Gene and method for improving drought resistance of tomato plant

Abstract

The invention discloses a gene for improving drought resistance of tomato plants and a method thereof. The nucleotide sequence of the gene is shown as Seq No.1. According to the invention, a complete coding sequence of the SlERF.D2 gene is obtained from tomato, a target is designed, the target is connected to a carrier CRISPR-Cas9, a plant is transformed by using an agrobacterium infection method, a gene editing plant is obtained, the gene editing plant is analyzed, and a result shows that the drought resistance of the tomato plant can be improved after gene editing.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and relates to a gene and a method for regulating drought stress of tomato plants, and particularly to an AP2 / ERF family transcription factor SlERF.D2, and application of the gene in regulating drought stress of tomato plants. Background Art

[0002] tomato( Solanum lycopersicum ) is an important vegetable and cash crop and one of the important food sources for humans. However, most tomato varieties have poor adaptability to the environment, and their growth and development are easily affected by abiotic stress and drought. Therefore, discovering tomato genes related to stress resistance and cultivating corresponding resistant varieties are of great significance to tomato production. In addition, tomatoes are self-pollinating plants with short growth cycles and complete genome sequencing, so tomatoes are often used as model crops.

[0003] As one of the largest transcription factor families in plants, AP2 / ERF transcription factors were once considered to be a type of transcription factor unique to the plant kingdom, with important regulatory functions. Ethylene response factors (ERFs) can not only promote plant seed germination, fruit development and organ abscission, but also participate in plant stress responses. As a sessile organism, the growth and development of plants are always affected by various external environmental conditions. Adversity stress has serious adverse effects on the growth and development process of plants and crop yield. In the face of various abiotic stresses, plants have evolved complex regulatory pathways to respond. The water status of plants is affected by factors such as leaf relative water content (RWC) and leaf transpiration rate. After drought stress, the transpiration rate of plant leaves is usually significantly lower than that of unstressed leaves, while the malondialdehyde (MDA) content of leaves will increase significantly. At the same time, under drought stress, the reduction of effective water is usually accompanied by a decrease in the total amount of nutrient absorption and the nutrient concentration in various tissues and organs. In addition, drought-induced stomatal closure limits the absorption of CO2 by leaves, leading to a decrease in the rate of plant photosynthesis and increasing the sensitivity of plants to light damage.

[0004] Knocking out CPK27 in tomato reduced drought resistance in tomato plants and impaired the abscisic acid (ABA)-regulated plant response to drought stress, providing an idea to improve plant drought resistance by manipulating CPK27, thereby making plants drought-resistant under changing climate conditions (Zhu C, Jing B, Lin T, et al. 2024, Plant Physiol.195(2):1005-1024). Overexpression of the WRKY39 gene in Populus trichocarpa improved drought resistance and salt-alkali tolerance regulation in transgenic plants during seed germination and vegetative growth (NiuY, Li X, Xu C, et al. 2021 PlantSignal Behav.;16(7):1918885).

[0005] The genome studied a DREB transcription factor gene (TaDTG6-B), which is closely related to drought tolerance in wheat. The 26 bp deletion in the TaDTG6-B coding region can induce the functional gain of TaDTG6-BDel574. Compared with TaDTG6-BIn574 encoded by the missing allele, TaDTG6-BDel574 showed stronger transcriptional activation, protein interaction and binding activity to the dehydration response element (DRE) / CRT cis-element, thereby conferring greater drought tolerance to wheat seedlings carrying this variant (MeiF, Chen B, Du L, et al. 2022 Plant Cell. 34(11):4472-4494). However, there are few reports on the ability of AP2 / ERF family transcription factors to improve the drought resistance of tomato plants. Summary of the invention

[0006] The object of the present invention is to provide a gene for improving drought resistance of tomato plants and a method thereof.

[0007] To achieve the above purpose and other related purposes, the technical solution provided by the present invention is: a gene for improving drought resistance of tomato plants, the nucleotide sequence of which is shown in Seq No.1.

[0008] To achieve the above-mentioned purpose and other related purposes, the technical solution provided by the present invention is: a method for improving drought resistance of tomato plants, comprising the following steps: Step 1: Preparation of gRNA target adapter primer; Step 2: Construction of gRNA expression cassette: Prepare an enzyme ligation reaction solution containing the target adapter primer in step 1, and use the cutting and ligation method to connect the target adapter to the gRNA expression cassette to expand the gRNA expression cassette; Step 3: Using the product of step 2 as a template, perform a first round of PCR amplification; then use the first round of PCR product as a template to perform a second round of PCR amplification, use agarose gel electrophoresis to detect the product concentration, and then use a DNA purification kit to purify and recover the second round of PCR product to obtain a purified product; Step 4: Use the cutting and ligation method to connect the purified product of step 3 with the CRISPR-Cas9 plasmid to obtain a connected plasmid; Step 5: Transform the plasmid connected in step 4 into E. coli DH5α competent cells to obtain positive monoclonal colonies; Step 6: Pick the positive monoclonal colony obtained in step 5 for PCR identification. If it is correct, extract the plasmid to obtain SlERF.D2 -CRISPR-Cas9 plasmid; Step 7: SlERF.D2 -CRISPR-Cas9 plasmid was transformed into EHA105 Agrobacterium competent cells to obtain the constructed SlERF.D2 - Single colony of Agrobacterium carrying CRISPR-CAS9 vector; Step 8: Construct SlERF.D2 -Genetic transformation of tomato with a single colony of Agrobacterium tumefaciens expressing CRISPR-Cas9 vector.

[0009] The preferred technical scheme is: the preparation of the gRNA target primer adapter includes: firstly preparing a 100 µM master solution of target one forward primer-F1, a target one reverse primer-R1, a target two forward primer-F2, and respectively, and then respectively mixing and diluting the target one forward primer-F1 master solution and the target one reverse primer-R1 master solution to 1 µM to obtain a first mixed primer, and mixing and diluting the target two forward primer-F2 master solution and the target two reverse primer-R2 master solution to 1 µM to obtain a second mixed primer; 90°C, 30s, and then transferring to room temperature for cooling to complete annealing; Target one forward primer-F1: 5′- gtcaTACACGTGTGGTATCGGGTC -3′; Target one reverse primer-R1: 5′- aaacGACCCGATACCACACGTGTA -3′; Target two forward primer-F2: 5′- gtcaGGTGTACGACAACGACCAT -3′; Target two reverse primer-R2: 5'-aaacATGGTCGTTGTCGTACACC -3'.

