COMPOSITIONS AND METHODS INCLUDING ENGINEERED INTRONUCLEAR SMALL RNA (snRNA)

Abstract

Disclosed herein are snRNA systems comprising an engineered stem loop.

Description

Reference to an electronic sequence listing

[0001] The contents of the electronic sequence listing (LOCN_020_001WO_SeqList_ST26.xml; size: 289,776 bytes; creation date: March 6, 2023) are incorporated herein by reference in its entirety. CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to and the benefit of U.S. Provisional Application No. 63 / 316,659, filed on March 4, 2022, and U.S. Provisional Application No. 63 / 379,983, filed on October 18, 2022. The contents of each of these applications are hereby incorporated by reference in their entirety. Technical Field

[0003] The present disclosure relates to molecular biology, gene therapy, and compositions and methods for modifying the expression and activity of RNA molecules. Background Art

[0004] There is a long-felt but unmet need in the art to provide effective therapeutics for correcting dysfunctional messenger RNA.

[0005] Small RNA (snRNA) in the nucleus is one of the smallest types of RNA, with an average size of about 150 nucleotides. snRNA is a functional non-coding RNA. The eukaryotic genome encodes a variety of non-coding RNAs (a class of highly abundant RNAs, such as snRNA), which are located in the nucleus and have important functions in intron splicing and RNA processing. In the pre-mRNA splicing process, snRNA can form ribonucleoprotein particles (snRNPs) together with other proteins. These snRNPs and other proteins form a large particle complex (spliceosome) that is bound to the pre-mRNA transcript of unspliced. In addition to splicing, snRNA also plays a role in the nuclear maturation of nascent transcripts, gene expression regulation, in non-classical systems as a splicing donor, and in the 3' end processing of replication-dependent histone mRNA. U7 snRNA can be programmed to bind and regulate mRNA without expressing exogenous proteins, but it is still necessary to develop a therapeutic agent that targets mRNA with a high degree of specificity that minimizes the immunogenicity risk. Furthermore, the small size of these programmed snRNAs creates opportunities for the development of single-vector, highly specific (allele-specific), single-target and multi-target gene therapy approaches.

[0006] Thus, the present disclosure provides compositions and methods comprising a new therapeutic RNA-targeting platform composed of engineered snRNAs. Summary of the invention

[0007] The present disclosure provides gene therapy compositions comprising a novel therapeutic targeting RNA platform consisting of engineered snRNA (esnRNA) comprising an engineered snRNA stem-loop (eSL).

[0008] Disclosed herein are compositions comprising nucleic acid molecules and vectors comprising engineered snRNA (esnRNA).

[0009] Disclosed herein are RNA-targeting nucleic acid molecules comprising an engineered snRNA (esnRNA) system, wherein the esnRNA system comprises an engineered stem-loop (eSL).

[0010] In one embodiment, the esnRNA comprises a 5' interaction stabilizer domain (5' ISD).

[0011] In one embodiment, the esnRNA comprises a targeting sequence (TS) (or spacer) targeting a target RNA. In another embodiment, the target RNA is a microsatellite repeat RNA or a non-repetitive RNA. In another embodiment, the target microsatellite repeat RNA is selected from CUG, CAG, GGGGCC and CCCCGG. In one embodiment, the esnRNA comprises a targeting sequence (TS) targeting two target RNAs (GGGGCC and CCCCGG). In another embodiment, the two target RNAs are microsatellite repeat RNAs and non-repetitive RNAs. In another embodiment, the non-repetitive RNA is a flanking sequence of a microsatellite repeat RNA. In another embodiment, the esnRNA comprises a targeting sequence (TS) targeting two or more target RNAs. In another embodiment, the esnRNA comprises two or more targeting sequences (TS) targeting two or more target RNAs. In another embodiment, the esnRNA comprises a fusion of two or more TS.

[0012] In one embodiment, the esnRNA comprises a Sm binding domain (SmBD). In one embodiment, the SmBD is selected from U1, U2, U4 and U5 snRNA. In another embodiment, the SmBD is derived from a pseudo snRNA.

[0013] In one embodiment, the esnRNA is operably linked to a snRNA promoter. In another embodiment, the snRNA promoter is a U7 promoter. In another embodiment, the U7 promoter is an endogenous U7 promoter. In another embodiment, the U7 promoter is a human U7 promoter (hU7) or a mouse U7 promoter (mU7). In another embodiment, the U7 promoter is an endogenous human U7 promoter of SEQ ID NO: 43. In one embodiment, the snRNA promoter is a U1 promoter. In another embodiment, the U1 promoter is a human U1 promoter or a mouse U1 promoter. In another embodiment, the snRNA promoter is selected from: a human U7 promoter, a human U1 promoter, a human U2 promoter, a human U4 promoter, a human U5 promoter, a human U6 promoter, a human 7sk promoter, a tRNA (Val) promoter, a mouse U1 promoter, and a mouse U7 promoter. In another embodiment, the vector comprises one or more esnRNAs, or one or more copies of esnRNAs driven by one or more snRNA promoters. In one embodiment, the vector comprises two copies (2x) of the esnRNA. In one embodiment, the vector comprises two snRNA promoters, wherein each promoter drives a copy of 2x esnRNA. In another embodiment, the two snRNA promoters are U7 promoter and U1 promoter. In another embodiment, the two snRNA promoters are selected from: human U7 promoter, human U1 promoter, human U2 promoter, human U4 promoter, human U5 promoter, human U6 promoter, human 7sk promoter, tRNA (Val) promoter, mouse U1 promoter, mouse U2 promoter, mouse U5 promoter, mouse U6 promoter, mouse U7 promoter and mouse H1 promoter. In another embodiment, the two snRNA promoters are mouse U7 promoter and mouse U1 promoter.

[0014] In one embodiment, the esnRNA is operably linked to a snRNA downstream terminator (DT). In another embodiment, the snRNA DT is a U7 DT.

[0015] In one embodiment, the esnRNA comprises the eSL, the U7 promoter, the TS, the SmBD, the 5'ISD and the DT. In another embodiment, the esnRNA comprises the eSL, the U7 promoter, the U1 promoter, the TS, the SmBD, the 5'ISD and the DT.

[0017] In one embodiment, the esnRNA comprises the eSL, the U7 promoter, the TS, the SmBD, the 5'ISD and the DT. In another embodiment, the esnRNA comprises the eSL, the U7 promoter, the U1 promoter, the TS, the SmBD, the 5'ISD and the DT.

[0018] Also disclosed herein is a vector comprising the esnRNA. In some embodiments, the vector comprises multiple copies of the esnRNA. In some embodiments, the multiple copies of the esnRNA are 2, 3 or 4 copies (2x, 3x or 4x) of the esnRNA. In some embodiments, the multiple copies of the esnRNA are 4 or more copies (4x or more) of the esnRNA. In some embodiments, each esnRNA in the multiple copies of the esnRNA is separated by a nucleic acid buffer sequence derived from a human non-coding genomic sequence downstream of the snRNA. In one embodiment, the buffer sequence is derived from a human genomic sequence downstream of U7. In one embodiment, the buffer sequence is selected from: buffer 1 (30bp, 100bp or 500bp), buffer 2 (30bp, 100bp or 500bp), buffer 3 (30bp, 100bp or 500bp) and combinations thereof. In one embodiment, the vector is a viral vector or a non-viral vector. In another embodiment, the viral vector is an AAV vector. In another embodiment, the AAV vector is a scAAV vector or a ssAAV vector. In another embodiment, the AAV vector is an AAV9 vector. In another embodiment, the AAV9 vector is a ssAAV9 vector or a scAAV9 vector.

[0019] Also disclosed herein is a method for targeting one or more target RNAs of interest, and blocking, knocking down, editing, exon skipping, exon inclusion, or splicing the one or more target RNAs, the method comprising contacting the esnRNA of the present disclosure with a cell containing the one or more target RNAs.

[0020] The present disclosure provides an RNA-targeting nucleic acid molecule, the RNA-targeting nucleic acid molecule comprising an engineered snRNA esnRNA, wherein the esnRNA system comprises an engineered stem-loop (eSL), the engineered stem-loop comprising one or more nucleic acid sequences selected from the following: SEQ ID NO: 1-SEQ ID NO: 11, SEQ ID NO: 146-SEQ ID NO: 148, SEQ ID NO: 163 or SEQ ID NO: 186-205.

[0021] In some embodiments, the esnRNA comprises a targeting sequence (TS) that targets a target RNA of interest.

[0022] In some embodiments, the target RNA is a pre-mRNA or mRNA sequence. In some embodiments, the target RNA of interest is a microsatellite repeat RNA. In some embodiments, the microsatellite repeat RNA is selected from CUG, CAG, and GGGGCC+CCCCGG.

[0023] In some embodiments, the target RNA is a sequence encoding DMD. In some embodiments, the targeting sequence is selected from SEQ ID NO: 206 or SEQ ID NO: 207. In some embodiments, the targeting sequence comprises one or more nucleic acid sequences shown in SEQ ID NO: 208-SEQ ID NO: 227.

[0024] In some embodiments, the esnRNA comprises two targeting sequences targeting two target RNAs. In some embodiments, the two TSs are fusion sequences.

[0025] In some embodiments, the esnRNA comprises a Sm binding domain (SmBD) selected from the group consisting of: U1, U2, U4, and U5 SmBD.

[0026] In some embodiments, the SmBD comprises a nucleic acid sequence shown in any one of SEQ ID NO:31-SEQ ID NO:38 or SEQ ID NO:164.

[0027] In some embodiments, the esnRNA comprises a 5' interaction stabilizer domain (5' ISD), the 5' interaction stabilizing domain comprising a nucleotide sequence selected from any one of SEQ ID NO: 12-SEQ ID NO:23.

[0028] In some embodiments, the esnRNA comprises a nucleic acid sequence shown in any one of SEQ ID NO:65-SEQ ID NO:119 or SEQ ID NO:179-SEQ ID NO:185.

[0029] The present disclosure provides a vector comprising one or more esnRNAs of the present disclosure. In some embodiments, the viral vector is an AAV vector. In some embodiments, the esnRNA is operably linked to a promoter.

[0030] In some embodiments, the esnRNA is operably linked to a U7 promoter or a U1 promoter.

[0031] In some embodiments, the esnRNA is operably linked to a downstream terminator (DT). In some embodiments, the esnRNA is operably linked to a U7 downstream terminator or a U1 downstream terminator.

[0032] In some embodiments, the vector comprises at least one, at least two, at least three, at least four, or at least five esnRNAs. In some embodiments, the at least one, at least two, at least three, at least four, or at least five esnRNAs each target the same target RNA sequence.

[0033] In some embodiments, the at least one, at least two, at least three, at least four, or at least five esnRNAs target two or more target RNA sequences. In some embodiments, each esnRNA is separated by a buffer sequence. In some embodiments, the buffer sequence comprises a nucleic acid sequence as shown in any one of SEQ ID NO: 24-SEQ ID NO: 30.

[0034] In some embodiments, the vector comprises the nucleic acid sequence shown in any one of SEQ ID NO:123-SEQ ID NO:143, SEQ ID NO:168-SEQ ID NO:178, or SEQ ID NO:231-SEQ ID NO:233.

[0035] A nucleic acid molecule targeting DMD exon 51 RNA, wherein the nucleic acid molecule targeting DMD exon 51 RNA comprises a spacer sequence shown in any one of SEQ ID NO: 206-SEQ ID NO: 230.

[0036] The present disclosure provides a method of treating a disease or disorder in a subject, the method comprising administering an RNA-targeting nucleic acid molecule of the present disclosure or an AAV vector of the present disclosure.

[0037] In some embodiments, the disease or disorder is associated with a toxic repeat RNA sequence. In some embodiments, the toxic repeat RNA sequence is a CAG, CUG, GGCCCC, CCGGG or GGCCC+CCGGGG RNA repeat.

[0038] In some embodiments, the disease or disorder is myotonic dystrophy (DM1) or Huntington's disease (HD).

[0039] In some embodiments, the disease or disorder is Duchenne muscular dystrophy.In some embodiments, the RNA-targeting nucleic acid molecule or AAV vector targets an RNA sequence encoding dystrophin (DMD).

[0040] In some embodiments, the RNA sequence encoding DMD comprises an intron sequence or an exon sequence. In some embodiments, the exon sequence comprises exon 51 or its flanking region of DMD. In some embodiments, the administration is intravenous, intramuscular, subpial, intrathecal, intraparenchymal, intrathecal, intrastriatal, subcutaneous, intradermal, intraperitoneal, intratumoral, intravenous, intraocular and / or parenteral administration. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0042] Figure 1A-Figure 1D . Figure 1A A tape station image of the PCR product is shown, where the abundance of the engineered SL is increased, indicating increased stability of the esnRNA disclosed herein. The predicted PCR product size is shown below the image. Figure 1B Schematic diagram illustrating an engineered snRNA (esnRNA) comprising an engineered stem-loop (eSL) disclosed herein compared to a non-engineered stem-loop. Figure 1C An alternative mechanism for protecting the 5' end of snRNA that forgoes the use of an interaction stabilizer domain (ISD) is shown. Figure 1D The approximate sizes of the snRNA cassettes are shown.

[0043] Figure 2A-2C . Figure 2A-2B FISH quantification and images of CUG RNA foci of esnRNAs targeting CUG disclosed herein compared to NT (non-targeting) esnRNAs are shown. The Y-axis depicts the average foci percentage per cell normalized to NT, and the x-axis depicts the treatment. The nuclei were stained with DAPI, and the CUG RNA foci were labeled with a specific marker probe. Figure 2C Schematic representation of esnRNA MOA that targets and blocks CUG repeat expansion, releases MBLN, and restores splicing defects characteristic of DM1 disease.

[0044] Figure 3A-3C . Figure 3A qPCR results for dose-dependent knockdown of CAG80 reporter mRNA to baseline levels are shown. The Y-axis depicts CAG repeat RNA expression levels relative to the reference gene GAPDH, and the x-axis depicts snRNA treatment, CAG targeting (CUG15) or non-targeting (nt) (using different doses, 250ng, 500ng or 1000ng). Figure 3BWestern blot of CAG80 reporter polyQ protein expression is shown. The top lane shows CAG reporter polyQ expression and the bottom lane shows GAPDH loading control. Figure 3C Shown are the CAG repeat expansion in the Huntington's disease mutant HTT and the esnRNA MOA that blocks the CAG repeat.

[0045] Figure 4A-4D . Figure 4A Shown are tape station images of PCR products detecting USH2A exon 13 inclusion (top band) or exclusion (bottom band) after treatment with esnRNA. Figure 4C Shown is the quantification of the percentage of exon 13 exclusion following esnRNA treatment compared to the NT esnRNA control (shown in A). Figure 4B Schematic representation of engineered snRNA comprising eSL compared to non-engineered snRNA is shown. Figure 4D A schematic diagram of splicing regulation in Usher syndrome and DMD (Duchenne muscular dystrophy) is shown.

[0046] Figure 5A-5F PCR results for recovery of splice isoforms of BIN1, DMD, and LBD3 (mis-spliced ​​in DM1 patient cells) after treatment with esnRNA to target CUG repeats in DM1 patient-derived myotubes are shown. Panels A-C show quantification of the percentage of recovery to healthy splice isoforms from the tape station images shown in panels D-F. The Y-axis depicts the percent correction, and the x-axis depicts the treatment (knt refers to non-targeted negative control; CAGx15 refers to esnRNA targeting CUG; unt refers to untreated).

[0047] Figure 6A-6B Quantification of the efficacy of esnRNAs with alternative 5' interaction stabilizing domains (ISDs) in knocking down CUG RNA foci is shown, synthetic snRNA transfection followed by fluorescent in situ hybridization for CUG RNA foci in CTG480 HeLa cells. (Light blue = alternative engineered stem-loop with corresponding 5'ISD. Dark blue = selected engineered stem-loop and corresponding 5'ISD. sR220004 = non-targeting snRNA). Synthetic snRNA transfections were performed at 33 nM (A) or 11 nM (B) doses.

[0048] Figure 7A-7B It is shown that different ISDs result in different stability levels over time. Fig. 7A and Figure 7BThe relative abundance of synthetic engineered snRNAs with alternative 5' stabilizing domains over time is shown. RNA was collected at 24h, 48h and 72h after transfection of synthetic snRNAs with different stabilizing domains to determine the relative stability of the snRNAs.

