Method for erasing sheep iCHI embryo apparent modification abnormity and application thereof

Abstract

The invention relates to the technical field of gene engineering, in particular to a method for erasing sheep iCHI embryo epigenetic modification abnormity and application of the method. The method provided by the invention comprises the following steps: transferring recombinant plasmids expressing protamine into sheep androgenetic haploid stem cells, then introducing the sheep androgenetic haploid stem cells into mature sheep oocytes, and after activation culture, obtaining sheep iCHI embryos with abnormal apparent modification erasure. Abnormal methylation in the iCHI embryo can be erased through transient expression of protamine in sheep AG-haESCs cells, the blastocyst rate of the prepared Pro-iCHI embryo is remarkably improved compared with that of the iCHI embryo and is similar to that of an IVF embryo, the Pro-iCHI embryo is used for embryo transplantation, a semi-cloning gene editing sheep can be obtained, and a material is provided for subsequent breeding application.

Description

Technical Field

[0001] The present invention relates to the field of gene engineering technology, and in particular to a method for erasing abnormal epigenetic modification of sheep iCHI embryos and an application thereof. Background Art

[0002] Androgenetic haploid embryonic stem cells (AG-haESCs), also known as "artificial sperm", can be used for sperm research and have solved the problem that sperm cannot be cultured in vitro. The semi-cloning technology mediated by AG-haESCs has a wide range of application prospects. It can be used to quickly prepare gene-edited animals and conduct genetic screening and molecular mechanism research at the individual level.

[0003] Semi-cloned sheep are prepared through the AG-haESCs technology (oocyte intracytoplasmic haSCs injection, iCHI). The AG-haESCs used to prepare iCHI embryos can also be gene-edited to obtain gene-edited semi-cloned animals. Like in vitro fertilized embryos, iCHI embryos can form pseudo-pronuclei and perform DNA demethylation. However, iCHI embryos have the same problems as somatic cell nuclear transfer (SCNT) during development, with abnormal epigenetic modifications, resulting in the inability of reconstructed embryos to develop into blastocysts in vitro. Therefore, erasing incorrect epigenetic modifications to obtain iCHI embryos is the key to obtaining semi-cloned animals. Summary of the invention

[0004] In order to solve the above problems, the present invention provides a method for erasing epigenetic modification abnormalities in sheep iCHI embryos and its application. The present invention can erase epigenetic modification abnormalities (abnormal methylation) in iCHI embryos by transiently expressing protamine in sheep AG-haESCs cells, thereby solving the problem that sheep iCHI embryos cannot develop into blastocysts.

[0005] In order to achieve the above object, the present invention provides the following technical solutions: The present invention provides a method for erasing abnormal epigenetic modification of sheep iCHI embryos, comprising the following steps: The recombinant plasmid expressing protamine was transferred into the ovine haploid stem cells to obtain episomal-Prm1 transient positive cells; Introducing the episomal-Prm1 transient positive cells into mature sheep oocytes to obtain Pro-iCHI embryos; After activating the Pro-iCHI embryos with ionomycin, sheep iCHI embryos with the epigenetic modification abnormalities erased were cultured.

[0006] Preferably, the method for constructing the recombinant plasmid comprises: Using pCW57-MCS1-P2A-MCS2-mDux vector as the backbone, double restriction enzyme digestion was performed with NheI and MluI to obtain a vector fragment of 7847 bp in size; Synthetic Contains Prm1 A recombinant fragment of a gene; the nucleotide sequence of the recombinant fragment is shown in SEQ ID NO.1; The vector fragment and the recombinant fragment are linked by DNA ligase to obtain a Prm1 plasmid; The Prm1 plasmid is digested through the NotI restriction site to obtain a linearized Prm1 plasmid; The pCRISPR-S12 vector was amplified by PCR using primers episomal-F and episomal-R to obtain a PCR product; the nucleotide sequences of the primers episomal-F and episomal-R are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively; The linearized Prm1 plasmid and the PCR product are homologously recombined to obtain the recombinant plasmid.

[0007] Preferably, the culturing method comprises: culturing the activated Pro-iCHI embryos in G1 culture medium for 3 days and then transferring them to G2 culture medium for 4 days.