[0010] The preferred technical solution is: in step 2, the target linker is connected to the gRNA expression cassette by cutting and ligating, and the gRNA expression cassette is expanded, including: gRNA-U# plasmid 1 µL, first mixed primer 0.5 µL, BsaI 0.4 µL of enzyme, 1 µL of 10×Cutsmart buffer, 0.1 µL of T4 DNA ligase, 0.5 µL of 10×T4 DNA ligase buffer, ddH2O supplemented to 10 µL, PCR program set to 37°C, 5 min; 20°C, 5 min; 5 cycles to obtain the first ligation product; gRNA-U# plasmid 1 µL, second mixed primer 0.5 µL, BsaI Enzyme 0.4 µL, 10×Cutsmart buffer 1 µL, T4 DNA ligase 0.1 µL, 10×T4 DNA ligase buffer 0.5 µL, ddH2O supplemented to 10 µL, PCR program set at 37°C for 5 min, 20°C for 5 min, 5 cycles to obtain the second ligation product.

[0011] The preferred technical solution is: in step 3, Each gRNA expression cassette contains 2 rounds of PCR reactions. In the first round of PCR, there are 4 reactions in total; Reaction 1 of target one is as follows: take 1 μL of the first ligation product as template, 2 μL UF, 2 μL target one reverse primer R1, 1 μL Super-Fidelity DNA Polymerase, 10 μL 5×Super-Fidelity DNA Polymerase buffer, 1 μL dNTPs, and add ddH2O to 50 μL to obtain the third ligation product; Reaction 2 of target one is as follows: take 1 μL of the first ligation product as template, 2 μL of gRNA-R, 2 μL of target one forward primer F1, 1 μL Super-Fidelity DNA Polymerase, 10 μL 5×Super-Fidelity DNA Polymerase buffer, 1 μL dNTPs, and add ddH2O to 50 μL to obtain the fourth ligation product; Reaction 1 of target 2 is as follows: take 1 μL of the second ligation product as template, 2 μL UF, 2 μL of target 2 reverse primer R1, 1 μL Super-Fidelity DNA Polymerase, 10 μL 5×Super-FidelityDNA Polymerasebuffer, 1 μL dNTPs, and add ddH2O to 50 μL to obtain the fifth ligation product; Reaction 2 of target 2 is as follows: 1 μL of the second ligation product as template, 2 μL of gRNA-R, 2 μL of target 2 forward primer F1, 1 μL of Super-Fidelity DNA Polymerase, 10 μL of 5×Super-Fidelity DNA Polymerase buffer, 1 μL of dNTPs, and ddH2O supplemented to 50 μL to obtain the sixth ligation product; The PCR program was set as follows: 95°C pre-denaturation for 1 min, 95°C denaturation for 10 s, 60°C annealing for 15 s, 72°C extension for 15 s, 25 cycles; the final extension was 72°C for 10 min; detection was performed after the amplification was completed; UF: 5'-CTCCGTTTTACCTGTGGAATCG-3'; gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3'; Before the second round of PCR reaction, the position-specific primer pairs were pre-mixed into 10× working solutions, each at 1.5 µM: primer combination working solution PT1 = 1.5 µL of B1' + 1.5 µL of B2 + 7 µL of ddH2O, primer combination working solution PT2L = 1.5 µL of B2' + 1.5 µL of BL + 7 µL of ddH2O; The target site 1 reaction system is: 1 µL of the third ligation product and the fourth ligation product of the first round of PCR amplification, 3 µL of primer combination working solution PT1, 0.6 µL of dNTPs, 0.6 µL of Super-Fidelity DNA Polymerase, 6 µL of 5×Super-Fidelity DNA Polymerase buffer, 17.8 µL of ddH2O, mixed and placed in a PCR instrument to amplify the seventh ligation product; The target site 2 reaction system is: 1 µL each of the fifth and sixth ligation products of the first round of PCR amplification, 3 µL of primer combination working solution PT2L, 0.6 µL of dNTPs, 0.6 µL of Super-Fidelity DNA Polymerase, 6 µL of 5×Super-Fidelity DNA Polymerase buffer, and 17.8 µL of ddH2O. Mix well and place in a PCR instrument to amplify the eighth ligation product. The PCR reaction conditions were as follows: 95°C, 1 min; 95°C, 10 s; 60°C, 15 s; 72°C, 15 s; 18 cycles; 72°C, 10 min; 4°C, ∞; B1': 5'-TTCAGAGGTCTCTCTCGACTAGTGGAATCGGCAGCAAAGG-3'; B2: 5'-AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC-3'; B2': 5'-TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG-3'; BL: 5'-AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC-3'.

[0012] The preferred technical solution is: in step 4, the purified product of step 3 is connected to the CRISPR-Cas9 plasmid by a cutting and ligation method, including: the reaction system is: 0.2 μL of the purified product of step 3, 1 μL of the CRISPR-Cas9 plasmid, BsaI Enzyme 0.5 µL, 10× BsaI Buffer 1.5µL, ddH2O 11.8 µL, digest at 37℃ for 10 min; add 10×NEB T4DNA ligase buffer 0.4 µL, T4 DNA ligase 0.1µL, set the PCR instrument at 37℃ for 2 min; 10℃ for 3 min; 20℃ for 5 min; 13 cycles, and finally at 37℃ for 2 min to obtain the ligated plasmid; the purified product in step 3 refers to the product obtained by mixing the seventh ligation product and the eighth ligation product in a volume ratio of 1:1 and then purifying it.

[0013] The preferred technical scheme is: in step 5, 5 µL of the connected plasmid is transferred into 50 µL of Escherichia coli DH5α competent cells, the bottom of the centrifuge tube is shaken by hand to make it uniform, ice bath for 25 min, heat shock at 42°C for 45 s, and ice bath for 2 min; liquid LB culture medium is added thereto, and the bacteria are shaken in a shaker at 37°C and 200 rpm for 0.5-1.5 h; the cultured bacterial solution is centrifuged to obtain the supernatant, the bacterial solution is blown and mixed, and then applied to a solid LB culture medium containing kanamycin, and inverted in an incubator for overnight culture to obtain positive monoclonal colonies.

[0014] The preferred technical solution is: in step 6, the identification system is 25 µL: 2 µL of the bacterial solution obtained in step 5, 1 µL of SP-L primer and SP-R primer, 12.5 µL of 2×Taq enzyme, and 8.5 µL of ddH2O; the reaction conditions in the PCR instrument are: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 55°C annealing for 15 s, 72°C extension for 15 s, a total of 35 cycles, and 72°C post-extension for 5 min; after the PCR reaction is completed, 8 µL of the sample is taken for agarose gel electrophoresis detection to see whether the size of the electrophoresis band meets the theoretical value, and the bacterial solution with the correct band is transferred to 3 mL of liquid LB containing kanamycin for expansion culture, 37°C, 200rpm shaking culture for 16 h, and the plasmid is extracted using a plasmid extraction kit and agarose gel electrophoresis detection is performed, and the extracted plasmid is further sequenced to obtain SlERF.D2 -CRISPR-Cas9 plasmid; SP-L primer: GTCGTGCTCCACATGTTG; SP-R primer: CCCGACATAGATGCAATAACTTC.