[0049] Figure 8 The levels of snRNA expression in CTG480 HeLa cells measured by qPCR are shown when snRNA is expressed under different PolIII and PolII promoters. The Y axis depicts the snRNA expression level relative to the GAPDH reference gene, and the x axis depicts different snRNA promoters (Pol II U1 and U7 promoters or PolIII: U6, tRNA and 7SK) used to express snRNA. Plasmids with different promoters were transfected at two different doses (250 and 500 ng).

[0050] Figure 9A-9B Quantification of CUG foci in CTG480 HeLa cells by RNA FISH is shown after transfection with 500 ng (A) or 250 ng (B) of engineered snRNA constructs with different Pol III and Pol II promoters and respective DT sequences. Constructs with Pol II promoters driving expression of the engineered snRNAs (P02225 and P03557) were more efficient in depleting foci containing microsatellite repeats than constructs with Pol III promoters driving the snRNAs. Grey bars represent NT esnRNAs, and blue bars represent esnRNAs targeting CUGs.

[0051] Fig.10 Shown are snRNA expression levels in HEK293T cells determined by qPCR when the snRNA was expressed under PolIII (U6, tRNA, and 7SK) or PolII promoter (U7 and U1) and contained SmOpt or U1 Sm binding sites.

[0052] Figure 11A-11B Shown is the snRNA expression level relative to the GAPDH reference gene after transfection into HEK293 cells. Primers specific to each snRNA (z) are used for qPCR to determine relative promoter strength. The Y axis depicts the snRNA expression level relative to GAPDH, and the x axis depicts the snRNA spacer znt (non-targeted control, in A) and z38 (targeted spacer, B) when they are expressed under different promoters of snRNA (U1, U2, U4, U5 and U7; unt refers to untreated). Primer sets specific to z-nt (Figure A) or z-38 (Figure B) were used.

[0053] Figure 12A-12B Shown are the results of exon 51 skipping following transduction of human delta exon 52 myotubes with snRNAs disclosed herein (A03980: 2x z38 / 42 fusion snRNA cassettes; A03981: 2 snRNA cassettes, one with z42 TS and the other with z38 TS). Fig. 12A Shown are tape station images representing PCR products of exon 51 inclusive and exclusive isoforms and a schematic diagram showing expected fragment sizes. Fig. 12B Shows Fig. 12A Quantification of band intensity in semi-quantitative PCR. The Y-axis depicts the percentage of exon 51 skipping and the x-axis depicts the treatment (synthetic snRNA or AAV transduced with different MOIs of A03980 or A03981).

[0054] Figure 13A-13B Shown is dystrophin staining and recovery of human delta exon 52 myotubes after treatment with snRNA for exon 51 skipping. Fig.13A Shown are immunofluorescence for desmin or dystrophin in untreated myotubes, myotubes treated with synthetic snRNA, or myotubes treated with A03980 (2x z38 / z42 fusion snRNA cassette) at an MOI of 1e6 or 5e6. Fig. 13B Shown are immunofluorescence for desmin or dystrophin in myotubes transduced with A03981 (2 snRNA cassettes with z42 TS and z38 TS) at an MOI of 1e6 or 5e6.

[0055] Fig.14A The vector genome of A04569 is described, and its expression is as Fig. 14B Depicted are two fusion snRNAs of the same sequence. Fig. 14C It is shown that a fusion snRNA targeting the exon 51 exonic splicing enhancer (ESE) can be constructed such that the z38 targeting sequence is located at the most 5' position of the antisense sequence and the z42 targeting sequence is located downstream of the z38 sequence (z73), or in the opposite orientation, with the z42 targeting sequence at the most 5' position and z38 located downstream (z187). In both cases, the antisense sequence of the snRNA consists of 2 targeting sequences, each targeting a separate and unique ESE in exon 51 ( Fig. 14C bottom image).

[0056] Figures 15A-15DShown are the activities of fusion snRNAs targeting exon 51 ESE in human skeletal myotubes lacking exon 52 and del52hDMD / mdx mice. (A) Tape station images and quantification of exon 51 skipping in human skeletal myotubes lacking DMD exon 52 24 hours after transfection with low doses of synthetic snRNAs carrying the fusion antisense sequences z73 (z38 / z42) and z187 (z42 / z38). At low doses, transfection of synthetic snRNA z187 induced higher levels of exon 51 skipping than z73. ( Fig. 15B ) shows quantification of exon 51 skipping in human skeletal myotubes lacking DMD exon 52 7 days after transduction with AAV9-A04526 (carrying two esnRNA cassettes each expressing z73) and A04569 (carrying two cassettes each expressing z187) at MOIs of 2.5e4, 1e5, and 5e5. ( Fig. 15C ) shows quantification of exon 51 skipping in a mouse model of DMD lacking humanized exon 52 (del52hDMD / mdx). We injected 3e12 A04526 and A04569 vector genomes into mice retro-orbitally. After 3 weeks of survival, RNA was extracted from the tibialis anterior (TA), gastrocnemius (Gc), and heart. Semi-quantitative RT-PCR was performed to detect bands that included and excluded exon 51. ( Fig.15D ) shows quantification of dystrophin-positive fibers 4 weeks after intramuscular delivery of A04526 or ESE-targeted Vivo-Morpholino (ViM) at a dose of 3e11 vg / muscle to the gastrocnemius muscle of del52hDMD / mdx mice. hDMD / mdx mice expressing wild-type human dystrophin (grey bars) were used as a positive control for dystrophin expression. U = untreated.

[0057] Figures 16A-16D Shown is a reversal of splicing of DMD and LBD3 splicing isoforms and knockdown of DMPK in patient-derived myotubes (containing 1700 CUG repeats) after treatment with snRNA targeting CUG repeats. DM1 patient fibroblasts were differentiated into myotubes by transduction with myoD adenoviral vector (for 5 days). Cells were then transduced with A04233 and A04234 (scAAV9 double snRNA targeting CUG repeats) at multiple MOIs and harvested 7 days after transduction. Fig.16AThe tape station image shows the RT-PCR products obtained using specific primers for detecting DMD exon 78 inclusion (top band) and LBD3 exon 11 exclusion (bottom band), which are markers of splicing correction in normal WT cells. Fig. 16B ) and LBD3 exon 11 exclusion ( Fig. 16C ). The x-axis depicts the treatment (vehicle and MOI). The y-axis depicts the percentage of splicing correction for exon inclusion of DMD exon 78 or exclusion of LBD3 exon 11. Fig.16D Shown are DMPK RNA expression levels measured by ddPCR after treatment with snRNA (AAV9 A04233 and AAV9 A04234) at different MOIs. The x-axis depicts the treatment. The y-axis depicts DMPK copies per 1000 GAPDH reference gene copies normalized to UNT (untreated cells).

[0058] Figure 17A-17B Images and quantification of nuclear RNA foci from patient-derived myotubes transduced with AAV9 A04233 and AAV9 A04234 at different MOIs are shown. DM1 patient fibroblasts were differentiated into myotubes by transduction with myoD adenoviral vector (for 5 days). Cells were then transduced with A04233 and A04234 (scAAV9 double snRNA targeting CUG repeats) at various MOIs and harvested 7 days after transduction for RNA FISH (to detect CUG foci). Fig.17A Images of CUG RNA foci obtained from untreated myotubes and myotubes treated with AAV9 snRNA vectors A04233 and A04234 are shown. Nuclei were stained with DAPI, and CUG FISH was performed with a CUG-labeled probe. Cells were processed 7 days after transduction. Fig. 17B Quantification of the mean number of CUG foci / cell is shown. The x-axis depicts the treatment and the MOI used. The y-axis depicts the mean number of CUG foci / cell normalized to UNT (untreated cells).

[0059] Figures 18A-18C Depicted are the processing, timeline, and quantification of HTT mutant soluble proteins following treatment with AAV-snRNA targeting CAG repeats. Fig.18A Shown is the experimental design using the vector AAV-A04390 (2x hU7 / hU1 snRNA targeting CAG repeats), ie, 2 MOIs and an end-point assay for detecting mutant (mut) HTT soluble protein. Fig.18BThe timeline of this experiment is depicted. HD patient iPScs (containing 66 CAG repeats) were differentiated into cortical neurons for 2 weeks and then transduced with AAV-A04390 snRNA vector for another 2 weeks. Cortical neurons were then harvested and expressed by Mesoscalediscovery (MSD, Fig. 18C ) Immunoassay quantification of mutant soluble HTT protein. The y-axis depicts mutant soluble HTT (in fmol) per mg of protein lysate, and the x-axis depicts treatment and MOI.

[0060] Figure 19A-19B Depicted is the design of an in vivo study targeting the CAG repeat on the R6 / 2HD mouse model and quantification of mutant HTT soluble protein following treatment with AAV-snRNA targeting the CAG repeat (A03081). Fig.19A The dose of AAVrh10-snRNA (4xCAGx15 targeting snRNA vector) administered by intrastriatal injection (2e10 vector genomes) is shown. The untreated and uninjected contralateral striatum side was used as a control. Fig.19B ) shows quantification of mutant soluble HTT protein in untreated mice and snRNA treated mice (n=10) by Mesoscale discovery (MSD) immunoassay. The y-axis depicts mutant soluble HTT (in fmol) per mg of total protein lysate, and the x-axis depicts treatment.

[0061] Fig. 20A Depicted are the differences between snRNAs expressed by A04527 and A04526, where A04526 expresses an engineered snRNA with a 5' ISD and an engineered mouse SL, while A04527 has no 5' ISD and has a mouse native SL. Fig. 20B Bar graph showing expression of z38 / 42 (in snRNA copies / ng) 2 days after transduction of CHO-Lec2 cells with AAV9-A04527 or A04526 viruses at an MOI of 1e6. DETAILED DESCRIPTION

[0062] The present disclosure provides gene therapy compositions comprising a novel therapeutic targeting RNA platform consisting of engineered snRNA (esnRNA) comprising an engineered snRNA stem-loop (eSL).

[0063] Disclosed herein are compositions comprising nucleic acid molecules and vectors comprising engineered snRNA (esnRNA).

[0064] Intranuclear small RNA (snRNA) is an essential component of intranuclear small nuclear ribonucleoprotein complex (snRNP), and when the intranuclear small RNA protein complex is assembled with other proteins, a large nuclear ribonucleoprotein complex called spliceosome (a cell machine entrusted to mediate the whole mRNA maturation process) is formed. Spliceosome is responsible for pre-mRNA splicing, i.e., the process of removing introns from RNA transcripts before protein production. The size of a single snRNA is generally about 250 nucleotides or less. For example, the length of U1 snRNA is 164 nucleotides, and is encoded by genes with several copies in the human genome. U1 snRNA represents the ribonucleic acid component of nuclear particle U1 snRNP. U1 snRNA has a stem and loop three-dimensional structure, and there is a single-stranded sequence in the 5' region, usually about 9 nucleotides in length, which can be bound to the splicing donor site on the pre-mRNA molecule by complementary base pairing. (Horowitz et al., 1994, Trends Genet., 10(3): 100-6.) Since various spliceosomal snRNAs contain a large amount of uridylic acid, they are named U1, U2, U4, U5, U6, U4ATAC, U6ATAC, U7, U11 and U12. (Mattaj et al., 1993, FASEB J, 15, 7: 47-53.)

[0065] The snRNA system can be used to treat toxic mutations. For example, antisense oligonucleotides that interfere with splicing sites and regulatory elements in exons containing toxic mutations can induce skipping of specific exons at the pre-RNA level. Such antisense sequences can be packaged in snRNA sequences, which are delivered using viral vectors carrying nucleic acid sequences that can transcribe snRNA. U7 snRNA is endogenously involved in the processing of histone pre-mRNA 3' ends, but can be converted into a universal tool for splicing regulation by slight changes in the binding sites of Sm / Lsm proteins. One such therapeutic strategy for treating Duchenne muscular dystrophy has used modified U7 snRNA to convert out-of-frame mutations into in-frame mutations, which produces internally deleted toxic RNAs, but still has functional dystrophin. (Goyenvalle et al., 2009, 17(7): 1234-1240.)

[0066] Most U-rich snRNPs are complexes that mediate the splicing of pre-mRNA. U7 snRNP is an exception. U7 is not involved in splicing, but is a key factor in the unique 3' end processing of replication-dependent histone mRNA. By modifying the U7 snRNA histone binding sequence and Sm motif, U7 can no longer participate in the processing of histone pre-mRNA, but instead target pre-mRNA or smRNA for blocking or splicing regulation. In this way, U7 snRNA can be used as an effective gene therapy platform. The U7 snRNA platform also has the following additional advantages: compact size, the ability to accumulate in the nucleus without causing cytotoxicity, and almost no immunoreactivity. (Gadgil et al., 2021, J Gene Med, 23(4): e3321.)

[0067] Disclosed herein is a newly engineered and redesigned snRNA platform (or referred to herein as an esnRNA platform) comprising 1) an engineered stem loop (eSL). Compensatory modifications to the natural stem loop sequence produce an engineered stem loop (eSL) that more effectively communicates (folds and anneals) with the snRNA interaction stabilizing domain (ISD), which in turn produces an snRNA platform with increased stability. See Figure 1. It has been previously shown that U7 snRNA can be programmed to regulate mRNA. Disclosed herein are programmed engineered snRNA improvements that can be used as gene therapy tools. It is shown herein that these engineered snRNA systems lead to blocking microsatellite repeat expansion (shown herein for the treatment of myotonic dystrophy (DM1) or Huntington's disease (HD)), leading to exon skipping (for the treatment of DMD), and leading to splicing regulation (shown herein for the treatment of USH2A (Usher syndrome type 2)). In one embodiment, these snRNAs are human snRNAs. In another embodiment, these snRNAs are mouse snRNAs. In another embodiment, the snRNA is a combination of human snRNA and mouse snRNA. In one embodiment, U7 is human U7 or mouse U7. In another embodiment disclosed herein, the engineered snRNA comprises different types of snRNAs (U1-U12, etc.) by combining the domains of endogenous snRNAs to fine-tune the stability of the platform and / or reduce off-target effects. For example, in one embodiment, the engineered snRNA system comprises a combination of human or mouse U7 snRNA components and human or mouse U1 snRNA components.

[0068] Additional elements that can modulate RNA processing and abundance can be further engineered into esnRNAs containing eSLs. Figure 1CIn one embodiment, additional elements that can modulate the processing, stability, and abundance of the esnRNA can be further engineered into the esnRNA at the 5' or 3' end. In another embodiment, such elements can include, but are not limited to, stem loops, hairpins, GC clamps, kiss loops, triplexes, quadruplexes, and protein binding sites.

[0069] The esnRNA platform and its parts disclosed herein can be used in any therapeutic environment and context, as long as one or more suitable spacers (or one or more TS) are included in the design of the esnRNA therapeutic composition. In certain embodiments, the therapeutic esnRNA composition is used to treat a disease selected from the group consisting of Duchenne muscular dystrophy, DM1 and HD. In another embodiment, the esnRNA composition is used to treat DMD caused by exon 51 mutations. Engineered stem-loop

[0070] The engineered snRNA (esnRNA) system disclosed herein comprises an engineered stem-loop (eSL), which comprises compensatory modifications to the natural snRNA stem-loop. These modifications result in increased stability of the esnRNP compared to snRNPs comprising unmodified stem-loops. The eSL disclosed herein can be derived from any snRNP (such as U1-U12). In one embodiment, the eSL is a human or mouse U7 eSL. In one embodiment, the eSL is a human or mouse eSL. In some embodiments, the eSL is a human and mouse eSL. In some embodiments, the eSL is a non-human eSL selected from the following: mouse, pig, sheep, goat, cattle, dog, cat, horse or a combination thereof. In some embodiments, the eSL is an eSL selected from the following: human, mouse, pig, sheep, goat, cattle, dog, cat, horse or a combination thereof. In some embodiments, the eSL sequence is not a natural stem-loop sequence. In some embodiments, at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage therebetween) of the nucleic acid sequence of the eSL is not a native stem-loop sequence.

