtained (as shown in SEQ ID NO.12). The system is shown in Table 3.

[0070] Table 3

[0071] name Dosage (unit: μL) illustrate 10xBuffer 5 1x 2mM dNTP 5 0.2mMEach <![CDATA[25mMMgSO 4 ]]> 2 1.0mM U6-F(10μM) 1.5 0.3μM sgRNA-R (10 μM) 1.5 0.3μM Target fragment U6 2 100-200ng / 50μL HH+scaffold+sgRNA+HDV sequence 2 100-200ng / 50μL KODplus(1U / μL) 1 1U / 50μL <![CDATA[ddH 2 The]]> 30 Add to 50 μL

[0072] The reaction procedure is shown in Table 4.

[0073] Table 4

[0074]

[0075] The PCR results were detected by agarose gel electrophoresis. The target fragment was excised and recovered using Tiangen's agarose gel recovery kit. Finally, 50 μL of ddHO was used to recover the fragment. 2 After dissolution and elution with O, the overlapping PCR recovery products were obtained and stored at -20°C for later use.

[0076] 5) NEBuilder ligation reaction and transformation

[0077] HiFi DNA Assembly Master Mix Sample Request utilizes special recombinases and the principle of homologous recombination to direct the recombination of a vector linearized by any method and a PCR fragment with a 15-25bp overlap region at both ends, and can simultaneously achieve efficient seamless splicing of 1-5 fragments.

[0078] The reaction system connected by NEBuilder is as follows:

[0079] NEBuilder HiFi DNA Assembly Master Mix 2.5 μL, MAD7 linear vector 0.5 μL, overlapping PCR recovery product 1 μL, ddH 2 Add 3% HO to make up to 5 μL.

[0080] The NEBuilder ligation reaction procedure is as follows: 50°C for 30 min to obtain the ligation product DNA.

[0081] Conversion reaction steps:

[0082] ①Take 50 μL of competent cells (Trans1-T1) melted in an ice bath, add the ligation product DNA, mix gently, and place on ice for 30 minutes;

[0083] ② Heat shock in a 42℃ water bath for 45 seconds, then quickly transfer the centrifuge tube to an ice bath for 2-5 minutes (do not shake the centrifuge tube during the ice bath);

[0084] ③ Add 400 μL of sterile SOC or LB liquid culture medium (without any antibiotics) to the centrifuge tube, mix well, and culture at 37°C, 200 rpm for 1 hour;

[0085] ④ Pipette 200 μL of transformed competent cells onto a LB solid culture medium plate containing KAN antibiotic (50 μg / mL), spread the cells evenly with a sterilized spreader until the liquid is completely absorbed, invert the plate in a 37°C constant temperature incubator, and culture for 10-14 hours.

[0086] ⑤PCR detection of transformants

[0087] Add LB liquid culture medium (containing 50μg / mL of KAN antibiotics) to the sterilized PCR tube, add 20μL to each well, pick different single colonies from the LB solid plate with a sterilized toothpick or a 10μL gun tip, and fully inoculate the picked single colonies into the LB liquid culture medium. Take out 2.0μL of liquid from the 20μL liquid culture medium and transfer it to another PCR plate as a DNA template for PCR. Seal the PCR plate with a silicone cover and place it in a constant temperature incubator at 37℃ for 8-10h.

[0088] The PCR system used to detect transformants is as follows:

[0089] 10x Buffer 2μL, dNTP 1.6μL, M13-F (10μM) 0.4μL, U6-F (10μM) 0.4μL, DNAtemplate 2μL, Taq Enzyme 0.2μL, ddH 2 O 13.4μL, total 20μL.

[0090] The PCR reaction program is shown in Table 5.

[0091] Table 5

[0092]

[0093] The results of the PCR reaction were detected with 1% agarose. The corresponding colonies were found according to the number of the colonies that amplified the target fragments, and the colonies were expanded and cultured in a centrifuge tube containing 6-8 ml LB liquid culture medium (50 μg / mL KAN antibiotics) and cultured at 37°C and 200 rpm overnight.