[0015] The preferred technical solution is: in step 7, take 100 µL of EHA105 Agrobacterium competent cells, divide them into two tubes, wait for them to melt in an ice bath, and add 1 µL SlERF.D2 -CRISPR-Cas9 plasmid, stir the bottom of the centrifuge tube by hand to mix it, let it stand on ice for 5 min, liquid nitrogen for 5 min, 37℃ water bath for 5 min, ice bath for 5 min; add 700 µL of LB liquid medium without antibiotics, shake and culture at 28℃ for 2-3h; centrifuge at 5000 rpm for 5 min to collect the bacteria, keep about 100 µL of supernatant, resuspend the bacteria, spread it on LB-Kana / Rif solid medium, invert it and culture it in a 28℃ incubator for 2-3 days to obtain the constructed SlERF.D2 - Single colony of Agrobacterium carrying the CRISPR-Cas9 vector.

[0016] The preferred technical solution is: in step 8, the constructed SlERF.D2 -CRISPR-Cas9 vector, dissolved in 10 µL sterile water to make bacterial solution, added to 3 mL of liquid LB medium containing Kana and Rif, 200 rpm, 28 ° C overnight culture, then took 400 µL in 30 mL of liquid LB medium containing Kana and Rif, 200 rpm, 28 ° C shaking culture for 3-6 h, and detected by spectrophotometer until the bacterial solution OD 600 The cells were collected by centrifugation at 5000 rpm for 5 min at room temperature, the supernatant was discarded, and the cells were precipitated with sterile water until the OD600 is 0.1-0.15; the tomato cotyledons and stem segments are pre-cultured in the dark for 2 days and then immersed in the diluted Agrobacterium infection solution. The infection solution is poured out after 5 minutes of infection. The cotyledons and stem segments are placed on culture media containing different plant hormones for germination, bud elongation, and rooting. The rooted explants are transferred to nutrient soil for culture, and subsequent sequencing and identification are performed to obtain transformed tomato plants.

[0017] Due to the application of the above technical solution, the present invention has the following advantages compared with the prior art: The present invention obtains from tomato SlERF.D2 The coding sequence of the gene was obtained, the primers of the CRISPR-Cas9 vector were designed, and the corresponding vector was constructed. The tomato was successfully infected with Agrobacterium competent cells, and the tomato SlERF.D2 -CRISPR-Cas9 gene-edited plants were found to have SlERF.D2 -CRISPR-Cas9 plants showed significant drought resistance, the results showed SlERF.D2 Gene could improve drought resistance in tomato plants BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 for SlERF.D2 Identification of gene-edited tomato plants; A: erf.d2 Sequencing results; B: WT and erf.d3 Comparison of sequence peaks.

[0019] Figure 2 Wild type (WT), erf.d2 Phenotypic differences in gene-edited tomato plants under drought conditions.

[0020] Figure 3 Wild type (WT), erf.d2 Differences in phenotypes of gene-edited tomato leaves under drought conditions.

[0021] Figure 4 Wild type (WT), erf.d2 Changes in water content in gene-edited tomato leaves.

[0022] Figure 5 Wild type (WT), erf.d2 Differences in phenotypes of gene-edited tomato plants after rehydration. DETAILED DESCRIPTION

[0023] The following is a description of the implementation of the present invention by means of specific embodiments. Those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in the embodiments.

[0024] See also Figures 1 - 5. It should be noted that the structures, proportions, sizes, etc. illustrated in the drawings of this specification are only used to match the contents disclosed in the specification for people familiar with this technology to understand and read, and are not used to limit the limiting conditions under which the present invention can be implemented. Therefore, they have no substantive technical significance, and any structural modification, change in proportional relationship or adjustment of size. The following examples are provided to better understand the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are all conventional methods unless otherwise specified. The experimental materials used in the following examples are all purchased from conventional biochemical reagent stores unless otherwise specified.

[0025] Example 1: A gene and method for improving drought resistance of tomato fruit plants A method for improving drought resistance of tomato fruit plants comprises the following steps: SlERF.D2 - Construction of CRISPR-Cas9 deletion vector (1) Obtain SlERF.D2 Gene sequence and design gRNA target primers.

[0026] (2) Preparation of gRNA target linker.

[0027] (3) Construction and connection of gRNA expression cassette: The gRNA vector is digested by enzymes, and the target linker is connected to the gRNA expression cassette using the cutting and ligation method to expand the gRNA expression cassette.

[0028] (4) Perform one round of PCR amplification using the product of step (3) as a template. Perform a second round of PCR amplification using the product of the first round of PCR as a template, and observe the product concentration by running a gel. Purify and recover the product of the second round of PCR using a DNA purification kit.

[0029] (5) Use the cutting and ligation method to connect the gRNA expression cassette and the Cas9 plasmid.

[0030] (6) The ligated product from step (5) was transformed into E. coli DH5α competent cells.

[0031] (7) Select positive monoclonal strains for identification and perform agarose gel testing on the resulting products.

[0032] (8) SlERF.D2 -CRISPR-Cas9 plasmid was transformed into EHA105 Agrobacterium competent cells.

[0033] (9) SlERF.D2 -CRISPR-Cas9 plasmid-containing Agrobacterium tumefaciens cells were used for genetic transformation of tomatoes.

[0034] The preferred embodiment is as follows: in step (1), tomato SlERF.D2The gene sequence was designed by gRNA target primers through the website http: / / crispr.dbcls.jp / . Two pairs of target primers F1 / F2 and R1 / R2 were designed to make their GC content not less than 50% and not more than 70%, and the Tm value was 55-70℃.

[0035] A preferred embodiment is as follows: in step (2), the adapter primer is dissolved into a 100 µM stock solution and mixed and diluted to 1 µM. It is heated at about 90°C for 30 s, then transferred to room temperature for cooling to complete annealing, and the concentration is detected.

[0036] The preferred embodiment is: in step (3), to ensure BsaI To test the activity of the enzyme, first prepare 10 µL of the reaction system. BsaI 0.5 µL enzyme, 1 µL gRNA-U# plasmid, 1 µL 10× Cutsmart buffer, ddH2O supplemented to 10 µL, 37°C, 15 min, then agarose gel electrophoresis to check whether the target band is cut out. The total gRNA vector enzyme digestion reaction system is 10 µL, including 1 µL gRNA-U# plasmid, react in a PCR instrument for 20 min, and finally 70°C for 5 min to inactivate the enzyme. The target linker and gRNA expression cassette ligation reaction is: 1 µL 10× T4 DNA ligase buffer, 1 µL gRNA-U# plasmid, 0.5 µL target linker, ddH2O supplemented to 10 µL, and finally 0.1 µL T4 DNA ligase.