[0071] In some embodiments, the human eSL comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to one or more of the following nucleotide sequences: ggctttctggctccttaccggaaagcc (SEQ ID NO: 1), ggctttctgggaggttaccggaaagcc (SEQ ID NO: 2), ggctttctggcctccttaccggaaagcc (SEQ ID NO: 3), ggctttctggggaggttaccggaaagcc (SEQ ID NO: 4), ggctttctggctggctaccggaaagcc (SEQ ID NO: 5), ggctttctggcttccccggaaagcc (SEQ ID NO: 6), ggctttctggcttcttcccggaaagcc (SEQ ID NO:7), ggctttctggcaacttaccggaaagcc (SEQ ID NO:8), ggctttctggttcggtaccggaaagcc (SEQ ID NO:9), ggctttctggaagccttaccggaaagcc (SEQ ID NO: 10), ggctttctggcttcttaccggaaagcc (SEQ ID NO: 11) or GGCTTTCTGGCCTCCGCCGGAAAGCCCCT (SEQ ID NO: 186).

[0072] In some embodiments, the murine eSL comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage therebetween) to one or more of the following nucleotide sequences: ggctttctggctccttaccggaaagcccct (SEQ ID NO: 163), Ggttttctgacctccgtcggaaaacccct(SEQ ID NO:146), ggttttctgacctccttcggtcggaaaacccct(SEQ ID NO:147), Ggttttctgacctccgtcggaaaacc (SEQ ID NO: 148), GGTTTTCTGACACTCCGTCGGAAAACCCCT(SEQ ID NO:228), GGTTTTCTGATCTCCATCGGAAAACCCCT(SEQ ID NO:229) or GGTTTTCCGACCTCCGTCGGAAAACCCCT (SEQ ID NO: 230).

[0073] In some embodiments, the human or murine eSL comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to one or more of the following nucleotide sequences: GGCTTTCTGGCACTCCACCGGAAAGCCCCT (SEQ ID NO: 190), GGCTTTCTGGCACTCCGCCGGAAAGCCCCT (SEQ ID NO:191) or GGCTTTCTGGCCTCCACCGGAAAGCCCCT (SEQ ID NO: 192).

[0074] In some embodiments, the dog or cat eSL comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to one or more of the following nucleotide sequences: GGTTTTCCGGTCTCCACCGGAAAGCCCCC (SEQ ID NO: 193).

[0075] In some embodiments, the bovine, ovine or caprine eSL comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to one or more of the following nucleotide sequences: GGCTTTCCGGTCTCCACCGGAAAGCCCCT (SEQ ID NO:194) or GGCTTTCCGGCCTCCGCCGGAAAGCCCCT (SEQ ID NO: 195).

[0076] In some embodiments, the porcine eSL comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to one or more of the following nucleotide sequences: GGTTTTCCGGTCTCCACCGGAAAACCCTT (SEQ ID NO: 196), GGTTTTCCGTGCTCCCACGGAAAACCCTT (SEQ ID NO: 197), GGTTTTCCGGCCTCCGCCGGAAAACCCTT (SEQ ID NO: 198), GGTTTTCCGTGACTCCCACGGAAAACCCTT (SEQ ID NO:199) or GGTTTTCCGGCACTCCGCCGGAAAACCCTT (SEQ ID NO: 200).

[0077] In some embodiments, the horse eSL comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to one or more of the following nucleotide sequences: GGTCTTCCGGTCTCCTCCGGAAGGCCCCC (SEQ ID NO:201) or GGTCTTCCGGCTCCCCGGAAGGCCCCC (SEQ ID NO: 202).

[0078] In some embodiments, the ovine eSL comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentages therebetween) identical to one or more of the following nucleotide sequences: GGCTTTCCGTGCTCCCACGGAAAGCCCCT (SEQ ID NO:203), GGCTTTCCGTGACTCCCACGGAAAGCCCCT (SEQ ID NO:204) or GGCTTTCCGGCACTCCGCCGGAAAGCCCCT (SEQ ID NO: 205).

[0079] In some embodiments, the engineered stem-loop provides enhanced stability of the snRNA relative to an snRNA comprising a native stem-loop. In some embodiments, the native snRNA stem-loop comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage therebetween) to one or more of the following nucleotide sequences: Ggttttctgacttcggtcggaaaacccct (SEQ ID NO: 145), ggttttctgacttcggtcggaaaacc (SEQ ID NO: 206), Ggctttctggctttttaccggaaagcc (SEQ ID NO: 235) or ggctttctggctttttaccggaaagccCCT (SEQ ID NO: 236). 5' interaction stabilizing domain

[0080] The eSL disclosed herein has the property of folding and annealing more efficiently with the 5'interaction stabilizing domain (5'ISD), and this in turn leads to increased stability of the esnRNA compared to non-engineered snRNA. The 5'ISD has nucleotides that are complementary to nucleotides within the engineered SL, and without wishing to be bound by theory, it is predicted that the interaction between the 5'ISD and the eSL forms a secondary structure that protects the 5' end of the snRNA. In some aspects, the 5'ISD anneals and / or hybridizes with the eSL of the present disclosure. In some aspects, the 5'ISD is a sequence that has complementarity and / or reverse complementarity with a sequence present in the eSL of the present disclosure. In some aspects, the 5'ISD disclosed herein can be one of the 5'ISDs selected from the following nucleotide sequences: ggagt (SEQ ID NO: 12), cctct (SEQ ID NO: 13), ggaggt (SEQ ID NO: 14), cctcct (SEQ ID NO: 15), agccag (SEQ ID NO: 16), ggaag (SEQ ID NO: 17), gaagaag (SEQ ID NO: 18), gttg (SEQ ID NO: 19), ccgaa (SEQ ID NO: 20), taaggag (SEQ ID NO: 21), gaag (SEQ ID NO: 22) or ggctt (SEQ ID NO: 23). Targeting sequence

[0081] The esnRNA system can be programmed to include a targeting sequence (TS) (also referred to as an intron). In some aspects, the targeting sequence is a 5' targeting sequence (5' TS) (also referred to as an intron) that targets one or more target RNAs. In this context, 5' refers to the 5' end of the snRNA insert, and is not necessarily about the overall vector configuration comprising one or more snRNA inserts. And the TS can be located at or near the 5' end of the snRNA. In alternative embodiments, one or more targeting sequences (TS) can be located at or near the 3' position of the snRNA construct, thereby generating a 3' targeting sequence (3' TS), particularly if the snRNA construct is not based on U7 snRNA.

[0082] The length of the targeting sequence of the present disclosure (including 5'TS and 3'TS) can be between about 1 and about 200 nucleotides. In some aspects, the length of the targeting sequence of the present disclosure is between about 10 and about 150 nucleotides. In some aspects, the length of the targeting sequence of the present disclosure is between about 10 and about 100 nucleotides. In some aspects, the length of the targeting sequence of the present disclosure is between about 20 and about 60 nucleotides. In some aspects, the length of the targeting sequence of the present disclosure is at least about 10, 20, 30, 40, 50, 60 or about 70 nucleotides.

[0083] In one example, U7 snRNA can be programmed by replacing histone mRNA binding sequences with sequences complementary to the target of interest. In some aspects, the esnRNA system of the present disclosure binds to the target mRNA or pre-mRNA sequence of interest. The exemplary esnRNA system shown herein results in blocking or knocking down microsatellite repeat expansion (for the treatment of myotonic dystrophy (DM1) or Huntington's disease (HD)), hexanucleotide repeat expansion (for the treatment of C9 / ALS), resulting in splicing regulation (for the treatment of USH2A (Usher syndrome type 2)), or results in targeting one or more exon splicing enhancers (ESE) to induce exon skipping (for the treatment of DMD, such as DMD exon 51 skipping). In one embodiment, the target RNA of interest is a microsatellite or hexanucleotide repeat RNA or a non-repetitive RNA. In another embodiment, the target repeat RNA is selected from CUG, CAG, GGGGCC and CCCCGG. In one embodiment, the esnRNA comprises a targeting sequence (TS) targeting two target RNAs of interest (GGGGCC and CCCCGG). In another embodiment, the two target RNAs of interest are microsatellite repeat RNA and non-repeat RNA.In another embodiment, the non-repeat RNA is the flanking sequence of the repeat RNA.

[0084] In some embodiments, the esnRNA of the present disclosure targets a pre-mRNA or mRNA sequence encoding a DMD gene. DMD is a gene encoding the protein dystrophin. Mutations in DMD are associated with Duchenne muscular dystrophy. In some embodiments, the DMD RNA sequence targeted by the esnRNA composition of the present disclosure is an exon 51 DMD RNA sequence.

[0085] The targeting sequence that binds DMD can comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage therebetween) to one or more of the following nucleotide sequences shown in the table below: Sequences targeting DMD exon 51 RNA

[0086] In one embodiment, the TS as a fusion as shown in the table above can be a single TS sequence contained within the fusion sequence.

[0087] In another embodiment, the targeting sequence (TS) targets two or more target RNAs. In another embodiment, the TS targeting two or more target RNAs is the different sequences targeting the same pre-mRNA molecule. In one embodiment, an intron or TS is a fusion sequence. In another embodiment, the fusion sequence is the intron targeting DMD exon 51, wherein the fusion sequence is shown in the above table.

[0088] In some embodiments, the sequence targeted to a CUG repeat comprises the following nucleic acid sequence: CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 165).

[0089] In some embodiments, the sequence targeted to the CAG repeat comprises the following nucleic acid sequence: CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG (SEQ ID NO: 167). Sm binding domain

[0090] The esnRNA system disclosed herein utilizes the Sm binding domain (SmBD). The Sm protein ring assembled around the Sm binding domain (SmBD) to form snRNP includes SmB / B', SmD1, SmD2, SmD3, SmE, SmF and SmG. The U7 Sm binding site recruits endogenous RNA binding factors and can be replaced by non-U7 snRNA to make the esnRNA more stable. In one embodiment, SmBD is selected from U1, U2, U4 and U5 snRNA. In another embodiment, SmBD is derived from pseudo snRNA. In another embodiment, SmBD is a nucleotide sequence comprising SEQ ID NO:31 (ATTTTT). In another embodiment, the SmBD comprises a nucleotide sequence selected from the group consisting of SEQ ID NO:32 (AATTTTTGG), SEQ ID NO:33 (AATTTGTGG), SEQ ID NO:34 (AATTTGTGG), SEQ ID NO:35 (AATTTCTGG), SEQ ID NO:36 (GATTTTTGG), SEQ ID NO:37 (AATTTTTGA), SEQ ID NO:38 (AATTTTTTG), SEQ ID NO:161 (AATTTTTGGAGCA) and SEQ ID NO:163 (AATTTTTGGAGTA). Promoter sequence

[0091] The esnRNA system disclosed herein comprises a snRNA promoter from any one of U1-U12. In one embodiment, the snRNA promoter is a U7 promoter. In another embodiment, the U7 promoter is a human U7 promoter (hU7) or a mouse U7 promoter (mU7). In another embodiment, the U7 promoter is an endogenous human U7 promoter comprising SEQ ID NO:39: TACTGCCGAATCCAGGTCTCCGGGCTTAACAACAACGAAGGGGCTGTGACTGGCTGCTTTCTCAACCAATCAGCACCGAACTCATTTGCATGGGCTGAGAACAAATGTTCGCGAACTCTAGAAATGAATGACTTAAGTAAGTTCCTTAGAATATTATTTTTCCTACTGAAAGTTACCACATGCGTCGTTGTTTATACAGTAATAGGAACAAGAAAAAAGTCACCTAAGCTCACCCTCATCAATTGTGGAGTTCCTTTATATCCCATCTTCTCTCCAAACACATACGCA.

[0092] In one embodiment, the snRNA promoter is a U1 promoter. In another embodiment, the U1 promoter is a human U1 promoter or a mouse U1 promoter.

[0093] In another embodiment, the snRNA promoter drives a copy of the snRNA insert. In another embodiment, the copies of each snRNA insert are identical. In another embodiment, different snRNA promoters drive each copy of the snRNA insert. In one embodiment, the 2x snRNA comprises a mouse U7 promoter that drives one copy of the snRNA insert and a mouse U1 promoter that drives another copy of the snRNA insert.

[0094] In other aspects, the snRNA promoter is a PolII promoter or a PolIII promoter. In other aspects, the snRNA promoter comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical (or any percentage therebetween) to the promoter and / or promoter sequence listed in the following exemplary promoter table: Terminator sequence

[0095] The esnRNA system disclosed herein comprises a snRNA downstream terminator (DT). The downstream terminator defines the end of a transcription unit (such as an esnRNA or snRNA). In another embodiment, the snRNA DT is a U7 DT, and the U7 DT comprises: CCTCTTATGATGTTTGTTGCCAATGATAGATTGTTTTCACTGTGCAAAAATTA TGGGTAGTTTTGGTGGTCTTGATGCAGTTGTAAGCTTGGAG (SEQ ID NO: 49).

[0096] In one embodiment, the esnRNA comprises an eSL, one or more promoters, a TS, a SmBD, a 5'ISD, and a DT. In one aspect, promoter and DT combinations are mixed and matched.

[0097] In another embodiment, the DT is selected from the exemplary DTs and / or DT sequences listed in the following exemplary DT table:

[0098] In one embodiment, the esnRNA is delivered in an AAV vector.

[0099] In some embodiments, the AAV vector comprises multiple copies of esnRNA. In some embodiments, the multiple copies of esnRNA are 2, 3 or 4 copies (2x, 3x or 4x) of esnRNA. In some embodiments, the multiple copies of esnRNA are 4 or more copies of esnRNA.

[0100] In some embodiments, each esnRNA in the multiple copies of the esnRNA is separated by a nucleic acid buffer sequence derived from a human non-coding genomic sequence downstream of the snRNA. In one embodiment, the buffer sequence is derived from a human genomic sequence downstream of U7.

[0101] In one embodiment, the buffer sequence is selected from the following nucleic acid sequences: Buffer 1 (30 bp) CAAACTACAGAGCCAAGTGCTATCCACAGA (SEQ ID NO: 24), Buffer 2 (30 bp) GAGCTTTCTGGGTTGCCATCTCAAGCAGAC (SEQ ID NO: 25), buffer 3 (30 bp) TACAAGGCCATCAGCTCATACTCACAATTG (SEQ ID NO: 26), and combinations thereof.

[0102] In another embodiment, the buffer sequence is selected from the following nucleic acid sequences: Buffer 1 (100 bp) CAAACTACAGAGCCAAGTGCTATCCACAGAGAGCTTTCTGGGTTGCCATCT CAAGCAGACTACAAGGCCATCAGCTCATACTCACAATTGACTTTGAGAG(SEQ ID NO:27), Buffer 2 (100 bp) TTGACCACATACGTGCTCTTTCAAAGTTCTGTGTTTGAAGTTATGTTAGTAACAACTGATGCCCATCCTGCAATGACAAATCCAATTCTCAGTGCAGCTC (SEQ ID NO: 28) and combinations thereof.

[0103] In another embodiment, the buffer sequence is selected from the following nucleic acid sequences: Buffer 1 (500 bp) CAAACTACAGAGCCAAGTGCTATCCACAGAGAGCTTTCTGGGTTGCCATCTCAAGCAGACTACAAGGCCATCAGCTCATACTCACAATTGACTTTGAGAGTCATTTTCCAATGCTCCTACACACCCCTTCTTCACAATCCCCAACAAATCTGAGGCTGGAACTTGGTACCATAACAATCATTACATTATTTCACCAGAAGTACACCTTGCCTGGAAGATTGGCATTATAGCATCTTCTAACATTGTGAAAGTTAGTGACCAATGAGGAGATCCAAGTCAGTTCCAGTTGGATTTCTCTATACTCTATAATAAATATATATGGTGTCTTCAACAATAGGACTTTGCCATCCAGTGATGCTAAAAATCAATAACAATGGCAATAACCTGCCCTGTTTGGAAAGCCTCTGGCTTCCATGACTAACAATTCAAGGCAGGTCTCCTATACCTAGTACTGAGATTTTTATTTGATAAACTATATCTTCTGGGAGGAGAAGCATTGT(SEQ ID NO:29), Buffer 2 (500bp) TTGACCACATACGTGCTCTTTCAAAGTTCTGTGTTTGAAGTTAGTTAGTAACAACTGATGCCCATCCTGCAATGACAAATCCAATTCTCAGTGCAGCTCTCTGAAATAGTTTGCTTTCTCTCTAGGTCTGTTCTATACTCCTAACTCTCCAGGAGTTTACAAGGAATAAAATCTCTTCCAAATGCTTTCTGTTGCAACAACTGGACCATACTGAAAGCTGAGGCCCACAATTGCAATCTAGGTTAGCA GGTAATCATTGTTGGTGAGGTCCTCCCTTTCCCCAGGCTCGTGTTTGTATTGGGGAGCAGGAAATTTTTGCTAGAGCAGCACTGCCATCTCTCTACACTCCACCTGATTGGTGGGATGGACCAGAGAAATGGACATTCCACACAGTCCCTCCTTTCACATCTGCTCACCTGCCCACAGGATACTTTCCACCATGCATACTGGGCTCTGCACCAACCATTCAGCAGTGATGAAGAGGAAACTTGAAC(SEQ ID NO:30) and / or combinations thereof.