[0008] Preferably, sheep haploid blastocysts are prepared and sheep haploid stem cells are cultured; the method for preparing sheep haploid blastocysts includes the first method or the second method; The first method comprises: removing the spindle in a mature sheep oocyte, injecting a sheep sperm into the cytoplasm, and obtaining a reconstructed embryo; activating the reconstructed embryo in ionomycin, and culturing the embryo in a culture medium containing 6-dimethylaminopurine until it forms a blastocyst, and obtaining the sheep haploid blastocyst; The second method comprises: removing the female pronucleus from the fertilized egg of the sheep, culturing it in a G1 culture medium to obtain a cleavage embryo; culturing the cleavage embryo in a G2 culture medium until it becomes a blastocyst, and obtaining the sheep haploid blastocyst; The method for culturing sheep haploid stem cells comprises: removing the zona pellucida from the sheep haploid blastocyst and placing the blastocyst in a FACE culture medium to culture the sheep haploid stem cells; the FACE culture medium is based on mTeSR1 as a basic culture medium and further comprises components of the following concentrations: 12-15 ng / mL fibroblast growth factor 2, 15-20 ng / mL activin A, 6-10 μM CHIR99021 and 4-8 μM IWR1-1-endo.

[0009] Preferably, in the first method, the concentration of ionomycin is 5-10 μM, the activation time is 5 min, and the concentration of 6-dimethylaminopurine in the culture medium is 2 mM.

[0010] Preferably, the concentration of ionomycin is 5 μM, and the activation time is 5 to 10 min.

[0011] The present invention provides the application of the method described in the above technical scheme in preparing gene-edited sheep.

[0012] The present invention provides a method for preparing a gene-edited sheep, comprising the following steps: Introducing gene editing reagents into sheep haploid stem cells to obtain gene-edited sheep haploid stem cells; The gene-edited sheep haploid stem cells are treated by the method described in the above technical solution to obtain gene-edited sheep iCHI embryos; The gene-edited sheep iCHI embryo is transplanted into an estrus recipient ewe to obtain a gene-edited sheep.

[0013] Preferably, the gene editing reagent comprises MSTN Reagents for gene editing.

[0014] Preferably, the MSTN The reagent for editing the gene includes an ePE plasmid; the construction method of the ePE plasmid includes: The pCMV-PE2-P2A-GFP plasmid was double-digested with SgrDI and PmeI to obtain a plasmid fragment of 8103 bp; The bGH poly-gRNA scaffold and the plasmid fragment are homologously recombined to obtain a recombinant fragment; the nucleotide sequence of the bGH poly-gRNA scaffold is shown in SEQ ID NO.4; The pCRISPR-S12 plasmid was double-digested with BamHI and PacI to obtain the pCRISPR-S12 plasmid fragment; The recombinant fragment and the pCRISPR-S12 plasmid fragment are homologously recombined to obtain an ePE backbone plasmid; The ePE backbone plasmid was double-digested with NheI and HindIII to recover a linearized ePE backbone plasmid of 18969 bp in size; The linearized ePE backbone plasmid and pegRNA are homologously recombined to obtain an ePE plasmid; the nucleotide sequence of the pegRNA is shown in SEQ ID NO.5.

[0015] Beneficial effects: The present invention provides a method for erasing epigenetic modification abnormalities in sheep iCHI embryos, comprising the following steps: transferring a recombinant plasmid expressing protamine into sheep haploid stem cells to obtain episomal-Prm1 transient positive cells; introducing the episomal-Prm1 transient positive cells into mature sheep oocytes to obtain Pro-iCHI embryos; activating the Pro-iCHI embryos with ionomycin, and culturing to obtain sheep iCHI embryos with erasing epigenetic modification abnormalities. The present invention can erase abnormal methylation in iCHI embryos by transiently expressing protamine in sheep AG-haESCs cells, and the blastocyst rate of the prepared Pro-iCHI embryos is significantly improved compared with that of iCHI embryos, and is similar to that of IVF embryos, providing materials for subsequent breeding applications, and semi-cloned gene-edited sheep can be obtained for embryo transplantation. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0017] Figure 1 Schematic diagram of iCHI embryo production; Figure 2 To determine the embryonic development rate before implantation of blastocysts obtained by iCHI, Pro-iCHI and IVF methods; Figure 3 The immunostaining results of H3K4me3, H3K9me3 and H3K27me3 in sheep AG-haESCs; Figure 4 To prepare using Pro-iCHI MSTN Gene-edited sheep MSTN Editing strategy diagram; Figure 5 for MSTN Gene-edited sheep and wild-type MSTN Sanger sequencing results of the targeted sites of the gene; Figure 6 for MSTNGene-edited sheep and wild-type MSTN Western blot analysis results of genes; Figure 7 for MSTN Physical picture of gene-edited sheep. DETAILED DESCRIPTION