[0037] A preferred embodiment is as follows: in step (4), one round of PCR includes two reactions, and the PCR system is 50 µL in total. Reaction 1 contains 1 µL of ligation product, 1 µL of primer UF, 1 µL of reverse primer R, 5 µL of dNTPs, 3 µLMgSO4, 1 µL of KOD enzyme, 5 µL of 10×KOD buffer, and 33 µL of ddH2O. Reaction 2 is the same as reaction 1 except that the primer pair is replaced with gRNA-R and forward primer F1. The PCR reaction conditions are as follows: pre-denaturation at 95°C for 1 min, denaturation at 95°C for 10 s, annealing at 60°C for 15 s, extension at 72°C for 15 s, for a total of 35 cycles, and post-extension at 72°C for 10 min. The product is detected by agarose gel electrophoresis.

[0038] A preferred embodiment is as follows: In step (5), a PCR reaction is performed using a cutting and ligation method. The reaction system is 0.2 µL of the purified product of step (4), 1 µL of CRISPR-Cas9 plasmid, BsaI Enzyme 0.5 µL, 10× BsaIBuffer 1.5 µL, ddH2O 11.8 µL, digest at 37 ℃ for 10 min. Add 10×NEB T4 DNA ligase buffer 0.4 µL, T4 DNA ligase 0.1 µL. Set the PCR instrument to 37℃ for 2 min, 10℃ for 3 min, 20℃ for 5 min, 13 cycles, and finally 37℃ for 2 min.

[0039] The preferred embodiment is as follows: in step (6), 5 µL of the connected plasmid is transferred into 50 µL of E. coli DH5α competent cells, the bottom of the centrifuge tube is gently shaken by hand to make it uniform, ice bath for 25 min, heat shock at 42°C for 45 s, and ice bath for 2 min. 350 µL of liquid LB is added thereto, and the bacteria are shaken in a shaker at 37°C and 200 rpm for 1 h. The cultured bacterial solution is centrifuged at 6000 rpm for 1 min, 100 µL of supernatant is retained, the bacterial solution is blown and mixed, and then coated on solid LB containing kana (100 µL is added to every 100 mL), and inverted in a 37°C incubator for overnight culture.

[0040] A preferred embodiment is as follows: in step (7), the identification system is 25 µL, including 2 µL of bacterial solution, 1 µL of SP-L / SP-R primers, 12.5 µL of 2×Taq enzyme, and 8.5 µL of ddH2O. The reaction conditions in the PCR instrument are: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 55°C annealing for 15 s, 72°C extension for 15 s, for a total of 35 cycles, and 72°C post-extension for 5 min. The reaction conditions in the PCR instrument are: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 55°C annealing for 15 s, 72°C extension for 3 s, for a total of 35 cycles, and 72°C post-extension for 5 min. After the PCR reaction is completed, take 8 µL of sample for agarose gel electrophoresis to see if the size of the electrophoresis band meets the theoretical value. Transfer the bacterial solution with the correct band to 3 mL of liquid LB containing kanamycin for expansion culture. Incubate at 37°C and 200 rpm for 16 h. Use a plasmid extraction kit to extract the plasmid and run agarose gel electrophoresis. Send the extracted plasmid to Biotech for further sequencing. SP-L sequence: GTCGTGCTCCACATGTTG; SP-R sequence: CCCGACATAGATGCAATAACTTC.

[0041] A preferred embodiment is as follows: in step (8), take 100 μL of competent Agrobacterium stored at -80°C, divide it into two tubes, wait for it to melt in an ice bath, add 2 μL of correctly sequenced plasmid DNA, gently stir the bottom of the centrifuge tube by hand to mix it, let it stand on ice for 5 min, liquid nitrogen for 5 min, 37°C water bath for 5 min, and ice bath for 5 min in sequence; add 700 μL of antibiotic-free LB liquid culture medium, shake and culture at 28°C for 3 h; centrifuge at 5000 rpm for 5 min to collect the bacteria, retain about 200 μL of supernatant, blow and pipette to mix and resuspend the bacteria, spread it on LB-Kana / Rif solid LB culture medium, and invert it in a 28°C incubator for 2-3 days.

[0042] The preferred implementation is: in step (9), the constructed SlERF.D2 -A single colony of Agrobacterium carrying the CRISPR-Cas9 vector was dissolved in 10 µL of sterile water to prepare a bacterial solution, which was added to 3 mL of liquid LB medium containing Kana and Rif, and cultured overnight at 28°C at 200 rpm. Subsequently, 400 µL was added to 30 mL of liquid LB medium containing Kana and Rif, and cultured at 28°C at 200 rpm for 3-6 h. The OD value of the bacterial solution was detected by a spectrophotometer. 600 The cells were collected by centrifugation at 5000 rpm for 5 min at room temperature, the supernatant was discarded, and the cell pellet was diluted with sterile water to OD 600 The concentration of 0.1-0.15 was used immediately after preparation. After pre-culture in the dark for 2 days, the tomato cotyledons and stem segments were immersed in the diluted Agrobacterium infection solution. After shaking and infecting for 5 minutes, the infection solution was poured out. The cotyledons and stem segments were placed on culture media containing different plant hormones for germination, bud elongation, and rooting. The rooted explants were transferred to nutrient soil for subsequent sequencing and identification, and then the transformed tomato plants were obtained. Subsequently, the upstream and downstream primers of the target were designed, the DNA of the transgenic tomato plants was extracted, PCR amplification was performed, and sequencing and identification were performed. SlERF.D2 Whether the gene has been edited.

[0043] Example 2: A gene and method for improving drought resistance of tomato fruit plants A gene for improving drought resistance of tomato fruit plants, the nucleotide sequence of the gene for tomato fruit ripening is shown in Seq No.1.