[0104] The 100 bp and 500 bp buffer 1 sequences are derived from a sequence starting 100 bp downstream of the Mus musculus U7 pseudogene 8 (located on chromosome 14: 4,409,359-4,409,421 reverse strand. GRCm39: CM001007.3). The 100 bp and 500 bp buffer 2 sequences are derived from a sequence starting 130 bp downstream of the human U7 pseudogene 5 (X chromosome: 140,451,148-140,451,208 forward strand. GRCh38: CM000685.2). Both 100 bp buffers are the first 100 bp of the corresponding 500 bp buffers. 30 bp buffers 1, 2 and 3 are continuous 30 bp sequences within "100 bp buffer 1" and are located downstream of the Mus musculus U7 pseudogene 8. These downstream sequences were chosen due to the lack of any known regulatory sites or genes within or nearby the sequences (using Gencode / Ensembl), the GC content of the total buffer being 40%-60%, the GC content of the 20 bp region at both ends of the buffer being 40%-60%, and minimal sequence complexity in addition to the lack of repetitive sequences. esnRNA sequences

[0105] Exemplary esnRNA sequences of the present disclosure may comprise any combination of esnRNA features described herein. In some aspects, the esnRNA comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage therebetween) to an esnRNA listed in the following esnRNA Table: esnRNA sequences of the present disclosure Carrier

[0106] In the context of a recombinant expression vector, the term "operably linked" is intended to mean that the hybrid promoter is linked to the NOI in a manner that permits expression of the nucleotide sequence in, for example, a host cell when the vector is introduced into (or contacted with) a host cell.

[0107] In some embodiments of the compositions and methods of the present disclosure, the vector comprises an engineered snRNA. In some embodiments, the therapeutic snRNA is in a single or unitary vector.

[0108] In some embodiments of the compositions and methods of the present disclosure, the RNA binding snRNA system that can target toxic CAG, CUG, GGCCCC, CCGGG or GGCCC+CCGGGG RNA repeats (or its flanking sequences) is in a single vector. In some embodiments of the compositions and methods of the present disclosure, the system of targeting RNA can target non-repetitive RNA of purpose. In some embodiments of the compositions and methods of the present disclosure, the system of targeting RNA can target one or more DMD sequences. In some aspects, the snRNA system can target multiple (that is, two or more) target RNAs. In some embodiments, the two or more target RNAs can be identical pre-mRNA molecules, but different sequences within the pre-mRNA molecules.

[0109] One type of vector is a "plasmid", which refers to a circular double-stranded DNA loop in which other DNA segments can be inserted (such as by standard molecular cloning techniques). Another type of vector is a viral vector, in which a DNA or RNA sequence of viral origin is present in a vector to be packaged into a virus (such as a retrovirus, a replication-defective retrovirus, an adenovirus, a replication-defective adenovirus, and an adeno-associated virus). The viral vector also includes a polynucleotide carried by the virus for transfection into a host cell. In some embodiments, the vector is a lentivirus (such as an integration-defective lentiviral vector) or an adeno-associated virus (AAV) vector. The vector can replicate autonomously in the host cell into which it is introduced (such as a bacterial vector with a bacterial replication origin and an episomal mammalian vector and other vectors, such as a non-episomal mammalian vector), and is integrated into the genome of the host cell after being introduced into the host cell, thereby replicating with the host genome.

[0110] In some embodiments, vectors (such as expression vectors) can guide the expression of genes operably connected to them. Common expression vectors are generally in the form of plasmids. In some embodiments, recombinant expression vectors include nucleic acids provided herein, such as esnRNAs suitable for expressing proteins in host cells. Recombinant expression vectors include one or more regulatory elements, which are selected based on the host cells to be used for expression, and the one or more regulatory elements are operably connected to the nucleic acid sequence to be expressed. In recombinant expression vectors, "operably connected" is intended to mean that the target nucleotide sequence is connected to one or more regulatory elements in a manner that allows the nucleotide sequence to be expressed (such as in an in vitro transcription / translation system or when the vector is introduced into a host cell in a host cell). Some embodiments of the vector depend on such factors, such as the selection of host cells to be transformed and the desired expression level. The vector can be introduced into a host cell to produce transcripts, proteins or peptides (including fusion proteins or peptides) encoded by nucleic acids as described herein, such as snRNA, CRISPR transcripts, proteins, enzymes, mutant forms thereof, fusion proteins thereof, etc. Viral vectors

[0111] In some embodiments of the compositions and methods of the present disclosure, the vector of the present disclosure is a viral vector. In some embodiments, the viral vector comprises a sequence separated from or derived from a retrovirus. In some embodiments, the viral vector comprises a sequence separated from or derived from a lentivirus. In some embodiments, the viral vector comprises a sequence separated from or derived from an adenovirus. In some embodiments, the viral vector comprises a sequence separated from or derived from an adeno-associated virus (AAV). In some embodiments, the viral vector has no replication ability. In some embodiments, the viral vector is isolated or recombinant. In some embodiments, the viral vector is self-complementary. Adeno-associated virus vector

[0112] As used herein, "AAV vector" refers to a vector comprising, consisting essentially of, or consisting of one or more nucleic acid molecules and one or more AAV inverted terminal repeats (ITRs). In some aspects, the nucleic acid molecule encodes the esnRNA of the present disclosure. When present in a host cell that provides the functions of the rep and cap gene products (e.g., by transfecting the host cell), such AAV vectors can be replicated and packaged into infectious viral particles. In some aspects, the AAV vector contains a promoter, at least one nucleic acid that can encode at least one protein or RNA, and / or an enhancer and / or terminator within the flanking ITRs packaged into infectious AAV particles. The encapsidated nucleic acid portion can be referred to as an AAV vector genome. The plasmid containing the AAV vector can also contain elements for manufacturing purposes, such as antibiotic resistance genes, replication origin sequences, etc., but these elements are not encapsidated and therefore do not form part of the AAV particles.

[0113] In some aspects, the AAV vector may comprise at least one nucleic acid encoding the esnRNA composition of the present disclosure. In some aspects, the AAV vector may comprise at least one regulatory sequence. In some aspects, the AAV vector may comprise at least one AAV inverse terminal (ITR) sequence. In some aspects, the AAV vector may comprise a first ITR sequence and a second ITR sequence. In some aspects, the AAV vector may comprise at least one promoter sequence. In some aspects, the AAV vector may comprise at least one enhancer sequence. In some aspects, the AAV vector may comprise at least one terminator sequence. In some aspects, the AAV vector may comprise at least one poly A sequence. In some aspects, the AAV vector may comprise at least one linker sequence. In some aspects, the AAV vector may comprise at least one buffer sequence. In some aspects, the AAV vector of the present disclosure may comprise at least one nuclear localization signal or a nuclear export signal and / or both.

[0114] In some aspects, the AAV vector may comprise a first AAV ITR sequence, a promoter sequence, an esnRNA sequence, a terminator sequence, and a second AAV ITR sequence. In some aspects, the AAV vector may comprise a first AAV ITR sequence, a promoter sequence, an esnRNA sequence, a terminator sequence, and a second AAV ITR sequence in the 5' to 3' direction.

[0115] In some aspects, the AAV vector may comprise a first AAV ITR sequence, a first promoter sequence, a first esnRNA sequence, a second promoter sequence, a second esnRNA sequence, and a second AAV ITR sequence. In some aspects, the AAV vector may comprise a first AAV ITR sequence, a first promoter sequence, a first esnRNA sequence, a second promoter sequence, a second esnRNA sequence, a third promoter sequence, a third esnRNA sequence, and a second AAV ITR sequence. In some aspects, the AAV vector may comprise a first AAV ITR sequence, a first promoter sequence, a first esnRNA sequence, a second promoter sequence, a second esnRNA sequence, a third promoter sequence, a third esnRNA sequence, a fourth promoter sequence, a fourth esnRNA sequence, and a second AAV ITR sequence.

[0116] As used herein, the term "adeno-associated virus" or "AAV" refers to a member of a class of viruses associated with this name and belonging to the genus Dependoparvovirus of the family Parvoviridae. Adeno-associated viruses are single-stranded DNA viruses that grow in cells, in which certain functions are provided by co-infected helper viruses. General information and reviews of AAV can be found in, for example, Carter, 1989, Handbook of Parvoviruses, Vol. 1, pp. 169-228 and Berns, 1990, Virology, pp. 1743-1764, Raven Press, (New York). It is fully expected that the same principles described in these reviews will apply to additional AAV serotypes characterized after the publication date of the reviews, because it is well known that the various serotypes are very closely related in structure and function, even at the genetic level. (See, e.g., Blacklowe, 1988, Parvoviruses and Human Disease, pp. 165-174, ed. JR Pattison; and Rose, Comprehensive Virology 3: 1-61 (1974)). For example, all AAV serotypes apparently exhibit very similar replication properties mediated by homologous rep genes; and all carry three related capsid proteins, such as those expressed in AAV2. The extent of the relatedness is further indicated by heteroduplex analysis, which reveals extensive cross-hybridization between serotypes along the length of the genome; and the presence of similar self-annealing segments at the ends corresponding to "inverted terminal repeats" (ITRs). Similar infectivity patterns also suggest that the replication function in each serotype is under similar regulatory control. Multiple serotypes of this virus are known to be suitable for gene delivery; all known serotypes can infect cells from a variety of tissue types.

[0117] AAV has unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cells in culture is non-cytopathic, and natural infection in humans and other animals is silent and asymptomatic. In addition, AAV infects many mammalian cells, making it possible to target many different tissues in vivo. In addition, AAV transduces slowly dividing cells and non-dividing cells, and can persist substantially as a transcriptionally active nuclear episome (extrachromosomal element) throughout the life cycle of these cells. The AAV proviral genome is inserted into a plasmid as cloned DNA, which makes the construction of a recombinant genome feasible. In addition, because the signal for directing AAV replication and genome encapsidation is contained in the ITR of the AAV genome, some or all of the internal approximately 4.3kb genome (encoding replication and structural capsid proteins, rep-cap) can be replaced by foreign DNA to produce AAV vectors. Rep and cap proteins in trans can be provided. Another important feature of AAV is that it is an extremely stable and robust virus. It readily withstands the conditions used to inactivate adenovirus (56°C to 65°C for several hours), making refrigeration less critical. AAV can even be lyophilized. Finally, AAV-infected cells are not resistant to repeated infection.

[0118] The recombinant AAV (rAAV) genome of the present invention comprises, consists essentially of, or consists of a nucleic acid molecule encoding at least one esnRNA and one or more AAV ITRs flanking the nucleic acid molecule. The production of pseudotyped rAAVs is disclosed, for example, in WO 2001083692. Other types of rAAV variants, such as rAAVs with capsid mutations, are also contemplated. See, for example, Marsic et al., Molecular Therapy, 22(11):1900-1909(2014). The nucleotide sequences of the genomes of various AAV serotypes are known in the art.

[0119] In some embodiments of the compositions and methods of the present disclosure, the viral vector comprises a sequence isolated from or derived from an adeno-associated virus (AAV). In some embodiments, the viral vector comprises an AAV inverted terminal repeat or capsid sequence isolated from or derived from serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh10, AAV11, or AAV12. In some embodiments, the AAV serotype is AAVrh.74. In one embodiment, the AAV vector comprises a modified capsid. In one embodiment, the AAV vector is an AAV2-Tyr mutant vector. In one embodiment, the AAV vector is included in a capsid with a non-tyrosine amino acid at the position of the surface-exposed tyrosine residue in position Tyr252, Tyr272, Tyr275, Tyr281, Tyr508, Tyr612, Tyr704, Tyr720, Tyr730 or Tyr673 corresponding to wild-type AAV2. See also WO 2008 / 124724, which is incorporated herein in its entirety. In some embodiments, the AAV vector comprises an engineered capsid. AAV vectors comprising engineered capsids include but are not limited to AAV2.7m8, AAV9.7m8, AAV22tYF and AAV8 Y733F. In some embodiments, the capsid is a ubiquitination-resistant capsid. In another embodiment, the ubiquitinated capsid is an AAV2 capsid comprising tyrosine (Y) and serine (S) mutations. In another embodiment, the AAV2 capsid comprises Y, S and threonine (T) mutations. In another embodiment, the AAV2 capsid includes but is not limited to AAV2 capsid mutants such as T455V, T491V, T550V, T659V, Y444+500+730F and Y444+500+730F+T491V. In some embodiments, the viral vector is replication incompetent. In some embodiments, the viral vector is isolated or recombinant (rAAV). In some embodiments, the viral vector is self-complementary (scAAV). In some embodiments, the viral vector is single-stranded (ssAAV). AAV ITR sequences

[0120] In some embodiments of the compositions and methods of the present disclosure, the AAV inverted terminal repeat sequence can comprise any AAV ITR sequence known in the art. In some aspects, the AAV ITR sequence can comprise or consist of an AAV1 ITR sequence, an AAV2 ITR sequence, an AAV3 ITR sequence, an AAV4 ITR sequence, an AAV5 ITR sequence, an AAV6 ITR sequence, an AAV7 ITR sequence, an AAV8 ITR sequence, an AAV9 ITR sequence, an AAV10 ITR sequence, an AAVrh10 ITR sequence, an AAV11 ITR sequence, an AAV12 ITR sequence, an AAV13 ITR sequence, or an AAVrh74 ITR sequence.

[0121] In some aspects, the ITR sequence can comprise a modified AAV ITR sequence.

[0122] In some aspects, the AAV ITR sequence can comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:162, or SEQ ID NO:166 (or any percentage therebetween).

[0123] In some aspects, the first AAV ITR sequence can comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:162, or SEQ ID NO:166 (or any percentages therebetween), and the second AAV ITR sequence can comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:162, or SEQ ID NO:166 (or any percentages therebetween). In some aspects, the first AAV ITR sequence is located at the 5' end of the AAV vector. In some aspects, the second AAV ITR sequence is located at the 3' end of the AAV vector.

[0124] In some embodiments of the compositions and methods of the present disclosure, the viral vector comprises a sequence isolated or derived from an adeno-associated virus (AAV).