[0094] 6) Verification of positive transformants

[0095] Use a plasmid extraction kit to extract the plasmid from the expanded LB liquid culture medium (containing 50μg / mL KAN antibiotics), and then use the PCR method to detect it again. The detection system and PCR procedure are the same as above. Then use the corresponding restriction endonuclease for enzyme digestion detection. The system and reaction conditions are shown in step 2). If both tests are as expected, send the extracted plasmid or bacterial solution for sequencing analysis. The sequencing analysis method is as follows:

[0096] First, the quality of sequencing should be confirmed. In the returned sequencing report, there are two files with .seq and .abi as file suffixes. Open them with bioedit or snapgene software. The peaks of sequences with good sequencing quality are relatively simple and no other peaks appear; the peaks of sequences with poor sequencing quality are relatively chaotic, accompanied by the appearance of miscellaneous peaks, and sometimes there is a phenomenon that the peaks do not match the sequence. For first-generation sequencing, the first 20-40bp of sequencing are inaccurate and should be deleted to ensure the sequencing quality. According to the principle of first-generation sequencing, the activity of the DNA polymerase used in sequencing will decrease its fidelity as the reaction proceeds, so the maximum reliable sequence that can be obtained in a sequencing reaction is 650-700bp. If the part that needs to be sequenced exceeds 1Kb, it is recommended to use primers at both ends for sequencing at the same time, and then use Vector::ContigExpress software for splicing. The quality of the sequencing sequence should be confirmed before splicing. Compare the reliable sequencing sequence with the template sequence to verify again whether the transferred plasmid is the expected plasmid.

[0097] 7) Preservation of positive transformants and plasmids

[0098] The positive transformants with correct sequencing were inoculated into 350 μL LB liquid culture medium (containing 50 μg / mL KAN antibiotics), cultured at 200 rpm at 37°C for 8-10 h, and then added with 350 μL sterile 50% glycerol (glycerol and sterile water mixed in a ratio of 1:1) in a clean bench. After mixing, the mixture was stored in a -20°C refrigerator for later use. For the plasmid extracted in step 6), the corresponding label was written and directly stored in a -20°C refrigerator.

[0099] The basic MAD7 vector used in the above construction is about 19.5Kb in size and is a medium-copy vector. It mainly contains the following elements: KAN antibiotic resistance gene; replication element; CaMV 35S promoter-driven bar selection gene; Ubi promoter-driven gene sequence encoding MAD7 protein and maize U6 promoter-driven sgRNA DNA sequence. Among them, except for the KAN resistance gene and replication element, the rest are on the T-DNA fragment, such as Figure 1 . It carries the KAN resistance gene, which can make the strain KAN resistant, so KAN antibiotics can be used for screening. The only BamHI restriction endonuclease site is located between the U6 promoter and RB. After enzyme cutting, MAD7 can be made linear for vector construction. In the transgenic positive plants, the MAD7 protein expressed by Ubi::MAD7::Nos on the MAD7 vector has directional DNA cleavage activity after binding to the sgRNA transcribed by U6::scaffold::sgRNA::HDV; the bar protein expressed by CaMV 35S::bar::CaMV poly(A)signal has herbicide resistance and can be used for screening positive plants.

[0100] The structure of the CRISPR / MAD7 editing vector is described as follows: a DNA fragment having a sequence shown in SEQ ID NO.12 is inserted between the recognition sites of the restriction endonuclease BamHI of the original vector MAD7, and the rest of the sequence of the original vector MAD7 is kept unchanged to obtain a recombinant vector. Figure 1 As shown in B, the nucleotide sequence of the recombinant vector is shown in SEQ ID NO.13 (1-9999 bp of the recombinant vector) and SEQ ID NO.14 (10000-19516 bp of the recombinant vector). Among them, positions 459-4244 of SEQ ID NO.13 are MAD7 elements, positions 4367-6338 are Ubi promoter elements, positions 6367-8302 are 3896 promoter elements, positions 8303-8980 are DsRed2, and positions 9715-9737 are sgRNA.