[0018] The present invention provides a method for erasing abnormal epigenetic modification of sheep iCHI embryos, comprising the following steps: The recombinant plasmid expressing protamine was transferred into the ovine haploid stem cells to obtain episomal-Prm1 transient positive cells; Introducing the episomal-Prm1 transient positive cells into mature sheep oocytes to obtain Pro-iCHI embryos; After activating the Pro-iCHI embryos with ionomycin, sheep iCHI embryos with the epigenetic modification abnormalities erased were cultured.

[0019] The method provided by the present invention is an improved iCHI technology, which repairs the abnormal DNA methylation of iCHI embryos during development by transiently expressing protamine in sheep AG-haESCs cells, enabling them to develop into blastocysts for the subsequent production of semi-cloned animals.

[0020] As an embodiment, the method for preparing the recombinant plasmid comprises the following steps: Using pCW57-MCS1-P2A-MCS2-mDux vector as the backbone, double restriction enzyme digestion was performed with NheI and MluI to obtain a vector fragment of 7847 bp in size; Synthetic Contains Prm1 A recombinant fragment of a gene; the nucleotide sequence of the recombinant fragment is shown in SEQ ID NO.1; The vector fragment and the recombinant fragment are linked by DNA ligase to obtain a Prm1 plasmid; The Prm1 plasmid is digested through the NotI restriction site to obtain a linearized Prm1 plasmid; The pCRISPR-S12 vector was amplified by PCR using primers episomal-F and episomal-R to obtain a PCR product; the nucleotide sequences of the primers episomal-F and episomal-R are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively; The linearized Prm1 plasmid and the PCR product are homologously recombined to obtain the recombinant plasmid.

[0021] As an embodiment, the culture method comprises: culturing the activated Pro-iCHI embryos in G1 culture medium for 3 days and then transferring them to G2 culture medium for 4 days.

[0022] As an embodiment, sheep haploid blastocysts are prepared and sheep haploid stem cells are cultured; the method for preparing sheep haploid blastocysts includes the first method or the second method; The first method comprises: removing the spindle in a mature sheep oocyte, injecting a sheep sperm into the cytoplasm, and obtaining a reconstructed embryo; activating the reconstructed embryo in ionomycin, and culturing the embryo in a culture medium containing 6-dimethylaminopurine until it forms a blastocyst, and obtaining the sheep haploid blastocyst; The second method comprises: removing the female pronucleus from the fertilized egg of the sheep, culturing it in a G1 culture medium to obtain a cleavage embryo; culturing the cleavage embryo in a G2 culture medium until it becomes a blastocyst, and obtaining the sheep haploid blastocyst; The method for culturing sheep haploid stem cells comprises: removing the zona pellucida from the sheep haploid blastocyst and placing it in a FACE culture medium to culture the sheep haploid stem cells; the FACE culture medium is based on mTeSR1 as a basic culture medium and also includes the following components at the following concentrations: 12-15 ng / mL fibroblast growth factor 2, 15-20 ng / mL activin A, 6-10 μM CHIR99021 and 4-8 μM IWR1-1-endo. As another embodiment, the sheep haploid stem cells obtained by the FACE culture medium are sorted by flow cytometry every 5 generations to maintain the proportion of haploid stem cells.

[0023] As an embodiment, in the first method, the concentration of ionomycin is 5-10 μM, the activation time is 5-10 min, and the concentration of 6-dimethylaminopurine in the culture medium is 2 mM.

[0024] As an embodiment, the concentration of ionomycin is 5 μM, and the activation time is 5 to 10 min.

[0025] Based on the above advantages, the present invention provides the application of the method described in the above technical solution in preparing gene-edited sheep.

[0026] The present invention provides a method for preparing a gene-edited sheep, comprising the following steps: Introducing gene editing reagents into sheep haploid stem cells to obtain gene-edited sheep haploid stem cells; The gene-edited sheep haploid stem cells are treated by the method described in the above technical solution to obtain gene-edited sheep iCHI embryos; The gene-edited sheep iCHI embryo is transplanted into an estrus recipient ewe to obtain a gene-edited sheep.