[0044] Seq No.1: ATGTATTCAGGGTATTGTGATTCTCAGGCGAGAGATATGTCGGAGATGGTGACGGAGTTTACACGTGTGGTATCGGGTCAGGATTATCGACCCGATACCAGATGTTATTCGGTTAATTCACCGTCTCCGGCTTATTCTTCGTCCAGCTCGGGTTCTAGAGCTGGACTGAAGAGAAGCCGTGATCAACAAGAATTTGGAACTGGGTTGTCATCTTCTTCCTCTGTTAAAATTGAAGAAGCTACAAGTATGGTTGCACCAATTCCCGCTTTCACAACCACAATCACAACCACGACCACAACAGGTGAGGGTTCGAGCGAAGAAACAGGAGGAGATAGGAGGAGGAAATACAGAGGTGTACGACAACGACCATGGGGTAAATGGGCAGCGGAAATAAGAGATCCACATAAAGCCGCCAGAGTTTGGTTAGGAACATTCGATACAGCAGAAGCTGCAGCAAGAGCATATGATGAAGCTGCATTGAGATTTCGAGGAAACAGAGCAAAACTCAACTTCCCTGAGAACGCCAGATTGTCATCGTTACCACAAACACAAAATACTGTAACGTCAACAATCTCCAATCCATCCCCTCTAATAGCTCAACCAACGTCGTTCCTCAATCCTATCCAGAGTTCAGATACAACAAGAGACTACTGGGAATACTCACAATTGTTGCAAAATCCAGGAGATTTTACGGATCAACAACCATCAAACTTATTGGAACAAATGTTCGTTGCCTCATCGATGGCAATGTTGCATTCAAACACATTGCCATTAATATCTTCGTCTTCATCGTTAGCTACATCAGCAACTTCTTCAACGTCATATCCCCTGTTATTTTCGAGTTATTACACACCACAAACTAATCAAATTCAAGGAACCAACACAAGTAGCACCAGCACCACTAGCAGCTCAAGTTTTTCTACAACATTTTGGAGTAGCTCTAGCCAATATCCTCCATCTTCTAGTTAA A method for improving drought resistance of tomato fruit plants comprises the following steps: Step 1: Preparation of gRNA target adapter primer; Step 2: Construction of gRNA expression cassette: Prepare an enzyme ligation reaction solution containing the target adapter primer in step 1, and use the cutting and ligation method to connect the target adapter to the gRNA expression cassette to expand the gRNA expression cassette; Step 3: Using the product of step 2 as a template, perform a first round of PCR amplification; then use the first round of PCR product as a template to perform a second round of PCR amplification, use agarose gel electrophoresis to detect the product concentration, and then use a DNA purification kit to purify and recover the second round of PCR products; Step 4: Use the cutting and ligation method to connect the purified product of step 3 with the CRISPR-Cas9 plasmid to obtain a connected plasmid; Step 5: Transform the plasmid connected in step 4 into E. coli DH5α competent cells; Step 6: Pick the positive monoclonal colonies obtained in step 5 for PCR identification, and perform agarose gel electrophoresis on the obtained products to obtain SlERF.D2 -CRISPR-Cas9 plasmid; Step 7: SlERF.D2 -CRISPR-Cas9 plasmid was transformed into EHA105 Agrobacterium competent cells to obtain the constructed SlERF.D2 - Single colony of Agrobacterium carrying CRISPR-Cas9 vector; Step 8: Construct SlERF.D2 -Genetic transformation of tomato with a single colony of Agrobacterium tumefaciens expressing CRISPR-Cas9 vector.

[0045] A preferred embodiment is as follows: the preparation of the gRNA target primer adapter is to first dissolve the target adapter primer into a 100 µM master solution, then respectively dilute the target one forward primer F1 and R1 primer and the target one reverse primer R1 to 1 µM to obtain a first mixed primer, and dilute the target two forward primer F2 and the target two reverse primer R2 to 1 µM to obtain a second mixed primer; 80-100°C for 30s, and then transfer to room temperature for cooling to complete annealing; The nucleotide sequence of the target adapter primer is as follows: Target one forward primer-F1: 5′-gtcaCAGCAGCAACCAAGGCTTAC-3′; Target one reverse primer-R1: 5′-aaacGTAAGCCTTGGTTGCTGCTG-3′; Target two forward primer-F2: 5′-gtcaTTCTTCAGCGCCTGCTGCTG-3′; Target two reverse primer-R2: 5'-aaacCAGCAGCAGGCGCTGAAGAA-3'.

[0046] The preferred embodiment is: in step 2, To ensure BsaI Enzyme activity, first BsaI The enzyme activity was tested in 10 µL reaction system, which contained BsaI 0.5 µL of enzyme, 1 µL of RNA-U# plasmid, 1 µL of 10× Cutsmart buffer, ddH2O supplemented to 10 µL, PCR program set to 37°C, 15 min, then agarose gel electrophoresis to check whether the target band is cut out; if the target band is cut out, it means BsaI The enzyme activity is good and can be used; The target linker and gRNA expression cassette are cut and connected by a cutting and connecting method, including: gRNA-U# plasmid 1 µL, first mixed primer 0.5 µL, BsaI Enzyme 0.4 µL, 1 µL 10× Cutsmartbuffer, 0.1 µL T4 DNA ligase, 0.5 µL 10× T4 DNA ligase buffer, ddH2O supplemented to 10 µL, PCR program set to 37°C 5 min, 20°C 5 min, 5 cycles to obtain the first ligation product; gRNA-U# plasmid 1 µL, second mixed primer 0.5 µL, BsaI Enzyme 0.4 µL, 1 µL 10× Cutsmartbuffer, 0.1 µL T4 DNA ligase, 0.5 µL 10× T4 DNA ligase buffer, add ddH2O to 10 µL, set the PCR program to 37°C 5 min, 20°C 5 min, 5 cycles to obtain the second ligation product.