[0101] Example 2 Genetic transformation of corn

[0102] 1) Obtaining the recombinant strain EHA105 / CRISPR / MAD7

[0103] The CRISPR / MAD7 editing vector constructed in Example 1 was introduced into BMEHA105 Agrobacterium competent cells (Beijing Bomade Gene Technology Co., Ltd., catalog number: BC303-01) to obtain recombinant Agrobacterium EHA105 / CRISPR / MAD7.

[0104] 2) Agrobacterium infection

[0105] (1) The recombinant Agrobacterium obtained in step 1) was cultured in N6 liquid medium (potassium nitrate 2800 mg / L, ammonium sulfate 463 mg / L, potassium dihydrogen phosphate 400 mg / L, magnesium sulfate 185 mg / L, calcium chloride 165 mg / L, potassium iodide 0.8 mg / L, boric acid 1.6 mg / L, manganese sulfate monohydrate 4.4 mg / L, zinc sulfate heptahydrate 1.5 mg / L, disodium ethylenediaminetetraacetic acid 37.25 mg / L, ferrous sulfate heptahydrate 27.85 mg / L, glycine 2 mg / L, vitamin B1 1 mg / L, vitamin B6 0.5 mg / L, nicotinic acid 0.5 mg / L, sucrose 20000 mg / L. Heat and stir to dissolve, adjust pH to 5.8±0.2 (25°C), and sterilize at 115°C for 20 minutes) in an Agrobacterium shaker at 28°C and 200 rpm to obtain a bacterial liquid OD 600nm The recombinant Agrobacterium liquid was centrifuged at 5000r / min for 10min, the bacteria were collected, and the prepared infection buffer (1L infection buffer is 4g of N6 medium basal salt containing N6 vitamin (product of Phytotech, product number C416-50L), 2mg 2,4-D, 100mg inositol, 0.7g L-proline, 68.4g sucrose, 36g glucose, 1mL AgNO 3 (10 mg / mL), 1 mL As (100 mol / L) and water were mixed and the pH was adjusted to 5.2 to obtain a suspended cell. The OD 600nm The value is about 0.5, and then it is shaken at 28℃ and 150r / min for 0.5h to obtain the infection solution.

[0106] (2) Soak the well-growing callus of the corn inbred line KN5585 in the infection buffer for 1 hour, then transfer it to the infection solution prepared in step (1) and soak it for 15 minutes, and then dry it.

[0107] (3) Place the infected callus tissue in step (2) into a co-culture medium (1 L of co-culture medium is 4 g of N6 medium basal salt containing N6 vitamin, 2 mg of 2,4-D, 30 g of sucrose, 8 g of agar, 1 mL of AgNO 3 (10 mg / mL), 1 mL As (100 mol / L), 3 mL L-cysteine ​​(100 mg / mL) and water, pH 5.8), cultured at 20°C for 3 days, and transferred to recovery medium (1 L recovery medium is 4 g N6 medium basal salt, 1 ml N6 vitamin 1000×, 1.5 mg 2,4-D, 0.7 g L-proline, 30 g sucrose, 5 μM AgNO 3 , 0.5 g MES, 100 mg cefotaxime, 100 mg vancomycin, 8 g agar and water were mixed, pH 5.8), cultured at 28°C for 10 days, then transferred to a recovery medium containing 1.5 mg / L glufosinate, cultured in the dark at 28°C for 7 days, and positive callus was selected.

[0108] (4) The positive callus obtained in step (3) was transferred to an embryoid induction medium (1L embryoid induction medium is prepared by mixing 4.43g of MS salt containing MS vitamin (containing inositol) (PM10122-303, Beijing Cooliebo), 0.25mg 2,4-D, 30g sucrose, 5mg 6-BA, 4g plant gel, 1mL Cefo (cephalosporin) (250mg / mL) and water, pH 5.8), cultured in the dark for 2 weeks, and then transferred to a differentiation medium (1L differentiation medium is prepared by mixing 4.43g of MS salt containing MS vitamin (containing inositol), 30g sucrose, 4g plant gel, 1mL Cefo (250mg / mL) and water, pH 5.8), and after green seedlings grow, transferred to a rooting medium (1L rooting medium is prepared by mixing 2.215g 1 / 2MS, 30g sucrose, 51.55mg MS vitamin (MSP09-10LT, Beijing Biodi Biotechnology Co., Ltd.), 4g of plant gel mixed with water, pH5.8) took root, grew to a certain height, exposed to the air for 3 days, and then transplanted.