[0027] As an embodiment, the gene editing reagent comprises MSTN Reagents for gene editing.

[0028] As an embodiment, the MSTN The reagent for editing the gene includes an ePE plasmid; the construction method of the ePE plasmid includes: The pCMV-PE2-P2A-GFP plasmid was double-digested with SgrDI and PmeI to obtain a plasmid fragment of 8103 bp; The bGH poly-gRNA scaffold and the plasmid fragment are homologously recombined to obtain a recombinant fragment; the nucleotide sequence of the bGH poly-gRNA scaffold is shown in SEQ ID NO.4; The pCRISPR-S12 plasmid was double-digested with BamHI and PacI to obtain the pCRISPR-S12 plasmid fragment; The recombinant fragment and the pCRISPR-S12 plasmid fragment are homologously recombined to obtain an ePE backbone plasmid; The ePE backbone plasmid was double-digested with NheI and HindIII to recover a linearized ePE backbone plasmid of 18969 bp in size; The linearized ePE backbone plasmid and pegRNA are homologously recombined to obtain an ePE plasmid; the nucleotide sequence of the pegRNA is shown in SEQ ID NO.5.

[0029] The ePE plasmid provided by the present invention can be used for sheep MSTN Gene editing to MSTN A single base mutation occurred in the 3'UTR region of the gene, G>A, and a 14-week premature baby was born. MSTN Gene-edited sheep.

[0030] To further illustrate the present invention, a method for erasing abnormal epigenetic modification of sheep iCHI embryos and its application provided by the present invention are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0031] Example 1 A non-genomic integration plasmid containing protamine (episomal-Prm1) was constructed as follows: The pCW57-MCS1-P2A-MCS2-mDux vector (Cat. No. 138320) purchased from the addgene website was used as the backbone, and double restriction digestion was performed using NheI and MluI to obtain two fragments of 2184 bp and 7847 bp. The 7847 bp fragment was recovered using an agarose gel DNA recovery kit (Tiangen) to obtain the vector fragment. Prm1 The vector fragment and the recombinant fragment of enhanced green fluorescent protein (EGFP) are linked by DNA ligase to obtain the Prm1 plasmid.

[0032] The Prm1 plasmid was single-digested through the NotI restriction site to obtain a linearized Prm1 plasmid.

[0033] The pCRISPR-S12 vector (addgene, catalog number 084031) was PCR amplified using primers episomal-F (shown in SEQ ID NO.2) and episomal-R (shown in SEQ ID NO.3) to obtain a PCR product of 4047 bp in size; The linearized Prm1 plasmid and the PCR product were homologously recombined through a part of the cloning kit (Novozyme) to obtain an episomal-Prm1 vector, in which the episomal vector element enables protamine to exert its effect and is not integrated into the genome.

[0034] Recombinant fragment (SEQ ID NO.1): 5'-CCAGATACCGATGCTGCCGCAGCAAAAGCAGGAGCAGATGCCGCCGTCGCAGGCGAAGATGTCGCAGACGGAGGAGGCGATGCTGCCGGCGGAGGAGGCGAAGATGCTGCCGTCGCCGCCGCTCATACACCATAAGGTGTAAAAAATACGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCAAGCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA-3'; episomal-F(SEQ ID NO.2): 5'-ACCACCGCACAGCAAAACGGGTAGCATATGCTTC-3'; episomal-R (SEQ ID NO.3): 5'-CAGGTCTGAAGATCAATGTCTGACGAGGGGCCAG-3'.

[0035] Example 2 1. Obtaining ovine haploid blastocysts: Mature oocytes were stained with 5 μg / mL Hoechst 33342 for 10 min, and the position of the spindle was determined by brief ultraviolet irradiation (1-2 s). The spindle was removed in M2 in vitro operating solution containing 5 μg / mL cytochalasin B (CB) using a Nikon inverted microscope with a 37°C hot stage, and a sperm was injected into the cytoplasm to obtain reconstructed embryos. The reconstructed embryos were then activated in 5 μM ionomycin for 5 min, and then placed in 2 mM 6-dimethylaminopurine at 37°C, 5% CO 2 Sheep haploid blastocysts can be obtained by incubating for 5 h under saturated humidity conditions.