[0125] In some embodiments of the compositions and methods of the present disclosure, the vector of the present disclosure is a non-viral vector. In some embodiments, the vector comprises or consists of: a nanoparticle, a micelle, a liposome or a cationic liposome / DNA complex, a polymer vesicle, a polyplex, or a dendrimer. In some embodiments, the vector is an expression vector or a recombinant expression system. As used herein, the term "recombinant expression system" refers to a genetic construct for expressing certain genetic material formed by recombination. esnRNA vector constructs

[0126] Exemplary esnRNA AAV vectors of the present disclosure may comprise one or more esnRNA sequences of the present disclosure. In some aspects, the esnRNA AAV vector comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage therebetween) to an esnRNA AAV vector listed in the following esnRNA AAV vector table:

[0127] An exemplary AAV vector of the present disclosure comprises, from 5' to 3', a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting DMD exon 51, a U7 downstream terminator sequence, a U1 promoter sequence, a U7 esnRNA sequence targeting DMD exon 51, a U1 downstream terminator sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A04569 (which encodes a snRNA sequence targeting DMD exon 51) comprises SEQ ID NO: 168. A04569: scAAVmU7p-z42 / 38 reverse fusion-mU7 terminator_mU1p-z42 / 38 reverse fusion-mU1 terminator; mouse loop with 5'ISD and eSL

[0128] An exemplary AAV vector of the present disclosure comprises, from 5' to 3', a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting DMD exon 51, a U7 downstream terminator sequence, a U1 promoter sequence, a U7 esnRNA sequence targeting DMD exon 51, a U1 downstream terminator sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A04526 (which encodes a snRNA sequence targeting DMD exon 51) comprises SEQ ID NO: 169. A04526: scAAVmU7p-z82 / 42 forward fusion-mU7 terminator_mU1p-z38 / 42 forward fusion-mU1 terminator; mouse loop with 5'ISD and eSL

[0129] An exemplary AAV vector of the present disclosure comprises, from 5' to 3', a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting DMD exon 51, a U7 downstream terminator sequence, a U1 promoter sequence, a U7 esnRNA sequence targeting DMD exon 51, a U1 downstream terminator sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A04771 (which encodes a snRNA sequence targeting DMD exon 51) comprises SEQ ID NO: 170. A04771: scAAVmU7p-z42 / 38 reverse fusion-mU7 terminator_mU1p-z42 / 38 reverse fusion-mU1 terminator; mouse loop with 5'ISD and eSL without CCU tail

[0130] An exemplary AAV vector of the present disclosure comprises, from 5' to 3', a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting DMD exon 51, a U7 downstream terminator sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting DMD exon 51, a U7 downstream terminator sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A04525 (which encodes a snRNA sequence targeting DMD exon 51) comprises SEQ ID NO: 171. A04525: scAAV-mU7p-z38 / 42-mU7Stop_mU7p-z38 / 42-mU7Stop; mouse circuit without ISD and eSL

[0131] An exemplary AAV vector of the present disclosure comprises, from 5' to 3', a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting DMD exon 51, a U7 downstream terminator sequence, a U1 promoter sequence, a U7 esnRNA sequence targeting DMD exon 51, a U1 downstream terminator sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A04527 (which encodes a snRNA sequence targeting DMD exon 51) comprises SEQ ID NO: 172. A04527: scAAV-mU7p-z38 / 42-mU7Terminate_mU1p-z38 / 42-mU1Terminate; mouse circuit without ISD and eSL

[0132] An exemplary AAV vector of the present disclosure comprises, from 5' to 3', a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting DMD exon 51, a U7 downstream terminator sequence, a U1 promoter sequence, a U7 esnRNA sequence targeting DMD exon 51, a U1 downstream terminator sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A04528 (which encodes a snRNA sequence targeting DMD exon 51) comprises SEQ ID NO: 173. A04528: scAAV-mU7p-z38 / 42-mU7Term_mU1p-z38 / 42-mU1Term; human circumplex with ISD and eSL

[0133] An exemplary AAV vector of the present disclosure comprises, from 5' to 3', a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting DMD exon 51, a U7 downstream terminator sequence, a U1 promoter sequence, a U7 esnRNA sequence targeting DMD exon 51, a U1 downstream terminator sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A04529 (which encodes a snRNA sequence targeting DMD exon 51) comprises SEQ ID NO: 174. A04529: scAAV-mU7p-z38 / 42-mU7stop_mU1p-z38 / 42-mU1stop; human loop with ISD and eSL and added CCU tail

[0134] An exemplary AAV vector of the present disclosure comprises, from 5' to 3', a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting DMD exon 51, a U7 downstream terminator sequence, a U1 promoter sequence, a U7 esnRNA sequence targeting DMD exon 51, a U1 downstream terminator sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A04537 (which encodes a snRNA sequence targeting DMD exon 51) comprises SEQ ID NO: 175. A04537: scAAV-mU7p-z38 / 42-mU7stop_mU1promoter-p-z38 / 42-mU1stop; long mouse loop with 5'ISD and eSL

[0135] An exemplary AAV vector of the present disclosure comprises from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CUG repeat, a U7 downstream terminator sequence, a U1 promoter sequence, a U7 esnRNA sequence targeting a CUG repeat, a U1 downstream terminator sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A04233 (which encodes a snRNA sequence targeting a CUG repeat) comprises SEQ ID NO: 176. A04233: scAAV-hU7-CUGx15-hU1-CUGx15 (3' mutant ITR)

[0136] An exemplary AAV vector of the present disclosure comprises from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CUG repeat, a U7 downstream terminator sequence, a U1 promoter sequence, a U7 esnRNA sequence targeting a CUG repeat, a U1 downstream terminator sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A04234 (which encodes a snRNA sequence targeting a CUG repeat) encodes SEQ ID NO: 177. A04234: scAAV-hU7-CUGx15-hU1-CUGx15 (5' mutant ITR)

[0137] An exemplary AAV vector of the present disclosure comprises from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting CAG repeats, a U7 downstream terminator sequence, a U1 promoter sequence, a U7 esnRNA sequence targeting CAG repeats, a U1 downstream terminator sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A04390 (which encodes a snRNA sequence targeting CAG repeats) comprises SEQ ID NO: 178. A04390: scAAV 5'mITR hU7-CAG15X-hU1-CAGx15

[0138] An exemplary AAV vector of the present disclosure comprises from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CUG repeat, a U7 downstream terminator sequence, a U1 promoter sequence, a U7 esnRNA sequence targeting a CUG repeat, a U1 downstream terminator sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A04530 (which encodes a snRNA sequence targeting a CUG repeat) comprises SEQ ID NO: 231. A04530: scAAV-mU7p-CUGx15-mU1p-CUGx15; mouse loop with ISD and eSL

[0139] An exemplary AAV vector of the present disclosure comprises from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CUG repeat, a U7 downstream terminator sequence, a U1 promoter sequence, a U7 esnRNA sequence targeting a CUG repeat, a U1 downstream terminator sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A04940 (which encodes a snRNA sequence targeting a CUG repeat) comprises SEQ ID NO: 232. A04940: scAAV-mU7p-CUGx10-mU1p-CUGx10; mouse circuit with ISD and eSL without CCU

[0140] An exemplary AAV vector of the present disclosure comprises from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting CAG repeats, a U7 downstream terminator sequence, a U1 promoter sequence, a U7 esnRNA sequence targeting CAG repeats, a U1 downstream terminator sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A04533 (which encodes a snRNA sequence targeting CAG repeats) comprises SEQ ID NO: 233. A04533: scAAV-mU7p-CAGx15-mU1p-CAGx15; mouse loop with ISD and eSL

[0141] An exemplary AAV vector of the present disclosure comprises, from 5' to 3', a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting CUG repeats, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting CUG repeats, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting CUG repeats, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting CUG repeats, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting CUG repeats, a U7 downstream terminator sequence, a buffer sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A02962 (which encodes a snRNA sequence targeting CUG repeats) comprises SEQ ID NO: 120. A02962 sspAAV-4X U7 (15XCUG) targeting CUG repeats (derivative of P00369)

[0142] An exemplary AAV vector of the present disclosure comprises, from 5' to 3', a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A02963 (which encodes a non-targeting snRNA sequence) comprises SEQ ID NO: 121. A02963 ss pAAV-4X U7(NT1)(derivative of P00369)

[0143] An exemplary AAV vector of the present disclosure comprises, from 5' to 3', a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CAG repeat, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CAG repeat, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CAG repeat, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CAG repeat, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CAG repeat, a U7 downstream terminator sequence, a buffer sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A02967 (which encodes a snRNA sequence targeting a CAG repeat) comprises SEQ ID NO: 122.

[0144] A02967 ss pAAV-4X U7 targeting CAG repeats (15XCAG)

[0145] An exemplary AAV vector of the present disclosure comprises, from 5' to 3', a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CUG repeat, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CUG repeat, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CUG repeat, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CUG repeat, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CUG repeat, a U7 downstream terminator sequence, a buffer sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A03079 (which encodes a snRNA sequence targeting a CUG repeat) comprises SEQ ID NO: 123. A03079 sc pAAV-4X U7 (15XCUG) targeting CUG repeats (derivative of P00369)

[0146] An exemplary AAV vector of the present disclosure comprises, from 5' to 3', a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A03080 (which encodes a snRNA sequence targeting a non-repetitive) comprises SEQ ID NO: 124. A03080 sc pAAV-4X U7(NT1)(derivative of P00369)

[0147] An exemplary AAV vector of the present disclosure comprises, from 5' to 3', a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CAG repeat, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CAG repeat, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CAG repeat, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CAG repeat, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CAG repeat, a U7 downstream terminator sequence, a buffer sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A03081 (which encodes a snRNA sequence targeting a CAG repeat) comprises SEQ ID NO: 125. A03081 sc pAAV-4X U7 targeting CAG repeats (15XCAG)

[0148] An exemplary AAV vector of the present disclosure comprises from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting CUG repeats, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), a sv40 poly A sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A02888 (which encodes a snRNA sequence targeting CUG repeats) comprises SEQ ID NO: 126. A02888 pAAV_1xU7(15xCUG)_CMV_GFP targeting CUG repeats (no buffer)

[0149] An exemplary AAV vector of the present disclosure comprises from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), a sv40 poly A sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A02889 (which encodes a snRNA sequence targeting a non-targeting repeat) comprises SEQ ID NO: 127. A02889 pAAV_1xU7(NT1)_CMV_GFP (no buffer)

[0150] An exemplary AAV vector of the present disclosure comprises from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CAG repeat, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), a sv40 poly A sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A02925 (which encodes a snRNA sequence targeting a CAG repeat) comprises SEQ ID NO: 128. A02925 pAAV_1xU7(15xCAG)_CMV_GFP targeting CAG repeats (no buffer)

[0151] An exemplary AAV vector of the present disclosure comprises from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting CUG repeats, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting CUG repeats, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting CUG repeats, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), a sv40 poly A sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A02894 (which encodes a snRNA sequence targeting CUG repeats) comprises SEQ ID NO: 129. A02894 pAAV_3xU7(15xCUG)_CMV_GFP targeting CUG repeats (100 bp buffer)

[0152] An exemplary AAV vector of the present disclosure comprises from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), a sv40 poly A sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A02895 (which encodes a non-targeting snRNA sequence) comprises SEQ ID NO: 130. A02895 pAAV_3xU7(NT1)_CMV_GFP (100 bp buffer)

[0153] An exemplary AAV vector of the present disclosure comprises, from 5' to 3', a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting CAG repeats, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting CAG repeats, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting CAG repeats, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), a sv40 poly A sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A02968 (which encodes a snRNA sequence targeting CAG repeats) comprises SEQ ID NO: 131. A02968 pAAV_3xU7(15XCAG)_CMV_GFP targeting CAG repeats (100 bp buffer)

[0154] An exemplary AAV vector of the present disclosure comprises, from 5' to 3', a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CUG repeat, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CUG repeat, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CUG repeat, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), a sv40 poly A sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A02896 (which encodes a snRNA sequence targeting a CUG repeat) comprises SEQ ID NO: 132. A02896 pAAV_3xU7(15xCUG)_CMV_GFP(500bp buffer)

[0155] An exemplary AAV vector of the present disclosure comprises from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), a sv40 poly A sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A02897 (which encodes a snRNA sequence targeting a non-targeting repeat) comprises SEQ ID NO: 133. A02897 pAAV_3xU7(NT1)_CMV_GFP (500bp buffer)

[0156] An exemplary AAV vector of the present disclosure comprises, from 5' to 3', a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting CAG repeats, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting CAG repeats, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting CAG repeats, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), a sv40 poly A sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A02969 (which encodes a snRNA sequence targeting CAG repeats) comprises SEQ ID NO: 134. A02969 pAAV_3xU7(15xCAG)_CMV_GFP targeting CAG repeats (500 bp buffer)

[0157] An exemplary AAV vector of the present disclosure comprises, from 5' to 3', a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting DMD exon 51, a U7 downstream terminator sequence, a U1 promoter sequence, a U7 esnRNA sequence targeting DMD exon 51, a U1 downstream terminator sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A03980 (which encodes a snRNA sequence targeting DMD exon 51) comprises SEQ ID NO: 135. A03980: pAAV (ssAAV) U7 promoter-esnRNA-z38 / 42-U7 terminator-U1 promoter-esnRNAz38 / z42-U1 terminator

[0158] An exemplary AAV vector of the present disclosure comprises, from 5' to 3', a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting DMD exon 51, a U7 downstream terminator sequence, a U1 promoter sequence, a U7 esnRNA sequence targeting DMD exon 51, a U1 downstream terminator sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A03981 (which encodes a snRNA sequence targeting DMD exon 51) comprises SEQ ID NO: 136. A03981: pAAV (ssAAV)_U7 promoter-esnRNA-z42-U7 stop-U1 promoter-esnRNA-z38-U1 stop

[0159] An exemplary AAV vector of the present disclosure comprises, from 5' to 3', a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting DMD exon 51, a U7 downstream terminator sequence, a U1 promoter sequence, a U7 esnRNA sequence targeting DMD exon 51, a U1 downstream terminator sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A04229 (which encodes a snRNA sequence targeting DMD exon 51) comprises SEQ ID NO: 137.

[0160] A04229: pAAV (scAAV) U7 promoter-esnRNA-z38 / 42-U7 terminator-U1 promoter-esnRNAz38 / z42-U1 terminator-mutant ITR

[0161] An exemplary AAV vector of the present disclosure comprises from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting DMD exon 51, a U7 downstream terminator sequence, a buffer sequence, a U1 promoter sequence, a U7 esnRNA sequence targeting DMD exon 51, a U1 downstream terminator sequence, a buffer sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A04184 (which encodes a snRNA sequence targeting DMD exon 51) comprises SEQ ID NO: 138. A04184: pAAV (ssAAV)-U7 promoter-z38 / 42-U7 terminator_U1 promoter-z38 / 42-U1 terminator_buffer combination sequence

[0162] An exemplary AAV vector of the present disclosure comprises from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CUG repeat, a U7 downstream terminator sequence, a buffer sequence, a U1 promoter sequence, a U7 esnRNA sequence targeting a CUG repeat, a U1 downstream terminator sequence, an eCMV promoter sequence, a sequence encoding GFP, a poly A sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A03681 (which encodes a snRNA sequence targeting a CUG repeat) comprises SEQ ID NO: 139. A03681: pAAV (ssAAV)-U7 promoter-zCUGx15-U7 terminator_U1 promoter-zCUGx15-U1 terminator-eCMV-eGFP

[0163] An exemplary AAV vector of the present disclosure comprises from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U1 promoter sequence, a U7 esnRNA sequence targeting a CUG repeat, a U1 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CUG repeat, a U7 downstream terminator sequence, an eCMV promoter sequence, a sequence encoding GFP, a poly A sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A03682 (which encodes a snRNA sequence targeting a CUG repeat) comprises SEQ ID NO: 140. A03682: pAAV (ssAAV)-U1 promoter-zCUGx15-U1 terminator_U7 promoter-zCUGx15-U7 terminator-eCMV-eGFP

[0164] An exemplary AAV vector of the present disclosure comprises, from 5' to 3', a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U1 promoter sequence, a non-targeting U7 esnRNA sequence, a U1 downstream terminator sequence, an eCMV promoter sequence, a sequence encoding GFP, a poly A sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A03683 (which encodes the non-targeting snRNA sequence) comprises SEQ ID NO: 141. A03683: pAAV (ssAAV) -U7 promoter-znt-U7 stop_U1 promoter-znt-U1 stop-eCMV-eGFP

[0165] An exemplary AAV vector of the present disclosure comprises from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CUG repeat, a U7 downstream terminator sequence, a buffer sequence, a U1 promoter sequence, a U7 esnRNA sequence targeting a CUG repeat, a U1 downstream terminator sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A03684 (which encodes a snRNA sequence targeting a CUG repeat) comprises SEQ ID NO: 142. A03864: pAAV (ssAAV)-U7 promoter-zCUGx15-U7 terminator_U1 promoter-zCUGx15-U1 terminator (derivative minus GFP-3681)

[0166] An exemplary AAV vector of the present disclosure comprises from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a U7 esnRNA sequence targeting a CUG repeat, a U7 downstream terminator sequence, a buffer sequence, a U1 promoter sequence, a U7 esnRNA sequence targeting a CUG repeat, a U1 downstream terminator sequence, and a second ITR sequence. In some aspects, the nucleic acid sequence encoding the AAV vector A04233 (which encodes a snRNA sequence targeting a CUG repeat) comprises SEQ ID NO: 143. A04233: pAAV (scAAV)-U7 promoter-zCUGx15-U7 terminator-U1 promoter-zCUGx15-U1 terminator (derivative of A03681, no GFP in scAAV) Promoter sequence

[0167] The gene therapy and RNA-targeting snRNA gene therapy compositions of the present disclosure comprise a promoter sequence derived from a snRNA.