[0109] (5) Take a 3 cm leaf of the plant, put it into a tube and grind it thoroughly, add 500 μl of buffer (from the bar gene test strip), and insert it into the bar gene test strip (Beijing Aochuang Jinbiao Biotechnology Co., Ltd., catalog number:

[0110] A07-13-413), the plants with positive bands were T 0 Generation of positive plants.

[0111] Example 3 Identification of transgenic plants

[0112] 1) Verification of genetically modified ingredients

[0113] DNA was extracted and purified using a plant genomic DNA extraction kit (Tiangen, China), tested positive using a Bar test strip (Agdia, Cat. # STX14200 / 0012, US), and T-DNA was detected using PCR of the MAD7 gene.

[0114] MAD7 PCR amplification used a forward primer (5'-TGTTCTGGGTGATGAAGTTG-3'; SEQ ID NO. 15) and a reverse primer (5'-TACACCTACGACAAGTACTT-3'; SEQ ID NO. 16).

[0115] The PCR program included 94°C for 3 min, 95°C for 30 s, 58°C for 30 s, and 68°C for 20 s for 35 cycles, and a final extension at 68°C for 10 min. The PCR reaction system was: 10x Buffer 5 μL; 2 mM dNTP 5 μL; 25 mM MgSO 4 2μL; 1.5μL each of upstream and downstream primers (10μM); 2μL DNA Template; 1μL KOD plus (1U / μL); ddH 2 O 32 μL.

[0116] 2) Mutation Detection

[0117] According to the target position of the constructed base editing vector, the primers shown in SEQ ID NO.4 and SEQ ID NO.5 were used to amplify the target gene of the corresponding plants by PCR, and the mutation type was analyzed by DSDecode software after sequencing. The PCR reaction system and reaction procedure were the same as the transgenic component verification in step 1).

[0118] Through Agrobacterium-mediated genetic transformation, 15 transformation events of CRISPR / MAD7 editing vectors were obtained. PCR amplification and Sanger sequencing revealed that a mutation occurred in the region where sgRNA binds ( Figure 1 B), and a non-frameshift mutation (ZmAGO1a-1111) with three bases inserted was obtained in the transformation event of the CRISPR / MAD7 editing vector. The type of mutation is ZmAGO1a-1: three bases inserted. The specific mutation types are as follows:

[0119] Compared with the wild type, the ZmAGO1a gene in the two homologous chromosomes of ZmAGO1a-1 underwent the following mutations: "5'-CTAGACCAGTTCCCGAGCTGCAC-3'; SEQ ID NO.17 (corresponding to positions 467-489 of SEQ ID NO.1, positions 2196-2218 of Zm00001d035747)" in the ZmAGO1a gene mutated to "5'-CTAGACCAGTTCCCGAGCTTCTGCAC-3; SEQ ID NO.18'". This mutation inserted three nucleotides "TCT" between positions 2214-2215 of Zm00001d035747. The insertion of these nucleotides caused a non-frameshift mutation, making it difficult for miRNA168 to recognize the gene, and relieving the inhibition of miRNA168 on the ZmAGO1a gene without affecting the normal function of protein argonaute 1B. The sequencing results of the mutation site and its surrounding nucleotides are shown in Figure 1 C.

[0120] 3) Genetically transformed T 0 The positive plants of the first generation were self-pollinated or test-crossed to obtain T 0 Generation seeds, after planting from T 1 After the non-frameshift mutant of ZmAGO1a gene was screened out from the positive plants of the first generation, the seeds were obtained by self-pollination. 2 The next generation of plants were planted for genotype detection and transgenic component detection. Finally, homozygous negative mutants were selected for self-pollination and seed breeding.