[0036] 2. Culture of sheep haploid stem cells (AG-haESCs): The zona pellucida of sheep haploid blastocysts was removed in 0.25% pronase and then placed in FACE culture medium at 37°C and 5% CO. 2 The cells were cultured under saturated humidity until stem cell colonies grew out; the FACE culture medium was based on mTeSR1 culture medium and only contained the following components at the following concentrations: 4 μM IWR1-1-endo, 12 ng / mL fibroblast growth factor 2 (FGF2), 8 μM CHIR99021, and 15 ng / mL Activin A.

[0037] During the culture process, spontaneous diploidization will occur in the haploid embryos of sheep. In order to maintain the proportion of haploid cells, they are continuously sorted by flow cytometry during the culture process. The stem cells cultured for 5 generations were incubated with 10 μg / mL Hoechst 33342 at 37℃ for 30 min. Every 10 min, the cells were gently mixed to make the staining uniform. The cell population when n=1 was selected for collection, the spontaneous diploid stem cells were removed, and the stem cells were purified. The flow sorting results showed that the proportion of haploid embryos in sheep can reach 20% in the first sorting. With the increase of sorting times (5-6 times), the proportion can eventually reach 70%.

[0038] 3. Discard the culture medium and feeder cells of the sheep AG-haESCs after flow sorting in step 2, and then resuspend the remaining sheep AG-haESCs in FACE culture medium mixed with 5 μg episomal-Prm1 vector (constructed in Example 1), then add the cells to an electroporation cup, pass a voltage of 220 V, and perform electric shock to obtain episomal-Prm1 transiently transfected positive AG-haESCs.

[0039] 4. Preparation of Pro-iCHI blastocysts in sheep (see partial process diagram Figure 1 A): Using a Nikon inverted microscope with a 37°C hot stage, an episomal-Prm1 transiently positive AG-haESCs was injected into a mature sheep oocyte in M2 in vitro operating solution containing 5 μg / mL cytochalasin B (CB) to obtain Pro-iCHI embryos; the Pro-iCHI embryos were placed in KSOM-AA culture medium for buffering for 1 hour, and then activated with 5 μM ionomycin for 5 minutes to obtain activated reconstructed embryos; the activated reconstructed embryos were cultured in G1 culture medium for 3 days and then in G2 culture medium for 4 days to obtain sheep Pro-iCHI blastocysts, which can be used to prepare semi-cloned animals.

[0040] Comparative Example 1 Sheep AG-haESCs were cultured using the method of steps 1 and 2 in Example 2.

[0041] Preparation of sheep iCHI embryos: Using a Nikon inverted microscope with a 37°C hot stage, a sheep AG-haESCs was injected into a mature sheep oocyte in M2 in vitro operating solution containing 5 μg / mL cytochalasin B (CB) to obtain a reconstructed embryo; the reconstructed embryo was activated in 5 μM ionomycin for 5 min and then placed in 2 mM 6-dimethylaminopurine at 37°C and 5% CO. 2 After incubation for 5 h under saturated humidity conditions, sheep iCHI embryos were obtained. The morphological pictures of iCHI embryos formed by sheep haploid embryos are shown in Figure 1 In B, PB is the polar body; PPB is the pseudopolar body; scale bar is 100 μm.

[0042] Test Example 1 Preparation of IVF embryos: Place in vitro matured oocytes in fertilization solution, add sperm, and the sperm-egg ratio is 500:1. Wash away the sperm 6 hours after fertilization, place in G1 culture medium for 3 days, and then place in G2 culture medium for 4 days to blastocyst.

[0043] The development of the sheep Pro-iCHI blastocysts prepared in Example 2, the sheep iCHI embryos prepared in Comparative Example 1, and the IVF embryos prepared by the above method were observed and counted, and the experiment was repeated three times in parallel. The results are shown in Figure 2 and Table 1.

[0044] Table 1 Development of iCHI and Pro-iCHI preimplantation embryos

[0045] Note: *** is P <0.001, two-tailed t test was used; 2-cell cleavage rate = (number of 2 cells / number of 1-cell) × 100%, and the statistics of other cleavage periods were the number of cleavages at each time divided by the number of 2-cell cleavages, and the percentage was calculated.

[0046] The results show that the blastocyst rate of Pro-iCHI embryos is significantly higher than that of iCHI embryos and is close to that of IVF embryos. The method provided by the present invention can erase abnormal methylation in iCHI embryos by transiently expressing protamine in sheep AG-haESCs cells, so that Pro-iCHI embryos can develop into blastocysts, providing materials for subsequent breeding applications.