[0168] A "promoter" is a control sequence that is a region in a polynucleotide sequence that controls the initiation and rate of transcription. It may contain genetic elements to which regulatory proteins and molecules can bind, such as RNA polymerase and other transcription factors.

[0169] In some embodiments of the compositions and methods of the present disclosure, the expression vectors, viral vectors or non-viral vectors provided herein include, but are not limited to, expression control elements. As used herein, "expression control element" refers to any sequence that regulates the expression of a coding sequence such as a gene. Exemplary expression control elements include, but are not limited to, promoters, enhancers, microRNAs, post-transcriptional regulatory elements, polyadenylation signal sequences, and introns. For example, expression control elements can be constitutive, inducible, repressive, or tissue-specific. A "promoter" is the following control sequence, which is a region in a polynucleotide sequence that controls the initiation and rate of transcription. It can contain genetic elements to which regulatory proteins and molecules can bind, such as RNA polymerases and other transcription factors. An "enhancer" is a region in DNA that can be bound by an activator protein to increase the probability or frequency of transcription.

[0170] In some embodiments of the compositions and methods of the present disclosure, the expression vectors, viral vectors, or non-viral vectors provided herein include, but are not limited to, vector elements such as buffer sequences derived from human genomic sequences downstream of the snRNA, and thus will have encoding for multiple snRNAs from a single construct.

[0171] In some embodiments, when the coding sequence is incorporated into the compositions disclosed herein, the polycistronic vector can express two or more independent proteins from the same mRNA simultaneously. The two strategies most widely used to construct the polycistronic configuration are by using IRES or 2A self-cleavage sites. "IRES" refers to the internal ribosome entry site or its part of the virus, prokaryotic or eukaryotic origin used in the polycistronic vector construct. In some embodiments, IRES is an RNA element that allows translation initiation in a cap-independent manner. The term "self-cleavage peptide" or "sequence encoding self-cleavage peptide" or "2A self-cleavage site" refers to the connection sequence used to incorporate the site in the vector construct to promote ribosome jumping and therefore produce two polypeptides from a single promoter, and such self-cleavage peptides include but are not limited to T2A and P2A peptides or other sequences encoding self-cleavage peptides.

[0172] In another embodiment, the vector configuration may comprise one or more linkers, one or more signal sequences, and / or one or more tags.

[0173] In some embodiments, the vector is a viral vector. In some embodiments, the vector is an adenoviral vector, an adeno-associated virus (AAV) vector or a lentiviral vector. In some embodiments, the vector is a retroviral vector, an adenovirus / retroviral chimera vector, a herpes simplex virus I or II vector, a parvovirus vector, a reticuloendotheliosis virus vector, a poliovirus vector, a papillomavirus vector, a vaccinia virus vector or any hybrid or chimeric vectors that incorporate the advantages of two or more viral vectors. In some embodiments, the vector also includes one or more expression control elements operably connected to the polynucleotide. In some embodiments, the vector further includes one or more selection markers. In some embodiments, the AAV vector has low toxicity. In some embodiments, the AAV vector is not incorporated into the host genome, so as to have a low probability of causing insertional mutagenesis. In some embodiments, the AAV vector can encode a series of total polynucleotides of 4.5kb to 4.75kb. In some embodiments, exemplary AAV vectors that can be used in any of the compositions, systems, methods, and kits described herein can include AAV1 vectors, modified AAV1 vectors, AAV2 vectors, modified AAV2 vectors, AAV2-Tyr mutant vectors, AAV3 vectors, modified AAV3 vectors, AAV4 vectors, modified AAV4 vectors, AAV5 vectors, modified AAV5 vectors, AAV6 vectors, modified AAV6 vectors, AAV7 vectors, modified AAV7 vectors, AAV8 vectors, AAV rh8 vector, AAV9 vector, AAV.rh10 vector, modified AAV.rh10 vector, AAVrh.74, AAV.rh32 / 33 vector, modified AAV.rh32 / 33 vector, AAV.rh43 vector, modified AAV.rh43 vector, AAV.rh64R1 vector and modified AAV.rh64R1 vector, AAV-Tyr mutant vector, AAV-Tyr-Ser mutant vector, AAV-Tyr-Ser-Thr mutant vector, and any combination or equivalent thereof. In some embodiments, the lentiviral vector is an integrase-competent lentiviral vector (ICLV). In some embodiments, a lentiviral vector can refer to a transgenic plasmid vector, as well as a transgenic plasmid vector combined with an associated plasmid (e.g., a packaging plasmid, a rev expression plasmid, an envelope plasmid), and a lentiviral-based particle capable of introducing exogenous nucleic acids into cells via a viral or virus-like entry mechanism.

[0174] Lentiviral vectors are well known in the art (see, e.g., Trono D. (2002) Lentiviral vectors, New York: Spring-Verlag Berlin Heidelberg and Durand et al. (2011) Viruses 3(2): 132-159 doi: 10.3390 / v3020132). In some embodiments, exemplary lentiviral vectors that can be used in any of the compositions, systems, methods, and kits described herein can include human immunodeficiency virus (HIV) 1 vectors, modified human immunodeficiency virus (HIV) 1 vectors, human immunodeficiency virus (HIV) 2 vectors, modified human immunodeficiency virus (HIV) 2 vectors, sooty mangabey simian immunodeficiency virus (SIV) 1 vectors, human immunodeficiency virus (HIV) 2 ... SM ) vector, modified white-collared mangabey monkey simian immunodeficiency virus (SIV SM ) vector, African green monkey simian immunodeficiency virus (SIV AGM ) vector, modified African green monkey simian immunodeficiency virus (SIV AGM ) vector, equine infectious anemia virus (EIAV) vector, modified equine infectious anemia virus (EIAV) vector, feline immunodeficiency virus (FIV) vector, modified feline immunodeficiency virus (FIV) vector, Visna / maedi virus (VNV / VMV) vector, modified Visna / maedi virus (VNV / VMV) vector, ovine arthritis-encephalitis virus (CAEV) vector, modified ovine arthritis-encephalitis virus (CAEV) vector, bovine immunodeficiency virus (BIV) or modified bovine immunodeficiency virus (BIV). Nucleic Acids

[0175] NOI (nucleotide sequence of interest) includes, but is not limited to, any nucleotide sequence or transgene that can be delivered by a vector. NOI can be synthetic, derived from naturally occurring DNA or RNA, codon optimized, recombinant RNA / DNA, cDNA, partial genomic DNA and / or combinations thereof. NOI can be a coding region or a partial coding region, but it is not necessarily a coding region. NOI can be RNA / DNA of sense or antisense orientation. NOI can be snRNA. NOI is also referred to herein as, but not limited to, a transgene, a heterologous sequence, a gene, a therapeutic gene. NOI can also encode RNA (ribonucleoprotein complex), POI (protein of interest), a partial POI, a mutant form or variant of POI. POI can be similar to or correspond to a wild-type protein. POI can also be a fusion protein or a ribonucleoprotein complex (such as snRNP). In some aspects, the RNA sequences disclosed herein can be expressed as DNA sequences, and obtaining the sequence of the RNA sequence from the DNA sequence is within the capabilities of a skilled technician. Codon optimization

[0176] In some embodiments, the NOI or transgene or GOI of the present disclosure (e.g., nucleic acid sequence encoding snRNA targeting RNA) is a codon-optimized nucleic acid sequence. In some embodiments, the codon-optimized sequence exhibits at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300%, at least 500%, or at least 1000% increased transcription or translation relative to a wild-type or non-codon-optimized nucleic acid sequence in a human subject.

[0177] In some aspects, codon optimized nucleic acid sequences show increased stability. In some aspects, codon optimized nucleic acid sequences show increased stability by increased resistance to hydrolysis. In some embodiments, codon optimized sequences show at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300%, at least 500% or at least 1000% increased stability relative to wild type or non-codon optimized nucleic acid sequences. In some embodiments, in human subjects, codon optimized sequences show at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300%, at least 500% or at least 1000% increased resistance to hydrolysis relative to wild type or non-codon optimized nucleic acid sequences.

[0178] In some respects, codon optimized nucleotide sequence may not include donor splice site. In some respects, codon optimized nucleotide sequence may include no more than about one, or about two, or about three, or about four, or about five, or about six, or about seven, or about eight, or about nine, or about ten donor splice sites. In some respects, compared with non-codon optimized nucleotide sequence, codon optimized nucleotide sequence includes less than at least one, or at least two, or at least three, or at least four, or at least five, or at least six, or at least seven, or at least eight, or at least nine, or at least ten donor splice sites.

[0179] Without wishing to be bound by theory, removing the donor splice site in a codon-optimized nucleic acid sequence can unexpectedly and unpredictably increase the expression of the target protein in vivo, because concealed splicing is prevented. In addition, concealed splicing may vary between different subjects, which means that the expression level of the protein comprising the donor splice site may vary unpredictably between different subjects. This unpredictability is unacceptable in the context of human therapy. Therefore, the codon-optimized nucleic acid sequence lacking the donor splice site unexpectedly and surprisingly allows the expression of protein in human subjects to increase, and normalizes the expression of protein in different human subjects.

[0180] In some aspects, the codon-optimized nucleic acid sequence can have a GC content different from the GC content of the non-codon-optimized nucleic acid sequence encoding the snRNA of the targeting RNA. In some aspects, the GC content of the codon-optimized nucleic acid sequence is more evenly distributed over the entire nucleic acid sequence compared to the non-codon-optimized nucleic acid sequence.

[0181] Without wishing to be bound by theory, by distributing the GC content more evenly throughout the nucleic acid sequence, the codon-optimized nucleic acid sequence exhibits a more uniform melting temperature ("Tm") over the length of the transcript. The uniformity of the melting temperature unexpectedly results in increased expression of the codon-optimized nucleic acid in a human subject because there is less stalling of the polymerase and / or ribosome when transcription and / or translation of the nucleic acid sequence occurs.

[0182] In some respects, compared with non-codon optimized nucleic acid sequences, codon optimized nucleic acid sequences can have less inhibitory microRNA target binding sites. In some respects, compared with non-codon optimized nucleic acid sequences, codon optimized nucleic acid sequences can have less than at least one, or at least two, or at least three, or at least four, or at least five, or at least six, or at least seven, or at least eight, or at least nine, or at least ten, or at least ten inhibitory microRNA target binding sites.

[0183] Without wishing to be bound by theory, codon-optimized nucleic acid sequences unexpectedly exhibit increased expression in human subjects by having fewer inhibitory microRNA target binding sites.

[0184] Provided herein are nucleic acid sequences encoding snRNA systems of gene therapy compositions or targeting RNAs, which are used in gene transfer and expression techniques described herein. Although not always explicitly stated, it should be understood that the sequences provided herein can be used to provide expression products and substantially identical sequences encoding RNA or expressing and producing proteins with the same biological properties. These "bioequivalent" or "biologically active" or "equivalent" polypeptides are encoded by equivalent polynucleotides as described herein. When compared using a sequence identity method run under default conditions, they can have a primary amino acid sequence that is at least 60%, or alternatively at least 65%, or alternatively at least 70%, or alternatively at least 75%, or alternatively at least 80%, or alternatively at least 85%, or alternatively at least 90%, or alternatively at least 95%, or alternatively at least 98% identical to a reference polypeptide. Specific polypeptide sequences are provided as examples of specific embodiments. Amino acids in the sequence are modified with alternative amino acids having similar charges. In addition, an equivalent polynucleotide is a polynucleotide that hybridizes to a reference polynucleotide or its complement under stringent conditions, or, in the case of a polypeptide, a polypeptide encoded by a polynucleotide that hybridizes to a reference encoding polynucleotide or its complement under stringent conditions. Alternatively, an equivalent polypeptide or protein is a polypeptide or protein expressed from an equivalent polynucleotide.

[0185] The NOI or nucleic acid sequence (e.g., polynucleotide sequence) disclosed herein may be codon optimized, and codon optimization is a technique well known in the art. Codon optimization relates to the fact that different cells differ in the use of specific codons. The codon bias corresponds to the bias of the relative abundance of a specific tRNA in a cell type. Expression may be increased by changing the codons in the sequence to match the relative abundance of the corresponding tRNA. Expression may also be reduced by deliberately selecting codons that are known to be rare in a specific cell type. Codon usage tables for mammalian cells and a variety of other organisms are known in the art. Based on the genetic code, nucleic acid sequences encoding, for example, esnRNA and esnRNA may be generated. In some embodiments, such sequences are optimized for expression in a host cell or a target cell, such as a host cell for expressing esnRNA or a cell in which the disclosed method is practiced (e.g., in a mammalian cell, such as a human cell). The codon preference and codon usage table of a particular species can be used to engineer an isolated nucleic acid molecule encoding esnRNA using the codon usage preference of the particular species. For example, the esnRNA disclosed herein can be designed to have codons that are preferentially used by a specific target organism. In one example, the esnRNA nucleic acid sequence is optimized for expression in human cells, such as an esnRNA nucleic acid sequence having at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity with its corresponding wild-type or origin nucleic acid sequence. In some embodiments, an isolated nucleic acid molecule encoding at least one esnRNA (which may be part of a vector) includes at least one esnRNA coding sequence that is codon-optimized for expression in eukaryotic cells or at least one esnRNA coding sequence that is codon-optimized for expression in human cells. In one embodiment, such a codon-optimized esnRNA coding sequence has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with its corresponding wild-type or origin sequence. In another embodiment, the eukaryotic codon-optimized nucleic acid sequence encodes an esnRNA that has at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to its corresponding wild-type or origin sequence. In another embodiment, multiple clones containing functionally equivalent nucleic acids, which are nucleic acids that differ in sequence but encode the same esnRNA sequence, can be routinely generated. Silent mutations in coding sequences are due to the degeneracy (i.e., redundancy) of the genetic code, whereby more than one codon can encode the same amino acid residue.Thus, for example, leucine can be encoded by CTT, CTC, CTA, CTG, TTA or TTG; serine can be encoded by TCT, TCC, TCA, TCG, AGT or AGC; asparagine can be encoded by AAT or AAC; aspartic acid can be encoded by GAT or GAC; cysteine ​​can be encoded by TGT or TGC; alanine can be encoded by GCT, GCC, GCA or GCG; glutamine can be encoded by CAA or CAG; tyrosine can be encoded by TAT or TAC; and isoleucine can be encoded by ATT, ATC or ATA. Tables showing standard genetic codes can be found in multiple sources (see, e.g., Stryer, 1988, Biochemistry, 3rd edition, WH5 Freeman and Co., NY).

[0186] "Hybridization" refers to the reaction of one or more polynucleotides to form a complex stabilized by hydrogen bonding between the bases of the nucleotide residues. Hydrogen bonding can be carried out by Watson-Crick base pairing, Hoogstein binding, or in any other sequence-specific manner. The complex can contain two chains forming a duplex structure, three or more chains forming a multi-stranded complex, a single self-hybridizing chain, or any combination of these. The hybridization reaction can constitute a step in a broader process (such as the initiation of a PC reaction or the enzymatic cleavage of a polynucleotide by a ribozyme).

[0187] Examples of stringent hybridization conditions include: an incubation temperature of about 25°C to about 37°C; a hybridization buffer concentration of about 6x SSC to about 10x SSC; a formamide concentration of about 0% to about 25%; and a washing solution of about 4x SSC to about 8x SSC. Examples of moderate hybridization conditions include: an incubation temperature of about 40°C to about 50°C; a buffer concentration of about 9x SSC to about 2x SSC; a formamide concentration of about 30% to about 50%; and a washing solution of about 5x SSC to about 2x SSC. Examples of high stringency conditions include: an incubation temperature of about 55°C to about 68°C; a buffer concentration of about 1x SSC to about 0.1x SSC; a formamide concentration of about 55% to about 75%; and a washing solution of about 1x SSC, 0.1x SSC, or deionized water. Typically, the hybridization incubation time is 5 minutes to 24 hours, with 1, 2 or more washing steps, and the wash incubation time is about 1, 2 or 15 minutes. SSC is 0.15 M NaCl and 15 mM citrate buffer. It will be appreciated that the equivalent of SSC using other buffer systems may be employed.