[0047] A preferred implementation is: in step 3, Each gRNA expression cassette contains 2 rounds of PCR reactions. In the first round of PCR, there are 4 reactions in total, and the total reaction system is 50 μL; Reaction 1 of target one is as follows: take 1 μL of the first ligation product as template, 2 μL UF, 2 μL target one reverse primer R1, 1 μL Super-Fidelity DNA Polymerase, 10 μL 5×Super-Fidelity DNA Polymerase buffer, 1 μL dNTPs, and add ddH2O to 50 μL to obtain the third ligation product; Reaction 2 of target one is as follows: take 1 μL of the first ligation product as template, 2 μL of gRNA-R, 2 μL of target one forward primer F1, 1 μL Super-Fidelity DNA Polymerase, 10 μL 5×Super-Fidelity DNA Polymerase buffer, 1 μL dNTPs, and add ddH2O to 50 μL to obtain the fourth ligation product; Reaction 1 of target 2 is as follows: take 1 μL of the second ligation product as template, 2 μL UF, 2 μL of target 2 reverse primer R1, 1 μL Super-Fidelity DNA Polymerase, 10 μL 5×Super-Fidelity DNA Polymerase buffer, 1 μL dNTPs, and add ddH2O to 50 μL to obtain the fifth ligation product; Reaction 2 of target 2 is as follows: 1 μL of the second ligation product as template, 2 μL of gRNA-R, 2 μL of target 2 forward primer F1, 1 μL of Super-Fidelity DNA Polymerase, 10 μL of 5×Super-Fidelity DNA Polymerase buffer, 1 μL of dNTPs, and ddH2O supplemented to 50 μL to obtain the sixth ligation product; The PCR program was set as follows: 95°C pre-denaturation for 1 min, 95°C denaturation for 10 s, 60°C annealing for 15 s, 72°C extension for 15 s, 25 cycles; and finally 72°C extension for 10 min. After the amplification, 5 μL of the product was taken and detected by 2% agarose gel electrophoresis; UF: 5'-CTCCGTTTTACCTGTGGAATCG-3'; gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3'; Before the second round of PCR reaction, the position-specific primer pairs were pre-mixed into 10× working solutions, each at 1.5 µM: primer combination working solution PT1 = 1.5 µL B1' + 1.5 µL B2 + 7 µL ddH2O, primer combination working solution PT2L = 1.5 µL B2' + 1.5 µL BL + 7 µL ddH2O; The target site 1 reaction system is: 1 µL each of the third and fourth ligation products of the first round of PCR amplification, 3 µL of primer combination working solution PT1, 0.6 µL of dNTPs, 0.6 µL of Super-Fidelity DNA Polymerase, 6 µL of 5×Super-Fidelity DNA Polymerase buffer, and 17.8 µL of ddH2O. Mix well and place in a PCR instrument to amplify the seventh ligation product. The target site 2 reaction system is: 1 µL each of the fifth and sixth ligation products of the first round of PCR amplification, 3 µL of primer combination working solution PT2L, 0.6 µL of dNTPs, 0.6 µL of Super-Fidelity DNA Polymerase, 6 µL of 5×Super-Fidelity DNA Polymerase buffer, and 17.8 µL of ddH2O. Mix well and place in a PCR instrument to amplify the eighth ligation product. The PCR reaction conditions were as follows: 95°C, 1 min; 95°C, 10 s, 60°C, 15 s, 72°C, 15 s, 18 cycles; 72°C, 10 min; 4°C, ∞; B1': 5'-TTCAGAGGTCTCTCTCGACTAGTGGAATCGGCAGCAAAGG-3'; B2: 5'-AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC-3'; B2': 5'-TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG-3'; BL: 5'-AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC-3'.

[0048] A preferred implementation is: in step 4, The PCR reaction was performed using the cutting and ligation method; the reaction system was: 0.2 µL of the purified product from step 3, 1 µL of CRISPR-Cas9 plasmid, BsaI Enzyme 0.5 µL, 10× BsaI1.5µL of buffer, 11.8µL of ddH2O, and digestion at 37℃ for 10min; add 0.4µL of 10×NEB T4 DNA ligase buffer and 0.1µL of T4 DNA ligase, set the PCR instrument at 37℃ for 2 min, 10℃ for 3 min, 20℃ for 5 min, 13 cycles, and finally at 37℃ for 2 min to obtain the ligated plasmid; the purified product in step 3 refers to the product obtained by mixing the seventh ligation product and the eighth ligation product in a volume ratio of 1:1 and then purifying.

[0049] A preferred implementation is: in step 5, 5 µL of the connected plasmid is transferred into 50 µL of Escherichia coli DH5α competent cells, the bottom of the centrifuge tube is shaken by hand to make it uniform, ice bath for 25 min, heat shock at 42°C for 45 s, and ice bath for 2 min; 350 µL of liquid LB culture medium is added thereto, and the bacteria are shaken in a shaker at 37°C and 200 rpm for 1 h; the cultured bacterial solution is centrifuged at 6000 rpm for 1 min, 100 µL of supernatant is retained, the bacterial solution is blown and mixed, and then coated on solid LB containing kanamycin, and inverted in a 37°C incubator for overnight culture.

[0050] A preferred embodiment is as follows: in step 6, the identification system is 25 µL: 2 µL of the bacterial solution obtained in step 5, 1 µL of each of SP-L / SP-R primers, 12.5 µL of 2×Taq enzyme, and 8.5 µL of ddH2O; the reaction conditions in the PCR instrument are: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 55°C annealing for 15 s, 72°C extension for 15 s, a total of 35 cycles, and 72°C post-extension for 5 min; after the PCR reaction is completed, 8 µL of the sample is taken for agarose gel electrophoresis detection to see whether the size of the electrophoresis band meets the theoretical value, and the bacterial solution with the correct band is transferred to 3 mL of liquid LB containing kanamycin for expansion culture, and cultured at 37°C and 200 rpm for 16 h. The plasmid is extracted using a plasmid extraction kit and agarose gel electrophoresis is performed for detection, and the extracted plasmid is further sequenced to obtain SlERF.D2 -CRISPR-Cas9 plasmid.

[0051] The preferred embodiment is as follows: in step 7, take 100 μL of EHA105 Agrobacterium competent cells, divide them into two tubes, wait for them to melt in an ice bath, add 1 μL SlERF.D2-CRISPR-Cas9 plasmid, stir the bottom of the centrifuge tube by hand to mix it, let it stand on ice for 5 min, liquid nitrogen for 5 min, 37℃ water bath for 5 min, ice bath for 5 min; add 700 µL of LB liquid medium without antibiotics, shake and culture at 28℃ for 2-3h; centrifuge at 5000 rpm for 5 min to collect the bacteria, keep about 200 µL of supernatant, resuspend the bacteria, spread on LB-Kana / Rif solid medium, invert and culture at 28℃ incubator for 2-3 days to obtain the constructed SlERF.D2 - Single colony of Agrobacterium carrying the CRISPR-Cas9 vector.

[0052] The preferred implementation is: in step 8, the constructed SlERF.D2 -CRISPR-Cas9 vector, dissolved in 10 µL sterile water to make bacterial solution, added to 3 mL of liquid LB medium containing Kana and Rif, 200 rpm, 28 ° C overnight culture, then took 400 µL in 30 mL of liquid LB medium containing Kana and Rif, 200 rpm, 28 ° C shaking culture for 6-7 h, and detected by spectrophotometer until the bacterial solution OD 600 The cells were collected by centrifugation at 5000 rpm for 5 min at room temperature, the supernatant was discarded, and the cells were precipitated with sterile water until the OD 600 0.1-0.15; pre-culture the tomato cotyledons and stem segments in the dark for 2 days and then immerse them in the diluted Agrobacterium infection solution. After infection for 5 minutes, pour out the infection solution, place the cotyledons and stem segments on culture media containing different plant hormones for germination, bud elongation, and rooting, transfer the rooted explants to nutrient soil for culture, and perform subsequent sequencing and identification to obtain transformed tomato plants. Then design upstream and downstream primers of the target, extract tomato plant DNA, perform PCR amplification using tomato DNA as a template, and analyze through sequencing and identification. SlERF.D2 Whether the gene has been edited.