[0047] Test Example 2 The episomal-Prm1 transient positive cells prepared by the method of Example 2 at different times (0 h, 24 h and 48 h) were immunostained for trimethylation of the 4th lysine residue of histone H3 (H3K4me3), trimethylation of the 9th lysine residue of histone H3 (H3K9me3) and trimethylation of the 27th lysine residue of histone H3 (H3K27me3). The results are shown in Figure 3 , where the scale bar is 20 μm, 0 h refers to the episomal-Prm1 transiently positive cells 0 h after electroporation, 24 h refers to the episomal-Prm1 transiently positive cells 24 h after electroporation, and 48 h refers to the episomal-Prm1 transiently positive cells 48 h after electroporation.

[0048] The results showed that transiently expressed protamine could erase the abnormal H3K4me3, H3K9me3, and H3K27me3 modifications in iCHI embryos and compact the cell nucleus into a sperm-like structure.

[0049] Example 3 In order to better apply the Pro-iCHI method, the present invention selected the myostatin (Myostatin, MSTN ) gene and used Pro-iCHI technology to prepare gene-edited semi-cloned animals. MSTNThe gene is mainly expressed in skeletal muscle and is a member of the transforming growth factor β (TGFβ) superfamily. It is expressed in all tissues. MSTN When the gene mutates, it will cause the animal's muscle groups to be very developed, resulting in a "double muscle" phenotype. Therefore, the present invention selects this gene as the target site for sheep gene editing, which can not only improve the commercial value of the sheep, but also observe obvious traits.

[0050] The present invention uses Prime Editors (PE) as the MSTN The main working principle of the gene editing tool, PE editor, is to achieve precise insertion and deletion of multiple bases by "searching" and "replacing" the target site without introducing double-strand breaks and donor DNA templates. The editing principle of the guide editor is as follows Figure 4 As shown: Under the guidance of the spacer sequence on the guide RNA (pegRNA), nCas9 cuts the single-stranded DNA at the nickase, the PBS sequence (primer sequence) recognizes the complementary sequence before the nicking site, and reverse transcription is performed using the RTT sequence (transcription template sequence) as a template to polymerize the target sequence onto the nicked DNA chain, as follows: 1) The pCMV-PE2-P2A-GFP plasmid (purchased from addgene, catalog number #132776) was double-digested with SgrDI and PmeI, and the target fragment was obtained by DNA gel electrophoresis. The target fragment with a length of 8103 bp was recovered using a gel recovery kit (Tiangen) to obtain a linearized plasmid fragment.

[0051] 2) The bGH poly-gRNA scaffold sequence fragment was synthesized at Shanghai Bioengineering, and the bGH poly-gRNA scaffold sequence fragment and the linearized plasmid fragment recovered in step 1) were integrated together using ClonExpress Ultra One-Step Cloning Kit V2 (Vazyme) to obtain an integrated fragment. The nucleotide sequence of the bGH poly-gRNA scaffold sequence fragment is shown in SEQ ID NO.4, and is as follows: 5'--3'.

[0052] 3) The pCRISPR-S12 vector (addgene, product number Plasmid 084031) was double-digested with BamHI and PacI, and homologously recombined with the integration fragment obtained in step 2) to obtain an ePE backbone plasmid; the ePE backbone plasmid was double-digested with NheI and HindIII to recover a linearized ePE backbone plasmid of 18969 bp; pegRNA (SEQ ID NO.5) was artificially synthesized, and the linearized ePE backbone plasmid and pegRNA were homologously recombined to obtain an ePE plasmid for subsequent sheep transfection. MSTN Gene editing.

[0053] SEQ ID NO.5: 5'-ATTTATAAGTATTAAAATAAgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcAACATTCCATTATTTTAATACTTATATAAAT-3'; wherein, 5'-ATTTATAAGTATTAAAATAA-3' (SEQ ID NO.6) is the spacer sequence, 5'-gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc-3' (SEQ ID NO.7) is the gRNA scaffold, 5'-AACATTCCATTA-3' (SEQ ID NO.8) is the RTT sequence, and 5'-TTTTAATACTTATAAAT-3' (SEQID NO.9) is the PBS sequence.