[0188] "Homology" or "identity" or "similarity" refers to the degree of sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing positions in each sequence, which can be aligned for comparison purposes. When a position in the compared sequences is occupied by the same base or amino acid, then the molecules are homologous at that position. The degree of homology between sequences varies with the number of matching or homologous positions shared by the sequences. "Unrelated" or "non-homologous" sequences share less than 40% identity with one of the sequences of the invention, or alternatively less than 25% identity. cell

[0189] In some embodiments of the compositions and methods of the disclosure, the cells of the disclosure are prokaryotic cells.

[0190] In some embodiments of the compositions and methods of the present disclosure, the cells of the present disclosure are eukaryotic cells. In some embodiments, the cells are mammalian cells. In some embodiments, the cells are bovine, mouse, cat, horse, pig, dog, monkey, or human cells. In some embodiments, the cells are non-human mammalian cells, such as non-human primate cells.

[0191] In some embodiments, the cells of the present disclosure are somatic cells. In some embodiments, the cells of the present disclosure are sex cells. In some embodiments, the sex cells of the present disclosure are not human cells.

[0192] In some embodiments of the compositions and methods of the present disclosure, the cells of the present disclosure are stem cells. In some embodiments, the cells of the present disclosure are embryonic stem cells. In some embodiments, the embryonic stem cells of the present disclosure are not human cells. In some embodiments, the cells of the present disclosure are pluripotent stem cells or multipotent stem cells. In some embodiments, the cells of the present disclosure are adult stem cells. In some embodiments, the cells of the present disclosure are induced pluripotent stem cells (iPSC). In some embodiments, the cells of the present disclosure are hematopoietic stem cells (HSC).

[0193] In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are neuronal cells. In one embodiment, one or more cells of a patient treated with a composition disclosed herein include, but are not limited to, central nervous system (neurons), peripheral nervous system (neurons), peripheral motor neurons, and / or sensory neurons. In one embodiment, the neuronal cells are glial cells.

[0194] In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are fibroblasts or epithelial cells. In some embodiments, the epithelial cells of the present disclosure form squamous cell epithelium, cuboidal cell epithelium, columnar cell epithelium, stratified cell epithelium, pseudostratified columnar cell epithelium or transitional cell epithelium. In some embodiments, the epithelial cells of the present disclosure form glands, including but not limited to the pineal gland, thymus, pituitary gland, thyroid gland, adrenal gland, apical secretory gland, holocrine gland, local secretory gland, serous gland, mucous gland and sebaceous gland. In some embodiments, the epithelial cells of the present disclosure contact the outer surface of an organ, including but not limited to the lung, spleen, stomach, pancreas, bladder, intestine, kidney, gallbladder, liver, larynx or pharynx. In some embodiments, the epithelial cells of the present disclosure contact the outer surface of a blood vessel or vein.

[0195] In some embodiments of the present disclosure, somatic cells are eye cells. Eye cells include but are not limited to corneal epithelial cells, keratinocytes, retinal pigment epithelial (RPE) cells, lens epithelial cells, iris pigment epithelial cells, conjunctival fibroblasts, non-pigmented ciliary epithelial cells, trabecular meshwork cells, choroidal fibroblasts, conjunctival epithelial cells. In some embodiments, eye cells are retinal cells or keratocytes. In one embodiment, retinal cells are photoreceptor cells or retinal pigment epithelial cells. In another embodiment, retinal cells are ganglion cells, amacrine cells, bipolar cells, horizontal cells, Muller glial cells, rod cells or cone cells. In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are primary cells.

[0196] In some embodiments of the compositions and methods of the disclosure, the somatic cells of the disclosure are cultured cells.

[0197] In some embodiments of the compositions and methods of the disclosure, the somatic cells of the disclosure are in vivo, in vitro, ex vivo, or in situ.

[0198] In some embodiments of the compositions and methods of the disclosure, the somatic cells of the disclosure are autologous or allogeneic. How to use

[0199] The present disclosure provides a method of encoding RNA or expressing NOI in a cell using the snRNA system disclosed herein. In one embodiment, the present disclosure provides a method of modifying the activity of RNA or a protein encoded by an RNA molecule, the method comprising contacting a composition of the present disclosure with a target RNA molecule under conditions suitable for binding to the RNA molecule.

[0200] The present disclosure provides a method for modifying the expression level of an RNA molecule of the present disclosure or a protein encoded by an RNA molecule, the method comprising contacting a composition of the present disclosure with a cell containing the RNA molecule under conditions suitable for binding to the RNA molecule. In some embodiments, the cell is in vivo, in vitro, ex vivo or in situ. In some embodiments, the composition of the present disclosure comprises a vector comprising a snRNA sequence. In some embodiments, the vector is AAV.

[0201] The present disclosure provides a method for modifying the expression level of an RNA molecule of the present disclosure or a protein encoded by an RNA molecule, the method comprising contacting a composition of the present disclosure with an RNA molecule under conditions suitable for knocking down, blocking, splicing, multi-targeting or editing a target RNA. In some embodiments, the vector is AAV.

[0202] The present disclosure provides a method for modifying the activity of a target RNA or a protein encoded by an RNA molecule, the method comprising contacting a composition with a cell comprising an RNA molecule under conditions suitable for knocking down, blocking, splicing, multi-targeting or editing the target RNA. In some embodiments, the cell is in vivo, in vitro, ex vivo or in situ. In some embodiments, the composition comprises a vector comprising a snRNA sequence disclosed herein. In some embodiments, the vector is AAV.

[0203] The present disclosure provides a method of treating a disease or disorder, the method comprising administering to a subject a therapeutically effective amount of a snRNA composition of the present disclosure.

[0204] The present disclosure provides a method for treating a disease in a patient in need of such treatment, the method comprising administering to the patient a therapeutically effective amount of an snRNA composition of the present disclosure, wherein the composition comprises a vector comprising an snRNA sequence disclosed herein, wherein the composition modifies, reduces, destroys, knocks down or ablates the expression level of toxic repeat RNA (compared to the expression level of toxic repeat RNA treated with a non-targeting (NT) control or compared to untreated). In another embodiment, the reduction level is 1-fold or greater. In another embodiment, the reduction level is 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold or 10-fold. In another embodiment, the reduction level is 10-fold or greater. In another embodiment, the reduction level is between 10-fold and 20-fold. In another embodiment, the reduction level is 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold or 20-fold. In another embodiment, when administered to a patient, the gene therapy composition disclosed herein results in 20%-100% destruction of toxic repeat RNA. In one embodiment, the % elimination of toxic repetitive RNA is any one of 20%-99%, 25%-99%, 50%-99%, 80%-99%, 90%-99%, 95%-99%. In one embodiment, the % elimination is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. In another embodiment, the % elimination is complete elimination or 100% elimination of toxic repetitive RNA.

[0205] The present disclosure provides a method of treating a disease or disorder in a subject, the method comprising administering a nucleic acid molecule targeting an RNA (ie, an esnRNA of the present disclosure) or an AAV vector comprising an esnRNA of the present disclosure.

[0206] In some aspects, the disease or disorder is associated with a toxic repeat RNA sequence. In some aspects, the toxic repeat RNA sequence is a CAG, CUG, GGCCCC, CCGGG or GGCCC+CCGGGG RNA repeat.

[0207] In some aspects, the disease or disorder is myotonic dystrophy (DM1) or Huntington's disease (HD).

[0208] In some respects, disease or obstacle is Duchenne muscular dystrophy.In some respects, the nucleic acid molecule of targeting RNA or AAV vector targeting coding dystrophin (DMD) RNA sequence.In some respects, the RNA sequence encoding DMD comprises intron sequence or exon sequence.In some respects, described exon sequence comprises exon 51 or its flanking region of DMD.

[0209] In some embodiments of the methods of the present disclosure, the subject of the present disclosure has been diagnosed with the disease to be treated. In some embodiments, the subject of the present disclosure presents at least one sign or symptom of the disorder or disease to be treated. In some embodiments, the subject of the present disclosure presents at least one sign or symptom of the disease.

[0210] In some embodiments of the method of the present disclosure, the subject of the present disclosure is female. In some embodiments of the method of the present disclosure, the subject of the present disclosure is male. In some embodiments, the subject of the present disclosure has two XX or XY chromosomes. In some embodiments, the subject of the present disclosure has two XX or XY chromosomes and a third chromosome (X or Y).

[0211] In some embodiments of the methods of the present disclosure, the subject of the present disclosure is a newborn, infant, child, adult, older adult or elderly. In some embodiments of the methods of the present disclosure, the subject of the present disclosure is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or 31 days old. In some embodiments of the methods of the present disclosure, the subject of the present disclosure is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months old. In some embodiments of the methods of the disclosure, the subject of the disclosure is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 years old, or any number or fraction therebetween.

[0212] In some embodiments of the methods of the present disclosure, the subject of the present disclosure is a mammal. In some embodiments, the subject of the present disclosure is a non-human mammal.

[0213] In some embodiments of the methods of the present disclosure, the subject of the present disclosure is a human.

[0214] In some embodiments of the methods of the present disclosure, the therapeutically effective amount comprises a single dose of a composition of the present disclosure. In some embodiments, the therapeutically effective amount comprises at least one dose of a composition of the present disclosure. In some embodiments, the therapeutically effective amount comprises one or more doses of a composition of the present disclosure.

[0215] In some embodiments of the methods of the present disclosure, the therapeutically effective amount eliminates the signs or symptoms of the disease or disorder. In some embodiments, the therapeutically effective amount reduces the severity of the signs or symptoms of the disease or disorder.

[0216] In some embodiments of the methods of the present disclosure, the therapeutically effective amount eliminates the disease or disorder.

[0217] In some embodiments of the methods of the present disclosure, a therapeutically effective amount prevents the onset of a disease or disorder. In some embodiments, a therapeutically effective amount delays the onset of a disease or disorder. In some embodiments, a therapeutically effective amount reduces the severity of the signs or symptoms of the disease or disorder. In some embodiments, a therapeutically effective amount improves the prognosis of the subject.

[0218] In some embodiments of the methods of the present disclosure, the composition of the present disclosure is administered to the subject via intracerebral administration. In some embodiments, the composition of the present disclosure is administered to the subject via an intrastriatal route. In some embodiments, the composition of the present disclosure is administered to the subject by stereotactic injection or infusion. In some embodiments, the composition is administered to the brain. In some embodiments of the methods of the present disclosure, the composition of the present disclosure is administered topically to the subject. In some embodiments, the compositions disclosed herein are formulated as pharmaceutical compositions. In short, the pharmaceutical compositions for the purposes disclosed herein may include one or more proteins or polynucleotides encoding the one or more proteins in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients, the one or more proteins or polynucleotides being optionally contained in AAV, which is optionally also immunoorthogonal. The composition may include a buffer, such as neutral buffered saline, phosphate buffered saline, etc.; carbohydrates, such as glucose, mannose, sucrose or dextran, mannitol; proteins; polypeptides or amino acids, such as glycine; antioxidants; chelating agents, such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives. The compositions of the present disclosure can be formulated for routes of administration such as, for example, oral, enteral, topical, transdermal, intranasal and / or inhalation; and for routes of administration via injection or infusion such as, for example, intravenous, intramuscular, subpial, intrathecal, intraparenchymal, intrathecal, intrastriatal, subcutaneous, intradermal, intraperitoneal, intratumoral, intravenous, intraocular and / or parenteral administration. In certain embodiments, the compositions of the present disclosure are formulated for intracerebral or intrastriatal administration. Example Example 1: esnRNA targeting CUG repeats in DM1 cell model

[0219] Materials and Methods

[0220] CTG480 HeLa cells were seeded in 12-well plates at 100,000 cells / ml. The next day, snRNA was transfected using lipofectamine (2 μL P3000 and 2.5 μl lipofectamine per sample). After 24 hours, cells were trypsinized and 1 / 2 of the cells were seeded in chamber slides for FISH and the other 1 / 2 of the cells were seeded in 24-well plates for RNA analysis.

[0221] The next day, RNA was extracted for RNA analysis and cells were fixed for FISH. For FISH, CUG foci were labeled with a CUG fluorescent probe and cell nuclei were stained with DAPI.

[0222] Objective: To determine whether engineered snRNPs containing engineered stem-loops can knock down CUG expansion and, therefore, reduce the number of RNA foci in a DM1 cell model.

[0223] Rationale: U7 snRNA can be programmed to target mRNA by replacing its histone mRNA annealing sequence with a sequence complementary to the target of interest. Others have shown that U7 with 15x CAG repeats reduces the CUG repeat expansion that causes DM1 ( et al. NSMB 2011). We optimized this snRNA system by engineering a stem-loop (SEQ ID NO:1) to better stabilize the secondary structure of U7 snRNA in cells. We compared our engineered U7 stem-loop with the known U7 stem-loop ( et al. NSMB 2011). The construct contains 15x CAG repeats and an optimized Sm binding domain, which further helps stabilize the programmed U7. Constructs targeting CUG will be tested in appropriate cell models to determine if they can deplete CUG foci by binding to and blocking CUG repeats, and compared to U7 containing non-targeting (NT) sequences. See Figure 1A-Figure 1D and Figure 2A-2C .

[0224] The constructs and controls were transiently transfected into HeLa (CTG480), which has 480 CTG repeats inserted into its genome by CRISPR of model DM1 and expresses CUG foci as shown by in situ hybridization. Cells were plated and fixed on chamber slides, and RNA in situ hybridization was performed on cells using a probe for CUG and dapi for nuclear staining. Colocalization of CUG probe and DAPI signal was quantified using Halo.

[0225] Treatment with the 15xCAG esnRNA construct (used to target / block CUG repeats) significantly reduced CUG RNA foci.

[0226] The non-engineered snRNA and esnRNA constructs resulted in a 39% and 68% reduction in the mean number of foci per cell, respectively, compared to their respective non-targeting controls. Example 2: esnRNA targeting CAG repeats

[0227] Materials and Methods

[0228] HEK293T cells were seeded in 12-well plates at 150,000 cells / ml. The next day, snRNA was transfected using lipofectamine (2 μL P3000 and 2.5 μl lipofectamine per sample). Cells were transfected with a CAG reporter construct (containing 80 CAG repeats) and increasing doses (from 100 ng to 1000 ng) of a snRNA plasmid targeting CAG repeats (called CUG-15) or a control non-targeted (nt).

[0229] At 48 h post-transfection, RNA was extracted using QiaCube Connect for RNA analysis. qRT-PCR was performed to detect the expression level of the CAG reporter and normalized to the expression level of the GAPDH reference gene.

[0230] Another set of cells was used for Western blot analysis using a myc tag antibody to detect protein levels of the poly-QCAG containing reporter. GAPDH was used as a loading control.

[0231] Purpose: Mutant HTT is caused by the presence of a microsatellite repeat in exon 1 of HTT. Here, we explored whether an engineered snRNP containing an engineered stem-loop could knock down CAG microsatellite repeat RNA in a CAG80 reporter assay.

[0232] Basic principle:

[0233] U7 snRNA can be programmed to target mRNA by replacing its histone mRNA annealing sequence with a sequence complementary to the target of interest. The esnRNA system reprogrammed to target CAG repeats contains eSLs of SEQ ID NO: 1 to better stabilize the secondary structure of U7 snRNA in cells. The constructs contain 15x CUG repeats to target CAG expansion. These constructs also contain an optimized Sm binding domain, which further helps stabilize the programmed U7. Constructs targeting CAG were tested to determine whether they can knock down CAG repeats and polyQ-containing proteins compared to eSLs containing non-targeting sequences.