[0053] one: SlERF.D2 Identification of gene-edited tomato plants Constructed using CRISPR / Cas9 technology and tissue culture technology SlERF.D2 Gene-edited tomato plants will grow to the T1 generation SlERF.D2 -Cas9 tomato plants were cut to extract DNA from 0.1 g of leaves. After cloning the fragments, the amplified products were sequenced and the sequencing results were decoded. Compared with the reference sequence, SlERF.D2 -Cas9 plant DNA sequences both strands were missing 4bp, a homozygous mutation. The sequencing peaks were compared, and compared with the WT plant, slerf.d2 tomato was missing 4 bp, which is consistent with the above results, indicating that this strain is slerf.d2Homozygous deletion ( Figure 1 ).

[0054] two: slerf.d2 Drought stress in tomato plants By recording WT and slerf.d2 Drought resistance of tomato plants under drought conditions, judging slerf.d2 The function of the gene in tomato plants. After about 12 days of dehydration treatment, compared with the wild type (WT), slerf.d2 The mutant showed severe signs of leaf curling and wilting ( Figure 2 ). At the same time, the phenotype of tomato leaves in vitro was observed on the 15th day after drought treatment and the leaves were dried. slerf.d2 Leaves showed a higher water loss rate than WT ( Figure 3 , 4). After rehydration treatment, it was found that the leaves of WT had withered and could not grow new leaves, while slerf.d2 Can grow fresh green leaves, prove slerf.d2 Tomato plants have strong drought resistance ( Figure 5 ).

[0055] The above description is only used to explain the preferred embodiments of the present invention, and is not intended to limit the present invention in any form. Therefore, any modifications or changes made to the present invention under the same inventive spirit should still be included in the scope of protection intended by the present invention.

Claims

1. A gene for improving drought resistance of tomato plants, characterized in that: The nucleotide sequence is shown in Seq No.

1.

2. A method for improving drought resistance of tomato plants, characterized in that: The following steps are involved: Step 1: Preparation of gRNA target adapter primer; Step 2: Construction of gRNA expression cassette: Prepare an enzyme ligation reaction solution containing the target adapter primer in step 1, and use the cutting and ligation method to connect the target adapter to the gRNA expression cassette to expand the gRNA expression cassette; Step 3: Using the product of step 2 as a template, perform a first round of PCR amplification; then use the first round of PCR product as a template to perform a second round of PCR amplification, use agarose gel electrophoresis to detect the product concentration, and then use a DNA purification kit to purify and recover the second round of PCR product to obtain a purified product; Step 4: Use the cutting and ligation method to connect the purified product of step 3 with the CRISPR-Cas9 plasmid to obtain a connected plasmid; Step 5: Transform the plasmid connected in step 4 into E. coli DH5α competent cells to obtain positive monoclonal colonies; Step 6: Pick the positive monoclonal colony obtained in step 5 for PCR identification. If it is correct, extract the plasmid to obtain SlERF.D2 -CRISPR-Cas9 plasmid; Step 7: SlERF.D2 -CRISPR-Cas9 plasmid was transformed into EHA105 Agrobacterium competent cells to obtain the constructed SlERF.D2 - Single colony of Agrobacterium carrying CRISPR-CAS9 vector; Step 8: Construct SlERF.D2 -Genetic transformation of tomato with a single colony of Agrobacterium tumefaciens expressing CRISPR-Cas9 vector.

3. The method for improving drought resistance of tomato fruit plants according to claim 2, characterized in that: The preparation of the gRNA target primer adapter includes: firstly preparing a 100 µM master solution of target one forward primer-F1, a target one reverse primer-R1, and a target two forward primer-F2, respectively, and then respectively mixing and diluting the target one forward primer-F1 master solution and the target one reverse primer-R1 master solution to 1 µM to obtain a first mixed primer, and mixing and diluting the target two forward primer-F2 master solution and the target two reverse primer-R2 master solution to 1 µM to obtain a second mixed primer; 90°C for 30s, and then transferring to room temperature for cooling to complete annealing; Target one forward primer-F1: 5′- gtcaTACACGTGTGGTATCGGGTC -3′; Target one reverse primer-R1: 5′- aaacGACCCGATACCACACGTGTA -3′; Target two forward primer-F2: 5′- gtcaGGTGTACGACAACGACCAT -3′; Target two reverse primer-R2: 5'-aaacATGGTCGTTGTCGTACACC -3'.

4. The method for improving drought resistance of tomato fruit plants according to claim 3, characterized in that: In step 2, the target linker is connected to the gRNA expression cassette by cutting and ligating, and the gRNA expression cassette is expanded, including: gRNA-U# plasmid 1 µL, first mixed primer 0.5 µL, BnS 0.4 µL of enzyme, 1 µL of 10×Cutsmart buffer, 0.1 µL of T4 DNA ligase, 0.5 µL of 10×T4 DNA ligase buffer, ddH2O supplemented to 10 µL, PCR program set to 37°C, 5 min; 20°C, 5 min; 5 cycles to obtain the first ligation product; gRNA-U# plasmid 1 µL, second mixed primer 0.5 µL, BnS Enzyme 0.4 µL, 10×Cutsmart buffer 1 µL, T4 DNA ligase 0.1 µL, 10×T4 DNA ligase buffer 0.5 µL, ddH2O supplemented to 10 µL, PCR program set to 37℃ 5 min, 20℃ 5 min, 5 cycles to obtain the second ligation product.