[0054] 4) The sheep AG-haESCs were cultured by the method of steps 1 and 2 in Example 2, and the ePE plasmid obtained in step 3) was introduced into the sheep AG-haESCs. The gene editing results were detected by dideoxy sequencing (Sanger sequencing) and Western Blot. The results of the Sanger sequencing method are shown in Figure 5 , Western Blot test results are shown in Figure 6 The results show that MSTN A single base mutation of G>A was generated in the genome, and the expression level of MSTN protein was also lower than that of cells without gene editing (wild type, denoted as WT). MSTN Knockout sheep AG-haESCs.

[0055] 5) The obtained value in step 4) MSTN The knockout sheep AG-haESCs were resuspended in FACE culture medium mixed with 5 μg of episomal-Prm1 vector (constructed in Example 1), and then the cells were added to an electroporation cup and electroporated at 220 V to obtain MSTN Episomal-Prm1 knockout was transiently transfected into positive AG-haESCs.

[0056] 6) Using a Nikon inverted microscope with a 37°C hot stage, mature sheep oocytes were injected with a 5 μg / mL cytochalasin B (CB) solution obtained in step 5). MSTN Episomal-Prm1 knockout positive AG-haESCs were transiently transfected to obtain MSTNKnockout Pro-iCHI embryos; MSTN The knockout Pro-iCHI embryos were placed in KSOM-AA culture medium for 1 h, and then activated with 5 μM ionomycin for 5 min to obtain activated reconstructed embryos; the activated reconstructed embryos were cultured in G1 culture medium for 3 days and then in G2 culture medium for 4 days to obtain MSTN Knockout sheep Pro-iCHI blastocysts are used for subsequent embryo transfer.

[0057] 7) Synchronize estrus treatment of recipient ewes by vaginal plug implantation, cloprostenol and gonadotropin-releasing hormone, and transfer the obtained MSTN The knockout blastocysts were stored in M199 culture medium (Thermo) containing 15% (V / V) fetal bovine serum and surgically transplanted into recipient sheep using TomCat catheters (Sovereign). A total of 256 2-cell embryos were transplanted into 32 recipient sheep, with 8 embryos transplanted into each sheep, and a 14-week premature fetus was finally obtained. MSTN Gene-edited sheep (see Figure 7 and Table 2).

[0058] Table 2 Transplantation and production of Pro-iCHI embryos in sheep

[0059] Note: The wild type in Table 2 is the one without the ePE plasmid pair MSTN Gene-edited sheep Pro-iCHI blastocyst.

[0060] Example 4 A method similar to Example 2, except that the method for obtaining the ovine haploid blastocyst in step 1 is as follows: first, a fertilized egg is obtained by in vitro fertilization, the fertilized egg is stained with 5 μg / mL Hoechst33342 in G1 culture medium (Vitrolife) for 10 min, the position of the male and female pronuclei is determined by brief ultraviolet irradiation (1-2 s), and the female pronucleus is removed by micromanipulation, and then the egg is cultured in G1 culture medium (Vitrolife) for 72 h, and then transferred to G2 culture medium (Vitrolife) and incubated at 37°C, 5% CO 2 By culturing to blastocyst under saturated humidity conditions, sheep haploid blastocysts can be obtained.

[0061] The blastocyst rates of the androgenic embryos obtained by the two methods in Example 4 and Example 2 were similar, 25.68% and 25.36%, respectively.

[0062] In summary, the method provided by the present invention can erase abnormal methylation in iCHI embryos by transiently expressing protamine in sheep AG-haESCs cells, and the blastocyst rate of the prepared Pro-iCHI embryos is significantly improved compared with that of iCHI embryos, which is similar to that of IVF embryos. The Pro-iCHI embryos can also develop into blastocysts, providing materials for subsequent breeding applications, and semi-cloned gene-edited sheep can be obtained by embryo transplantation.

[0063] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for erasing epigenetic modification abnormalities in sheep iCHI embryos, It is characterized in that The following steps are involved: The recombinant plasmid expressing protamine was transferred into the ovine haploid stem cells to obtain episomal-Prm1 transient positive cells; Introducing the episomal-Prm1 transient positive cells into mature sheep oocytes to obtain Pro-iCHI embryos; After activating the Pro-iCHI embryos with ionomycin, sheep iCHI embryos with the epigenetic modification abnormalities erased were cultured.