[0234] Complete knockdown of detectable polyQ protein was achieved with the highest 3 doses of U7. Nearly complete knockdown was achieved at the lowest U7 dose. Thus, we show herein dose-dependent knockdown of CAG80 reporter mRNA to baseline levels. See Figure 3A-3C . Example 3: esnRNA Regulation of USH2A Minigene Exon 13 Splicing

[0235] Materials and Methods

[0236] HEK293T cells were seeded at 150,000 / ml in 12-well plates. The next day, cells were transfected with 50 ng of USH2A minigene and a total of 250 ng, 500 ng, or 1 ug of pcDNA expressing non-targeting esnRNA or esnRNA targeting USH2A exon 13 using lipofectamine.

[0237] Cells were harvested 48 h after transfection. RNA was extracted using Qiacube connect, reverse transcribed, and semi-quantitative PCR was performed using primers annealing to USH2A exons 12 and 14.

[0238] Quantification of U7 was performed by PCR using primers that annealed to non-targeting esnRNA.

[0239] Rationale: Mutations in exon 13 of USH2A cause Usher syndrome type 2A. Exon 13 is an in-frame exon, and therapeutic strategies include skipping exon 13. We designed esnRNAs comprising the eSLs disclosed herein that target and anneal to the exonic splicing enhancer on exon 13 of USH2A and block inclusion of exon 13. Our programmed esnRNA system targeting USH2A exon 13 resulted in efficient exon 13 skipping on the minigene. PCR results demonstrated higher steady-state levels of the esnRNA system compared to non-engineered SLs. See Figure 4A-4D . See also Figure 1A . Example 4: Splicing correction by esnRNA-mediated CUG repeat blockade in DM1 patient myotubes

[0240] Materials and Methods

[0241] DM1 patient myotubes containing 2600 CUG repeats in the 3'UTR of DMPK were differentiated for 13 days and then esnRNA targeting 15xCUG repeats containing the eSL disclosed herein was introduced. RNA was extracted from cells 24 hours after treatment, reverse transcribed, and semi-quantitative PCR was performed for DM1 disease splicing biomarkers LDB3 exon 11, BIN1 exon 11, and DMD exon 78. Analysis of splicing isoforms was performed by calculating the percentage of healthy splicing isoforms (LDB3 exon 11 excluded isoform, BIN1 exon 11 included isoform, and DMD exon 78 included isoform) to the total signal from both disease and healthy isoforms.

[0242] Basic principle:

[0243] DM1 is caused by a CUG repeat expansion in the 3'UTR of the DMPK gene, which sequesters the MBNL protein and, therefore, leads to dysregulation of alternative splicing. An esnRNA containing the eSL disclosed herein was programmed to target CUG (15xCUG), and this resulted in a dose-dependent increase in the healthy splice isoforms of all three tested disease splicing biomarkers compared to non-targeted controls. See Figure 5A-5F . See also Figure 2C . Example 5: Testing of alternative 5' stabilizing motifs in U7-based eSLs and ISDs.

[0244] The efficacy of snRNA targeting CUGx15 with an alternative 5′ interaction stabilizing domain (ISD) in reducing RNA foci was demonstrated and confirmed by synthetic snRNA transfection in CTG480 HeLa cells followed by fluorescent in situ hybridization of CUG RNA foci. Figure 6A-6B (Light blue = alternative engineered stem-loop with corresponding 5′ ISD. Dark blue = selected engineered stem-loop and corresponding 5′ ISD. sR220004 = non-targeting snRNA.)

[0245] The expression levels of non-targeting snRNAs with alternative 5′ stabilizing domains were evaluated at 24h, 48h, and 72h after transfection of synthetic snRNAs. Figure 7A-7B sR220004 had the highest expression at all three time points; sR220088 had no detectable expression; the eSL / 5′ISD found in 004 was chosen for future constructs; sR220004 and sR220091 had the highest retention of expression at the 48h and 72h time points. Example 6: U7 snRNA efficacy and expression via PolIII and PolII promoters

[0246] snRNA expression was evaluated by qPCR in CTG480 HeLa cells when driven by different human PolIII and PolII promoters. Figure 8 The U1 promoter drives the highest level of snRNA, followed by the U7 promoter. The PolIII promoters U6 and 7SK have low expression, and the PolIII tRNA promoter has the lowest expression.

[0247] CUG foci quantification was assessed by RNA FISH in CTG480 HeLa cells. Figure 9A-9B Only the U1 and U7 promoters were clearly effective in reducing the number of CUG foci, with U1 being more effective than U7 (blue = CUG targeted; grey = non-targeted). UID Promoter, target P03490 tRNA(CUGx151 P03462 U6(CUGx15) P03465 7SK(CUGx15) P03557 U1(CUGx15) P02225 U7(CUGx15) P03491 tRNA(nt) P03463 U6(nt) P03466 7SK(nt) P03561 U1(nt) P02313 U7(nt)

[0248] snRNA expression was determined by qPCR in HEK293T cells (see Fig.10 ). When SmOpt was converted to U1 Sm binding sites, expression of U7 snRNA under the control of PolIII promoter increased by up to 25x. When the Sm site was converted to U1 Sm, expression through PolII U1 and U7 promoters was reduced. Expression through U1 and U7 promoters was superior to expression through Pol III promoter.

[0249] Transfect snRNA into HEK293T cells. Figure 11A-11B Here, znt esnRNA and z38 esnRNA expression were driven by unique snRNA promoters. These constructs were transfected into HEK293T cells. RNA was extracted and cDNA was prepared 48h after transfection. Primers specific for each snRNA (z) were used for qPCR to determine snRNA expression and relative promoter strength. Example 7: esnRNA constructs lead to DMD exon skipping of exon 51 in patient myotubes.

[0250] Transduction of human delta exon 52 myotubes was performed using the snRNA disclosed herein. Figure 12A-12B The band intensity was quantified using the amplification primers to determine the % exon 51 skipping.

[0251] Human delta exon 52 myotubes were transduced with AAV9 carrying the snRNA disclosed herein. Immunofluorescence was performed for desmin and dystrophin. Dystrophin was detected after treatment with snRNA targeting exon 51. Figure 13A-13B . Example 8: Exon 51 skipping skeletal myotubes and DMD mouse model

[0252] Human skeletal myotubes lacking exon 52 were transfected with snRNA targeting exon 51 RNA carrying fusion antisense sequences (z73 = z38 / z42 and z187 = z42 / z38) targeting the exonic splicing enhancer (ESE). Exon 51 skipping levels were quantified 24 hours after transfection with low doses of snRNA (tape station images, Fig.15A ). Human skeletal myotubes (DMD exon 52 deleted) were transduced with AAV9-A04526 (2x z73) and A04569 (2xz187). Myotubes were transduced at MOIs of 2.5e4, 1e5, and 5e5 for 7 days. Quantification of exon 51 skipping based on AAV9 ( Fig. 15B ). Mice carrying hDMD with exon 52 deletion (del52hDMD / mdx) were retro-orbitally injected with 3e12 A04526 and A04569 vector genomes. After 3 weeks of survival, RNA was extracted from the tibialis anterior (TA), gastrocnemius (Gc), and heart. Semi-quantitative RT-PCR was performed to detect bands that included and excluded exon 51. ( Fig. 15C ) shows quantification of exon 51 skipping in a humanized DMD mouse model. A dose of 3e11 vg / muscle of A04526 or Morpholino (ViM) targeting exon 51 ESE was delivered intramuscularly to the gastrocnemius muscle of del52hDMD / mdx mice. Fig.15D Quantification of dystrophin-positive fibers after 4 weeks is shown. hDMD / mdx mice expressing wild-type human dystrophin (grey bars) were used as a positive control for dystrophin expression. U = untreated. Example 9: AAV9-based splicing reversal and CUG repeat knockdown in DM1 patient-derived myotubes

[0253] DM1 patient fibroblasts were differentiated into myotubes by transduction with myoD adenoviral vector (for 5 days). Myotubes were transduced with A04233 and A04234 (scAAV9 with dual snRNA cassettes targeting CUG repeats) at MOIs of 5e4, 2e5, and 1e6 and harvested 7 days after transduction. In patient-derived myotubes (containing 1700 CUG repeats), splicing of DMD and LBD3 RNAs was reversed, as well as knockdown of DMPK, following treatment with U7 snRNA targeting CUG repeats. See Figures 16A-16D Nuclei were stained with DAPI, and CUG FISH was performed with a CUG-labeled probe. Cells were processed 7 days after transduction to quantify the average number of CUG foci per cell. Figure 17A-17B . Example 10: AAV9-based HTT knockdown in HD patient cells and HD mouse models

[0254] HD patient iPScs (containing 66 CAG repeats) were differentiated into cortical neurons for 2 weeks and then transduced with AAV-A04390 snRNA vector (2x snRNA cassette targeting CAG repeats) at 2 different MOIs for an additional 2 weeks. Cortical neurons were then harvested and mutant soluble HTT was quantified by Meso scalediscovery immunoassay. Figures 18A-18C . We then designed an in vivo study targeting CAG repeats in the R6 / 2HD mouse model. An AAV-snRNA vector targeting CAG repeats (A03081: AAVrh10-snRNA (4xsnRNA with CAGx15 TS)) was administered intrastriatically at 2e10 vector genomes, and post-treatment mutant soluble HTT protein was quantified in untreated and snRNA-treated mice (n=10) via Meso scale discovery (MSD) immunoassay. See Figure 19A-19B . Example 11: Compared with the natural stem-loop snRNA vector, the expression level of the engineered stem-loop snRNA vector is higher high.

[0255] CHO-Lec2 cells were transduced with AAV9-A04527 vector (expressing native stem-loop of z38 / 42 targeting DMD exon 51ESE) or AAV9-A04526 vector (expressing engineered stem-loop of z38 / 42 targeting DMD exon 51ESE) at an MOI of 1e6. The expression of z38 / 42 was higher in cells transduced with the engineered snRNA vector compared to the expression of z38 / 42 in cells transduced with the native stem-loop snRNA vector. Figure 20A-20B . Incorporated by Reference

[0256] Each document cited herein (including any cross-referenced or related patents or applications) is hereby incorporated by reference in its entirety unless expressly excluded or otherwise limited. Citation of any document is not an admission that it is prior art with respect to any invention disclosed or embodied herein, or that it alone or in any combination with any other reference or references teaches, suggests or discloses any such invention. In addition, to the extent that any meaning or definition of a term in this document conflicts with any meaning or definition of the same term in a document incorporated by reference, the meaning or definition assigned to that term in this document shall prevail. Other Implementations

[0257] While particular embodiments of the present disclosure have been illustrated and described, various other changes and modifications may be made without departing from the spirit and scope of the present disclosure. It is intended that the scope of the appended claims include all such changes and modifications within the scope of the present disclosure.

Claims

1. A nucleic acid molecule targeting an RNA, the nucleic acid molecule targeting an RNA comprising an engineered snRNA esnRNA, wherein the esnRNA system comprises an engineered stem-loop (eSL), the engineered stem-loop comprising one or more nucleic acid sequences selected from the group consisting of SEQ ID NO: 1-SEQ ID NO: 11, SEQ ID NO: 146-SEQ ID NO: 148, SEQ ID NO: 163, or SEQ ID NO: 186-205.

2. The RNA-targeting nucleic acid molecule of claim 1, wherein the esnRNA comprises a targeting sequence (TS) that targets a target RNA of interest.

3. The RNA-targeting nucleic acid molecule of claim 2, wherein the target RNA is a pre-mRNA or mRNA sequence.

4. The RNA-targeting nucleic acid molecule of claim 2, wherein the target RNA of interest is a microsatellite repeat RNA.

5. The RNA-targeting nucleic acid molecule of claim 4, wherein the microsatellite repeat RNA is selected from CUG, CAG, and GGGGCC+CCCCGG. The RNA-targeting nucleic acid molecule of claim 2 , wherein the target RNA is a sequence encoding DMD.

7. The RNA-targeting nucleic acid molecule of claim 6, wherein the targeting sequence is selected from SEQ ID NO: 206 or SEQ ID NO:

207.

8. The RNA-targeting nucleic acid molecule of claim 6, wherein the targeting sequence comprises one or more nucleic acid sequences shown in SEQ ID NO: 208-SEQ ID NO:

227.

9. The RNA-targeting nucleic acid molecule of claim 1, wherein the esnRNA comprises two targeting sequences targeting two RNAs of interest.

10. The RNA-targeting nucleic acid molecule of claim 9, wherein the two TSs are fusion sequences.

11. The RNA-targeting nucleic acid molecule of claim 1, wherein the esnRNA comprises a Sm binding domain (SmBD) selected from the group consisting of: U1, U2, U4, and U5 SmBD.

12. The RNA-targeting nucleic acid molecule of claim 11, wherein the SmBD comprises a nucleic acid sequence as shown in any one of SEQ ID NO:31-SEQ ID NO:38 or SEQ ID NO:

164.

13. The RNA-targeting nucleic acid molecule of claim 1, wherein the esnRNA comprises a 5' interaction stabilizer domain (5'ISD), wherein the 5' interaction stabilizer domain comprises a nucleotide sequence selected from any one of SEQ ID NO: 12-SEQ ID NO:

23.

14. The RNA-targeting nucleic acid of claim 1, wherein the esnRNA comprises a nucleic acid sequence as shown in any one of SEQ ID NO:65-SEQ ID NO:119 or SEQ ID NO:179-SEQ ID NO:

185.

15. A vector comprising one or more esnRNAs according to claim 1.

16. The vector of claim 15, wherein the viral vector is an AAV vector.

17. The AAV vector of claim 16, wherein the snRNA is operably linked to a promoter.

18. The AAV vector of claim 16, wherein the snRNA is operably linked to a U7 promoter or a U1 promoter.

19. The AAV vector of claim 6, wherein the snRNA is operably linked to a downstream terminator (DT).

20. The AAV vector of claim 16, wherein the snRNA is operably linked to a U7 downstream terminator or a U1 downstream terminator.

21. The AAV vector of claim 16, wherein the vector comprises at least one, at least two, at least three, at least four, or at least five esnRNAs.

22. The AAV vector of claim 21, wherein the at least one, at least two, at least three, at least four or at least five esnRNAs each target the same target RNA sequence.

23. The AAV vector of claim 21, wherein the at least one, at least two, at least three, at least four or at least five esnRNAs target two or more target RNA sequences.

24. The AAV vector of claim 21, wherein each esnRNA is separated by a buffer sequence.

25. The AAV vector of claim 24, wherein the buffer sequence comprises a nucleic acid sequence shown in any one of SEQ ID NO:24-SEQ ID NO:

30.

26. The AAV vector of claim 20, wherein the vector comprises a nucleic acid sequence as shown in any one of SEQ ID NO:123-SEQ ID NO:143, SEQ ID NO:168-SEQ ID NO:178, or SEQ ID NO:231-SEQ ID NO:

233.

27. A method for targeting one or more target RNAs of interest and blocking, knocking down, editing, exon skipping or splicing the one or more target RNAs, the method comprising contacting the esnRNA of claim 1 with a cell comprising the one or more target RNAs.

28. A nucleic acid molecule targeting DMD exon 51 RNA, wherein the nucleic acid molecule targeting DMD exon 51 RNA comprises a spacer sequence shown in any one of SEQ ID NO: 206 to SEQ ID NO:

230.

29. A method of treating a disease or disorder in a subject, the method comprising administering the RNA-targeting nucleic acid molecule of claim 1 or the AAV vector of claim 15.

30. The method of claim 29, wherein the disease or disorder is associated with toxic repetitive RNA sequences.

31. The method of claim 29, wherein the toxic repeat RNA sequence is CAG, CUG, GGCCCC, CCGGG, or GGCCC+CCGGGG RNA repeats.

32. The method of claim 29, wherein the disease or disorder is myotonic dystrophy (DM1) or Huntington's disease (HD).

33. The method of claim 29, wherein the disease or disorder is Duchenne muscular dystrophy.

34. The method of claim 33, wherein the RNA-targeting nucleic acid molecule or AAV vector targets an RNA sequence encoding dystrophin (DMD).

35. The method of claim 34, wherein the RNA sequence encoding DMD comprises an intron sequence or an exon sequence.

36. The method of claim 35, wherein the exon sequence comprises exon 51 of DMD or a flanking region thereof.

37. The method of claim 29, wherein the administration is intravenous, intramuscular, subpial, intrathecal, intraparenchymal, intrathecal, intrastriatal, subcutaneous, intradermal, intraperitoneal, intratumoral, intravenous, intraocular, and / or parenteral.

Images