[0121] The results are as follows Figure 1 As shown, chromosome 1 and chromosome 2 represent the DNA double strands of the test plant. The present invention successfully constructed a CRISPR / MAD7 editing vector for editing protein argonaute 1B gene Zm00001d035747 ( Figure 1 A). Through Agrobacterium-mediated genetic transformation, 15 transformation events of CRISPR / MAD7 editing vector were obtained. Centered on the position where sgRNA binds, upstream primers and downstream primers of this site were designed. Through PCR amplification and Sanger sequencing, it was found that a mutation occurred in the region where sgRNA binds ( Figure 1 B), and a non-frameshift mutation was obtained. Finally, the homozygous mutant material of the non-frameshift mutation of ZmAGO1a was selected for the identification of ear row number, ear diameter and yield.

[0122] Example 5 Phenotypic Identification of Transgenic Plants

[0123] 1) Identification of the number of rows and ears, ear diameter and yield

[0124] The number of rows per ear is an important domestication and improvement trait of maize, and is also an important yield component. Genetic improvement of the number of rows per ear is an effective way to increase maize yield.

[0125] Normally grown ears were randomly selected from the mutants, and the wild type was used as the control. The number of ear rows and ear diameter of the homozygous mutant (ZmAGO1a-1) with non-frameshift mutations screened from the transformed materials transformed with the CRISPR / MAD7 editing vector were counted. According to the T test results, the number of ear rows and ear diameter of the homozygous mutant with non-frameshift mutations were significantly more than those of the wild type. Figure 2 and Figure 3 The cross-section of the ear was selected from the homozygous mutant ear of the non-frameshift mutation and photographed. The results are shown in Figure 4 A single ear was randomly selected from the homozygous mutant ears of the non-frameshift mutation to identify the single ear yield. The T test results showed that the single ear yield of the homozygous mutant of the non-frameshift mutation was significantly higher than that of the wild-type material. Figure 5 The above experimental results show that the non-frameshift mutants obtained by editing the protein argonaute 1B gene Zm00001d035747 through gene editing can increase the number of corn ear rows and ear diameter, thereby increasing yield and quickly creating high-yield corn germplasm.

[0126] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A sgRNA, characterized in that The sequence is as follows: gtgcagctcgggaactggtctag; SEQ ID NO.

3.

2. A CRISPR / MAD7 gene editing vector, characterized in that: The nucleotide sequences are shown in SEQ ID NO.13 and SEQ ID NO.

14.

3. A recombinant bacterium EHA105 / CRISPR / MAD7, characterized in that: Containing the CRISPR / MAD7 gene editing vector as described in claim 2.

4. Use of the sgRNA of claim 1, or the CRISPR / MAD7 gene editing vector of claim 2, or the recombinant bacterium EHA105 / CRISPR / MAD7 of claim 3 in increasing the number of rows of corn ears.

5. Use of the sgRNA of claim 1, or the CRISPR / MAD7 gene editing vector of claim 2, or the recombinant bacterium EHA105 / CRISPR / MAD7 of claim 3 in increasing the diameter of corn ears.

6. Use of the sgRNA according to claim 1, or the CRISPR / MAD7 gene editing vector according to claim 2, or the recombinant bacterium EHA105 / CRISPR / MAD7 according to claim 3 in improving corn yield.

7. Use of the sgRNA according to claim 1, or the CRISPR / MAD7 gene editing vector according to claim 2, or the recombinant bacterium EHA105 / CRISPR / MAD7 according to claim 3 in preparing a high-yield corn variety.

8. Use of the sgRNA of claim 1, or the CRISPR / MAD7 gene editing vector of claim 2, or the recombinant bacterium EHA105 / CRISPR / MAD7 of claim 3 in corn breeding.

9. A method for creating high-yield corn germplasm using gene editing technology, characterized in that: The CRISPR / MAD7 gene editing vector described in claim 2 is introduced into a recipient plant.

10. The method for creating high-yield corn germplasm using gene editing technology according to claim 9, characterized in that: The recipient plant is the maize inbred line KN5585.

Images