2. The method according to claim 1, It is characterized in that The construction method of the recombinant plasmid comprises: Using pCW57-MCS1-P2A-MCS2-mDux vector as the backbone, double restriction enzyme digestion was performed with NheI and MluI to obtain a vector fragment of 7847 bp in size; Synthetic Contains Prm1 A recombinant fragment of a gene; the nucleotide sequence of the recombinant fragment is shown in SEQ ID NO.1; The vector fragment and the recombinant fragment are linked by DNA ligase to obtain a Prm1 plasmid; The Prm1 plasmid is digested through the NotI restriction site to obtain a linearized Prm1 plasmid; The pCRISPR-S12 vector was amplified by PCR using primers episomal-F and episomal-R to obtain a PCR product; the nucleotide sequences of the primers episomal-F and episomal-R are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively; The linearized Prm1 plasmid and the PCR product are homologously recombined to obtain the recombinant plasmid.

3. The method according to claim 1, It is characterized in that The culture method comprises: culturing the activated Pro-iCHI embryos in G1 culture medium for 3 days and then transferring them to G2 culture medium for 4 days.

4. The method according to claim 1, It is characterized in that The method for preparing sheep haploid stem cells comprises: preparing sheep haploid blastocysts and culturing sheep haploid stem cells; the method for preparing sheep haploid blastocysts comprises the first method or the second method; The first method comprises: removing the spindle in a mature sheep oocyte, injecting a sheep sperm into the cytoplasm, and obtaining a reconstructed embryo; activating the reconstructed embryo in ionomycin, and culturing the embryo in a culture medium containing 6-dimethylaminopurine until it forms a blastocyst, and obtaining the sheep haploid blastocyst; The second method comprises: removing the female pronucleus from the fertilized egg of the sheep, culturing it in a G1 culture medium to obtain a cleavage embryo; culturing the cleavage embryo in a G2 culture medium until it becomes a blastocyst, and obtaining the sheep haploid blastocyst; The method for culturing sheep haploid stem cells comprises: removing the zona pellucida from the sheep haploid blastocyst and placing the blastocyst in a FACE culture medium to culture the sheep haploid stem cells; the FACE culture medium is based on mTeSR1 as a basic culture medium and further comprises components of the following concentrations: 12-15 ng / mL fibroblast growth factor 2, 15-20 ng / mL activin A, 6-10 μM CHIR99021 and 4-8 μM IWR1-1-endo.

5. The method according to claim 4, It is characterized in that In the first method, the concentration of ionomycin is 5-10 μM, the activation time is 5 min, and the concentration of 6-dimethylaminopurine in the culture medium is 2 mM.

6. The method according to claim 1, It is characterized in that The concentration of ionomycin is 5 μM, and the activation time is 5 to 10 min.

7. Use of the method according to any one of claims 1 to 6 in the preparation of gene-edited sheep.

8. A method for preparing gene-edited sheep, It is characterized in that The following steps are involved: Introducing gene editing reagents into sheep haploid stem cells to obtain gene-edited sheep haploid stem cells; The gene-edited sheep haploid stem cells are treated by the method according to any one of claims 1 to 6 to obtain gene-edited sheep iCHI embryos; The gene-edited sheep iCHI embryo is transplanted into an estrus recipient ewe to obtain a gene-edited sheep.

9. The method according to claim 8, It is characterized in that The gene editing reagent comprises MSTN Reagents for gene editing.

10. The method according to claim 9, It is characterized in that The pair MSTN The reagent for editing the gene includes an ePE plasmid; the construction method of the ePE plasmid includes: The pCMV-PE2-P2A-GFP plasmid was double-digested with SgrDI and PmeI to obtain a plasmid fragment of 8103 bp; The bGH poly-gRNA scaffold and the plasmid fragment are homologously recombined to obtain a recombinant fragment; the nucleotide sequence of the bGH poly-gRNA scaffold is shown in SEQ ID NO.4; The pCRISPR-S12 plasmid was double-digested with BamHI and PacI to obtain the pCRISPR-S12 plasmid fragment; The recombinant fragment and the pCRISPR-S12 plasmid fragment are homologously recombined to obtain an ePE backbone plasmid; The ePE backbone plasmid was double-digested with NheI and HindIII to recover a linearized ePE backbone plasmid of 18969 bp in size; The linearized ePE backbone plasmid and pegRNA are homologously recombined to obtain an ePE plasmid; the nucleotide sequence of the pegRNA is shown in SEQ ID NO.5.

Images