5. The method for improving drought resistance of tomato fruit plants according to claim 4, characterized in that: In step 3, Each gRNA expression cassette contains 2 rounds of PCR reactions. In the first round of PCR, there are 4 reactions in total; Reaction 1 of target one is as follows: take 1 μL of the first ligation product as template, 2 μL UF, 2 μL target one reverse primer R1, 1 μL Super-Fidelity DNA Polymerase, 10 μL 5×Super-Fidelity DNA Polymerasebuffer, 1 μL dNTPs, and add ddH2O to 50 μL to obtain the third ligation product; Reaction 2 of target one is as follows: take 1 μL of the first ligation product as template, 2 μL of gRNA-R, 2 μL of target one forward primer F1, 1 μL Super-Fidelity DNA Polymerase, 10 μL 5×Super-Fidelity DNA Polymerasebuffer, 1 μL dNTPs, and add ddH2O to 50 μL to obtain the fourth ligation product; Reaction 1 of target 2 is as follows: take 1 μL of the second ligation product as template, 2 μL UF, 2 μL of target 2 reverse primer R1, 1 μL Super-Fidelity DNA Polymerase, 10 μL 5×Super-Fidelity DNA Polymerasebuffer, 1 μL dNTPs, and add ddH2O to 50 μL to obtain the fifth ligation product; Reaction 2 for target 2 is as follows: 1 μL of the second ligation product as template, 2 μL of gRNA-R, 2 μL of target 2 forward primer F1, 1 μL of Super-Fidelity DNA Polymerase, 10 μL of 5×Super-Fidelity DNA Polymerasebuffer, 1 μL of dNTPs, and ddH2O supplemented to 50 μL to obtain the sixth ligation product; The PCR program was set as follows: 95°C pre-denaturation for 1 min, 95°C denaturation for 10 s, 60°C annealing for 15 s, 72°C extension for 15 s, 25 cycles; the final extension was 72°C for 10 min; detection was performed after the amplification was completed; UF: 5'-CTCCGTTTTACCTGTGGAATCG-3'; gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3'; Before the second round of PCR reaction, the position-specific primer pairs were mixed into 10× working solution, each with 1.5 µM: primer combination working solution PT1 = 1.5 µL of B1' + 1.5 µL of B2 + 7 µL of ddH2O, primer combination working solution PT2L = 1.5 µL of B2' + 1.5 µL of BL + 7 µL of ddH2O; The target site 1 reaction system is: 1 µL of the third ligation product and the fourth ligation product of the first round of PCR amplification, 3 µL of primer combination working solution PT1, 0.6 µL of dNTPs, 0.6 µL of Super-Fidelity DNA Polymerase, 6 µL of 5×Super-Fidelity DNA Polymerase buffer, 17.8 µL of ddH2O, mixed and placed in a PCR instrument to amplify the seventh ligation product; The target site 2 reaction system is: 1 µL each of the fifth and sixth ligation products of the first round of PCR amplification, 3 µL of primer combination working solution PT2L, 0.6 µL of dNTPs, 0.6 µL of Super-Fidelity DNA Polymerase, 6 µL of 5×Super-Fidelity DNA Polymerase buffer, and 17.8 µL of ddH2O. Mix well and place in a PCR instrument to amplify the eighth ligation product. The PCR reaction conditions were as follows: 95°C, 1 min; 95°C, 10 s; 60°C, 15 s; 72°C, 15 s; 18 cycles; 72°C, 10 min; 4°C, ∞; B1': 5'-TTCAGAGGTCTCTCTCGACTAGTGGAATCGGCAGCAAAGG-3'; B2: 5'-AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC-3'; B2': 5'-TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG-3'; BL: 5'-AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC-3'.

6. The method for improving drought resistance of tomato fruit plants according to claim 5, characterized in that: In step 4, the purified product of step 3 is connected to the CRISPR-Cas9 plasmid by cutting and ligating, including: the reaction system is: 0.2 µL of the purified product of step 3, 1 µL of the CRISPR-Cas9 plasmid, BnS Enzyme 0.5 µL, 10× BnS Buffer 1.5µL, ddH2O11.8 µL, digest at 37℃ for 10 min; add 10×NEB T4 DNA ligase buffer 0.4 µL, T4 DNA ligase0.1µL, set the PCR instrument at 37℃ for 2 min; 10℃ for 3 min; 20℃ for 5 min; 13 cycles, and finally at 37℃ for 2 min to obtain the ligated plasmid; the purified product in step 3 refers to the product obtained by mixing the seventh ligation product and the eighth ligation product in a volume ratio of 1:1 and then purifying it.

7. The method for improving drought resistance of tomato fruit plants according to claim 2, characterized in that: In step 5, take 5 µL of the connected plasmid and transfer it into 50 µL of E. coli DH5α competent cells. Use your hands to stir the bottom of the centrifuge tube to make it even. Ice bath for 25 min, heat shock at 42°C for 45 s, and ice bath for 2 min. Add liquid LB medium and shake the cells at 37°C and 200 rpm in a shaker for 0.5-1.5 h. Centrifuge the cultured bacterial solution to take the supernatant, mix the bacterial solution by pipetting, and then spread it on solid LB medium containing kanamycin. Invert it in an incubator and culture it overnight to obtain positive monoclonal colonies.

8. The method for improving drought resistance of tomato fruit plants according to claim 2, characterized in that: In step 6, the identification system is 25 µL: 2 µL of the bacterial solution obtained in step 5, 1 µL of SP-L primer and SP-R primer, 12.5 µL of 2×Taq enzyme, and 8.5 µL of ddH2O; the reaction conditions in the PCR instrument are: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 55°C annealing for 15 s, 72°C extension for 15 s, a total of 35 cycles, and 72°C post-extension for 5 min; after the PCR reaction is completed, 8 µL of the sample is taken for agarose gel electrophoresis to see whether the size of the electrophoresis band meets the theoretical value, and the bacterial solution with the correct band is transferred to 3 mL of liquid LB containing kanamycin for expansion culture, and cultured at 37°C and 200 rpm for 16 h. The plasmid is extracted using a plasmid extraction kit and agarose gel electrophoresis is performed. The extracted plasmid is further sequenced to obtain SlERF.D2 -CRISPR-Cas9 plasmid; SP-L primer: GTCGTGCTCCACATGTTG; SP-R primer: CCCGACATAGATGCAATAACTTC.

9. The method for improving drought resistance of tomato fruit plants according to claim 2, characterized in that: In step 7, take 100 µL of EHA105 Agrobacterium competent cells, divide them into two tubes, wait for them to thaw in an ice bath, and add 1 µL SlERF.D2 -CRISPR-Cas9 plasmid, stir the bottom of the centrifuge tube by hand to mix it, let it stand on ice for 5 min, liquid nitrogen for 5 min, 37℃ water bath for 5 min, ice bath for 5 min; add 700 µL of LB liquid medium without antibiotics, shake and culture at 28℃ for 2-3h; centrifuge at 5000rpm for 5 min to collect bacteria, keep about 100 µL of supernatant, resuspend the bacteria, spread on LB-Kana / Rif solid medium, invert and culture at 28℃ incubator for 2-3 days to obtain the constructed SlERF.D2 - Single colony of Agrobacterium carrying the CRISPR-Cas9 vector.

10. The method for improving drought resistance of tomato fruit plants according to claim 2, characterized in that: In step 8, the constructed SlERF.D2 -CRISPR-Cas9 vector Agrobacterium single colony was dissolved in 10 µL sterile water to make bacterial solution, and the bacterial solution was added to 3 mL of liquid LB medium containing Kana and Rif, and cultured at 200 rpm and 28°C overnight. Then 400 µL was taken and added to 30 mL of liquid LB medium containing Kana and Rif, and cultured at 200 rpm and 28°C for 3-6 h. The bacterial solution was detected by spectrophotometer until the OD 600 The cells were collected by centrifugation at 5000 rpm for 5 min at room temperature, the supernatant was discarded, and the cells were precipitated with sterile water until the OD 600 is 0.1-0.15; the tomato cotyledons and stem segments are pre-cultured in the dark for 2 days and then immersed in the diluted Agrobacterium infection solution. The infection solution is poured out after 5 minutes of infection. The cotyledons and stem segments are placed on culture media containing different plant hormones for germination, bud elongation, and rooting. The rooted explants are transferred to nutrient soil for culture, and subsequent sequencing and identification are performed to obtain transformed tomato plants.

Images